ID: 961723291

View in Genome Browser
Species Human (GRCh38)
Location 3:128909841-128909863
Sequence AAGGGAAAACAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 1007}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961723284_961723291 3 Left 961723284 3:128909815-128909837 CCTCCCTGAATCTAGAGCTCAAA 0: 1
1: 0
2: 3
3: 24
4: 128
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007
961723285_961723291 0 Left 961723285 3:128909818-128909840 CCCTGAATCTAGAGCTCAAAGAG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007
961723282_961723291 5 Left 961723282 3:128909813-128909835 CCCCTCCCTGAATCTAGAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 169
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007
961723283_961723291 4 Left 961723283 3:128909814-128909836 CCCTCCCTGAATCTAGAGCTCAA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007
961723281_961723291 11 Left 961723281 3:128909807-128909829 CCTTAACCCCTCCCTGAATCTAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007
961723280_961723291 21 Left 961723280 3:128909797-128909819 CCTGGTCTTGCCTTAACCCCTCC 0: 1
1: 0
2: 0
3: 7
4: 235
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007
961723286_961723291 -1 Left 961723286 3:128909819-128909841 CCTGAATCTAGAGCTCAAAGAGA 0: 1
1: 0
2: 2
3: 12
4: 177
Right 961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 71
4: 1007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961723291 Original CRISPR AAGGGAAAACAGAAGGTGGC TGG Intronic
900098390 1:949828-949850 AAGGGGAATCAGAACGTGCCTGG + Intronic
900201685 1:1410608-1410630 AAGGGAACGCAGAGGCTGGCGGG + Intergenic
901175260 1:7294166-7294188 AGGGGATAACCCAAGGTGGCAGG + Intronic
901748356 1:11389679-11389701 AAAAGAAAACACAAGGCGGCTGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902281663 1:15379160-15379182 AAGGGAACTCAGAGGCTGGCGGG - Intronic
902604590 1:17561738-17561760 AAAGGAAAACAAAAAGTGGAAGG - Intronic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903342642 1:22664101-22664123 AAGGGGAAAAGGAAGGTGTCTGG - Intergenic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
904028983 1:27522256-27522278 AAGGGAACTCTGCAGGTGGCTGG + Intergenic
904269197 1:29338225-29338247 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
904272586 1:29360125-29360147 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905762628 1:40572829-40572851 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906209107 1:44002480-44002502 GAGGGAAACCGGAAGGGGGCTGG - Intronic
906218831 1:44061309-44061331 AAGGGACTACAGAAGGTTGGAGG - Intergenic
906404238 1:45528903-45528925 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
906498277 1:46321098-46321120 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
907120887 1:52007046-52007068 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
907138532 1:52162469-52162491 AAGGGCAAACAGAAAGGAGCTGG - Intronic
907341094 1:53736977-53736999 AAGGGAAAAAAAAAGGGGGGAGG + Intergenic
907462145 1:54611499-54611521 AAGGGATATCAGAAGGGGGAAGG - Intronic
907849792 1:58245249-58245271 AAGTGAAAGCAGAAGGTGCCTGG + Intronic
908021214 1:59900888-59900910 AAGGGAAAACAGGAGAGAGCAGG + Intronic
908294805 1:62703222-62703244 AATGGAAAACAGAAAAAGGCAGG - Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908450960 1:64254081-64254103 AATGGAAAACAGAAAAAGGCAGG + Intronic
908543167 1:65140596-65140618 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
908659960 1:66424958-66424980 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
909061024 1:70879613-70879635 AATGGAAAACAGAAAATAGCAGG - Intronic
909234049 1:73129441-73129463 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
909413249 1:75377888-75377910 AAGGGAACTCAGAGGCTGGCGGG + Intronic
909413900 1:75383293-75383315 AAGGGAACTCAGAGGCTGGCGGG + Intronic
909439317 1:75679930-75679952 AATGGAAAACAAAAGAAGGCAGG + Intergenic
909579094 1:77212630-77212652 AATGGAAAACAAAAGGGAGCAGG + Intronic
909651721 1:77983017-77983039 AAGGGAACTCAGAGGCTGGCGGG - Intronic
909835385 1:80248224-80248246 AAAGGAAAAGAGAAAGTGGAAGG + Intergenic
910111486 1:83688334-83688356 AATGGAAAACAAAAAGAGGCAGG - Intergenic
910604316 1:89067006-89067028 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
910648094 1:89535087-89535109 AAGGGGAAAAAGAATATGGCTGG + Intronic
