ID: 961718279

View in Genome Browser
Species Human (GRCh38)
Location 3:128873901-128873923
Sequence GAGTGTTTAGTCTGGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961718276_961718279 -3 Left 961718276 3:128873881-128873903 CCACGATGGACTCCATGTTTGAG No data
Right 961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG No data
961718272_961718279 18 Left 961718272 3:128873860-128873882 CCAAGCGCAAAGGCCCTGGGGCC No data
Right 961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG No data
961718274_961718279 5 Left 961718274 3:128873873-128873895 CCCTGGGGCCACGATGGACTCCA No data
Right 961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG No data
961718275_961718279 4 Left 961718275 3:128873874-128873896 CCTGGGGCCACGATGGACTCCAT No data
Right 961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961718279 Original CRISPR GAGTGTTTAGTCTGGATTCC TGG Intergenic
No off target data available for this crispr