ID: 961715654

View in Genome Browser
Species Human (GRCh38)
Location 3:128855752-128855774
Sequence GCTTCTGGAGTCACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961715650_961715654 8 Left 961715650 3:128855721-128855743 CCTCAAGCTTCAGCTGTGCATAG 0: 4
1: 10
2: 13
3: 53
4: 204
Right 961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961715654 Original CRISPR GCTTCTGGAGTCACCAGAGC AGG Intergenic
No off target data available for this crispr