ID: 961715288

View in Genome Browser
Species Human (GRCh38)
Location 3:128853556-128853578
Sequence GTTTTGGTGCTCCGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961715277_961715288 21 Left 961715277 3:128853512-128853534 CCTGGGAGACACTTGCCTTCAAA No data
Right 961715288 3:128853556-128853578 GTTTTGGTGCTCCGGAAGGCAGG No data
961715279_961715288 6 Left 961715279 3:128853527-128853549 CCTTCAAAGTGAAAGGAAATCCT No data
Right 961715288 3:128853556-128853578 GTTTTGGTGCTCCGGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961715288 Original CRISPR GTTTTGGTGCTCCGGAAGGC AGG Intergenic