911010590 1:93276925-93276947 AAGGGAACTCAGAGGCTGGCGGG - Intronic
911124515 1:94328456-94328478 ATGGGAAAACAGAAGGTTCCCGG + Intergenic
911681706 1:100724068-100724090 AAGAGAAAACAAAACCTGGCTGG + Intronic
911823089 1:102444383-102444405 AATGGAAAACAGAAAAAGGCAGG + Intergenic
911850184 1:102807994-102808016 AATGGAAAACAGAAAATGGCAGG + Intergenic
911929712 1:103886370-103886392 AATGGAAAACAGAAAAAGGCAGG + Intergenic
912011544 1:104970367-104970389 TAGGGAGAAAAGAAGGTCGCTGG + Intergenic
912108814 1:106314702-106314724 AATGGAAAACAAAAAGAGGCAGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912782426 1:112564217-112564239 AAGGGAAAAGGAAAGGAGGCTGG + Intronic
912983953 1:114406956-114406978 AAGAAAAAACAGAGGATGGCAGG - Exonic
913337598 1:117722983-117723005 AACGGAAAACAAAAGAAGGCAGG + Intergenic
913434613 1:118833739-118833761 AATGGAAAACACAAAGAGGCAGG + Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
914441199 1:147708811-147708833 AATGGAAAACAAAAAATGGCAGG - Intergenic
914443988 1:147733985-147734007 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
914735502 1:150412535-150412557 AAGAGAAAACACAAGGTAGCAGG + Intronic
914745333 1:150497286-150497308 AAGAGAAAAAAAAAGGTGGGGGG + Intronic
914838538 1:151228579-151228601 AAGGGAAAACAGAAGCATCCTGG + Intronic
915397873 1:155599680-155599702 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915401737 1:155626809-155626831 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915402642 1:155635021-155635043 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915480300 1:156180025-156180047 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
915480624 1:156182262-156182284 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
915679025 1:157561994-157562016 AAGGGAAGAAATGAGGTGGCAGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916010342 1:160699851-160699873 AAGGGAACTCAGAGGCTGGCGGG + Intronic
916048347 1:161017641-161017663 AAGGGAACTCAGAGGCTGGCGGG + Intronic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
917055356 1:170975974-170975996 AATGGAAAACAGAAAAAGGCTGG - Intronic
917357655 1:174143557-174143579 AATGTAAAACTGAGGGTGGCTGG + Intergenic
917579735 1:176363433-176363455 AAGGGAAATCCCAGGGTGGCTGG + Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
918780836 1:188697884-188697906 AAAGAAAAACAAAGGGTGGCCGG - Intergenic
919015534 1:192028879-192028901 AATGGAAAACAGAAAGAAGCAGG - Intergenic
919051475 1:192516423-192516445 AAGTGAAAACAGAAACTGGGAGG - Intergenic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919506732 1:198408192-198408214 AAGGGGAAAATGTAGGTGGCAGG - Intergenic
919590567 1:199496498-199496520 AAGGGAAAACAAAAGTGAGCAGG + Intergenic
919738772 1:200970241-200970263 TGGGGAAAACACAAGGTTGCGGG - Intronic
920295898 1:204956156-204956178 AGGGAAAAACTGATGGTGGCCGG - Intronic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
920767238 1:208845215-208845237 ATGAGGAAATAGAAGGTGGCAGG - Intergenic
920796451 1:209142008-209142030 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
921657830 1:217761941-217761963 AATGGTAATCAGAAGGTGACGGG - Intronic
921778584 1:219132796-219132818 CAGGGAAGAAAGAAGGTGACTGG + Intergenic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
922305475 1:224340633-224340655 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922384689 1:225071003-225071025 AATGGAAAACAGAAAATAGCAGG - Intronic
922628638 1:227081185-227081207 AAGGGAAAAGCAAAGGTAGCAGG - Intronic
922715460 1:227868483-227868505 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
924764110 1:247015926-247015948 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1062776433 10:152383-152405 AATGGAAAACAGAAAAAGGCAGG + Intronic
1063480053 10:6367507-6367529 AAGGGAGAAGAGAAGGGTGCAGG + Intergenic
1063531191 10:6832817-6832839 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1064665564 10:17647497-17647519 AAGGGAAAAAAAAAAGTGGAAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065427666 10:25621844-25621866 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1065553807 10:26894272-26894294 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1065590669 10:27258752-27258774 AGTGGAAAGCAGCAGGTGGCCGG + Intergenic
1065660328 10:27999094-27999116 AGCGGAAAGCAGCAGGTGGCCGG - Intergenic
