ID: 961718275

View in Genome Browser
Species Human (GRCh38)
Location 3:128873874-128873896
Sequence ATGGAGTCCATCGTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961718275_961718278 -4 Left 961718275 3:128873874-128873896 CCTGGGGCCACGATGGACTCCAT No data
Right 961718278 3:128873893-128873915 CCATGTTTGAGTGTTTAGTCTGG No data
961718275_961718279 4 Left 961718275 3:128873874-128873896 CCTGGGGCCACGATGGACTCCAT No data
Right 961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961718275 Original CRISPR ATGGAGTCCATCGTGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr