ID: 961716477

View in Genome Browser
Species Human (GRCh38)
Location 3:128861106-128861128
Sequence GTGGGGTGCAGGAGGTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961716468_961716477 -2 Left 961716468 3:128861085-128861107 CCTATGGTAAGCACCATCTGCGT No data
Right 961716477 3:128861106-128861128 GTGGGGTGCAGGAGGTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961716477 Original CRISPR GTGGGGTGCAGGAGGTGAAG GGG Intergenic
No off target data available for this crispr