1066388876 10:34963029-34963051 ATGTGACAACAGAAGGTGGGAGG + Intergenic
1066927325 10:41713988-41714010 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1067038824 10:42937747-42937769 AAGCGCAAACACAAGGTGGGAGG + Intergenic
1067101502 10:43338005-43338027 AAGGGAACGCAGAGGCTGGCGGG + Intergenic
1067963599 10:50884301-50884323 AAGGGAAAAAAGAAGACAGCTGG - Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1069184772 10:65409373-65409395 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1069452146 10:68526471-68526493 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1069478736 10:68760961-68760983 ACGGAAAAAAAAAAGGTGGCGGG - Intronic
1069556333 10:69400959-69400981 ACGAGAAAACAGAAGGTAGTTGG - Intronic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1070068118 10:73058154-73058176 AAGGGAAAAAAGAAAGGGGATGG + Intronic
1070756825 10:78998500-78998522 AGAGGAAATCAGAAAGTGGCAGG + Intergenic
1071190938 10:83099866-83099888 AAAAGAAAACAAAAGCTGGCCGG + Intergenic
1071247852 10:83784883-83784905 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1071320812 10:84455228-84455250 AGTGGAAAACACAAGGTGGGAGG - Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071571076 10:86697515-86697537 AAGAAAAAAAAGAAGTTGGCCGG - Intronic
1071998588 10:91171686-91171708 AAGGGAAAAACGAATGTGGAGGG + Intronic
1072069278 10:91900811-91900833 AAGGGGAAACAGAAGGTCGGAGG + Intergenic
1072111340 10:92323031-92323053 AAAAGAATAAAGAAGGTGGCTGG - Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072947232 10:99820955-99820977 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1073050580 10:100664559-100664581 AGGGGAGAAGAGAAGGGGGCAGG + Intergenic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073221549 10:101878663-101878685 AAGGAAAAAAAAAAGTTGGCTGG + Intronic
1073286421 10:102392240-102392262 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1073390990 10:103176204-103176226 AGGGGAAAAGGGAATGTGGCTGG - Intronic
1074029994 10:109677482-109677504 AATGGATAATAGAAGGTAGCCGG + Intergenic
1074189305 10:111122321-111122343 AAAGGAGATCAGAAGGTGGGAGG - Intergenic
1074840893 10:117349888-117349910 AAGGCAAAAGAGAAGGTGAGAGG + Intronic
1075375243 10:121973606-121973628 AAGGCAAAACAGAATGGGACAGG + Intronic
1075575069 10:123572057-123572079 AAGGGAAAAGGGAAAGTGGCAGG + Intergenic
1076037328 10:127210724-127210746 AAAGGAAAACAAAAAGAGGCAGG - Intronic
1076459300 10:130628754-130628776 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1078129661 11:8602777-8602799 TAGGGAATACAAAAGGTGGGAGG + Intergenic
1078327345 11:10391452-10391474 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1078697015 11:13644546-13644568 AAGGCAAAAAGGAAGGAGGCAGG + Intergenic
1079366796 11:19816892-19816914 AGGGGAAAAAAAAAGGTGGTGGG - Intronic
1079427786 11:20360115-20360137 AAGGCAAACCTGAACGTGGCAGG + Intergenic
1079469687 11:20766390-20766412 AAGGAAAGACACAAGGTGGTTGG + Intronic
1079628949 11:22650742-22650764 AATGGAAAACAGAAAAAGGCAGG - Intronic
1079654521 11:22972063-22972085 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1079770040 11:24446887-24446909 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1080051611 11:27864390-27864412 AAGGGAAAGCTGAAAGGGGCAGG - Intergenic
1080599367 11:33807587-33807609 AGGGGAATTCAGAAGGTGACAGG - Intergenic
1081289391 11:41305948-41305970 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1081905885 11:46669605-46669627 CAGGGAAGATAGAAGGTGGTAGG - Intronic
1082102970 11:48189569-48189591 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1082118053 11:48348297-48348319 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1082145023 11:48656564-48656586 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1082602126 11:55171353-55171375 AATGGAAAACAAAAAATGGCAGG - Intergenic
1082744430 11:56946686-56946708 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1083285342 11:61655156-61655178 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1083337334 11:61931222-61931244 AAGGCAAAACAGAAGGTCTTTGG + Intergenic
1083372854 11:62195463-62195485 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1083467539 11:62858659-62858681 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1083492200 11:63021328-63021350 AAGGGATTCCAGAAGGTGGGAGG - Intergenic
