ID: 961718276

View in Genome Browser
Species Human (GRCh38)
Location 3:128873881-128873903
Sequence CTCAAACATGGAGTCCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961718276_961718279 -3 Left 961718276 3:128873881-128873903 CCACGATGGACTCCATGTTTGAG No data
Right 961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961718276 Original CRISPR CTCAAACATGGAGTCCATCG TGG (reversed) Intergenic
No off target data available for this crispr