1083508350 11:63182672-63182694 AACGTTCAACAGAAGGTGGCAGG - Intronic
1083543058 11:63528114-63528136 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1084052222 11:66607346-66607368 AAGGGAAAACAGACAGGGACTGG - Intergenic
1084207347 11:67603497-67603519 AAGGGAACTCAGAGGCTGGCGGG - Exonic
1084247335 11:67868107-67868129 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1084280228 11:68085054-68085076 AAGGAAAGAAAGAAGGTGGGAGG - Intronic
1084601353 11:70147616-70147638 TTGGGAAATCAGAAGGTGGGAGG + Intronic
1084724434 11:70931654-70931676 AAGGGGCAAGAGAAGGTGTCTGG + Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084880154 11:72165176-72165198 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085241836 11:75063130-75063152 AAGGCAAAAAAGAATCTGGCTGG + Intergenic
1086523821 11:87701913-87701935 AATGGAAAACAAAAAATGGCAGG - Intergenic
1086687201 11:89746368-89746390 AATGGAAAACAAAAAATGGCTGG + Intergenic
1086718653 11:90093527-90093549 AATGGAAAACAAAAAATGGCTGG - Intergenic
1086876252 11:92099122-92099144 AATGGAAAACAGAAGGTCAATGG + Intergenic
1087723787 11:101695865-101695887 AAGGGAACTCAGAGGCTGGCAGG + Intronic
1087724719 11:101704363-101704385 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1087787592 11:102372991-102373013 AATGGAAAACAAAAAGAGGCAGG - Intronic
1088871907 11:113897609-113897631 AGAGGAAAATAGAAGGTGGAAGG - Intergenic
1088876662 11:113941906-113941928 TAGGGAAACCACAAGATGGCGGG - Intronic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089051549 11:115550023-115550045 GAGGGAAAACTGGAGGTGGCTGG - Intergenic
1089266107 11:117263101-117263123 AAGGAAAAAAAAAAAGTGGCTGG - Intronic
1089387844 11:118079680-118079702 CACGGAAAACAGGAGGTGGGAGG - Intronic
1089471156 11:118721158-118721180 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1089472051 11:118729350-118729372 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1090162278 11:124508383-124508405 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1091101019 11:132873558-132873580 ATGGGAAAAGATAAGGTAGCAGG + Intronic
1091185491 11:133642978-133643000 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1091942781 12:4504079-4504101 ATGGGATAACTGAAGGTGGGAGG + Intronic
1091963811 12:4721375-4721397 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092142198 12:6191465-6191487 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1092175076 12:6398804-6398826 GAGGGAATTCAGTAGGTGGCTGG - Intergenic
1092249629 12:6885997-6886019 AAGGGAACTCAGAGGCTGGCAGG - Intronic
1092437588 12:8462734-8462756 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1092559888 12:9601267-9601289 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1093621106 12:21290357-21290379 AAAGGAAAAGTGAAGATGGCAGG + Intronic
1093651240 12:21648035-21648057 AAGGAAAAAAAAAAGGTGGTTGG + Intronic
1094387641 12:29912204-29912226 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1094389299 12:29932197-29932219 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1094609611 12:31980612-31980634 AAGTAAAAACAGAAGGTGATTGG + Intronic
1094623274 12:32100313-32100335 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094803974 12:34070645-34070667 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1094805408 12:34085539-34085561 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1094828228 12:34288128-34288150 AAGGAAAAAAACAATGTGGCCGG + Intergenic
1095066941 12:37789209-37789231 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1095089853 12:38093632-38093654 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1095186449 12:39206552-39206574 AAGTGAAAACATGAGGTAGCAGG - Intergenic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095534565 12:43229905-43229927 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095639617 12:44472813-44472835 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1095715240 12:45338336-45338358 AAGGGACAGCAGAAGGTGAGGGG + Intronic
1095718382 12:45373029-45373051 AATGGAAAACAGAAAAAGGCAGG + Intronic
1096359865 12:50974807-50974829 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1096420630 12:51454430-51454452 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1096927507 12:55165425-55165447 AATGGAAAACAAAAAATGGCAGG - Intergenic
1096940110 12:55334233-55334255 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1097076739 12:56400504-56400526 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1097262663 12:57728201-57728223 TAGGGAAAGCAGAGGGTGGGGGG + Intronic
1097330460 12:58327602-58327624 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1097331396 12:58336091-58336113 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1097577966 12:61418794-61418816 AATGGAAAACAAAAAATGGCAGG - Intergenic
1098004322 12:65979527-65979549 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1098072595 12:66692070-66692092 AATGGAAAACTGAAGGTGGGAGG - Intronic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1098499533 12:71174843-71174865 AAGGAAAAGCACAAGGTGTCAGG + Intronic
1098808211 12:75049206-75049228 AATGGAAAAAACAATGTGGCTGG - Intronic
1099357922 12:81661366-81661388 AATGGAAAACAGAAAAAGGCAGG + Intronic
1099538369 12:83873264-83873286 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100015237 12:90002172-90002194 AAGGGAAAGCAGAAAGTTGCTGG + Intergenic
1100276359 12:93075204-93075226 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1100289694 12:93202013-93202035 CAGGGAAGAACGAAGGTGGCTGG - Intergenic
1100830794 12:98515410-98515432 AAACGAAAACAGAAGCGGGCCGG + Intergenic
1101107675 12:101455982-101456004 AAAGGACAAAAGAAGGTGGACGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101520590 12:105478702-105478724 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1101524654 12:105517687-105517709 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1101622278 12:106400151-106400173 AATGGAAAACAGAAAAAGGCAGG + Intronic
1102135513 12:110570840-110570862 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1102454061 12:113060762-113060784 AGGAGAAAACAGAATGGGGCGGG - Intronic
1103092428 12:118106778-118106800 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104472467 12:129041373-129041395 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1104655565 12:130571790-130571812 AAGGGGACACAGCAGATGGCAGG - Intronic
1104719775 12:131038884-131038906 AAGGGAAAAGACTAGGTCGCAGG + Intronic
1105399052 13:20071751-20071773 AAGGGAAAACACCTGGGGGCAGG - Intronic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1105941025 13:25148351-25148373 AAGGGAAGCCAGAAAGTGGGAGG - Intergenic
1105948353 13:25208668-25208690 AAGGGAAGGAAGAAGGTGGCGGG + Intergenic
1105951930 13:25236731-25236753 AGGGGAATACAGAACGAGGCTGG + Intergenic
1107034182 13:35883383-35883405 AAGGGAGAAGGGAAGGTGCCAGG - Intronic
1107225995 13:38047693-38047715 AATGGAAAACAGAAAATAGCTGG + Intergenic
1107274606 13:38664158-38664180 ACATGAAAACAGAGGGTGGCAGG - Intergenic
1107558348 13:41538568-41538590 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1107992118 13:45827830-45827852 AAGGAAAGACAGAGGTTGGCTGG - Intronic
1108046746 13:46390533-46390555 AAAGTAGAACAGAAGTTGGCAGG + Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108352487 13:49599825-49599847 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1109585643 13:64398890-64398912 AAGGGAAGAGGGAAGGTGGGGGG + Intergenic
1109750189 13:66681788-66681810 AATAGAGAACAGAAGGTGGATGG - Intronic
1109889010 13:68582730-68582752 AAAGAAACACAAAAGGTGGCTGG + Intergenic
1109959748 13:69615019-69615041 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1110162060 13:72390237-72390259 AAGGTAAAACAGAAGGTCTGAGG + Intergenic
1110257766 13:73451082-73451104 AAGGGAAAAGGGAAAGTGGTAGG + Intergenic
1111064757 13:83075217-83075239 AAGGGAAAACAAAATGGAGCAGG + Intergenic
1111531088 13:89538919-89538941 AATGGAAAACAGAAGAGAGCAGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113224081 13:108140205-108140227 AGGGGCAAACAGAAGTTTGCTGG - Intergenic
1113544834 13:111140331-111140353 GGAGGAAAACAGCAGGTGGCGGG + Intronic
1114170656 14:20269725-20269747 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1114438086 14:22724828-22724850 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114831514 14:26148275-26148297 AAGAAAAAACAGATGTTGGCAGG + Intergenic
1115012355 14:28564691-28564713 ATTGGAAAACAGTATGTGGCTGG + Intergenic
1115076361 14:29396674-29396696 AAAATAAAACAGAAGGTAGCTGG - Intergenic
1115412406 14:33090315-33090337 AATGGAAAACAAAAGAAGGCAGG + Intronic
1115898589 14:38118902-38118924 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1116018115 14:39431453-39431475 AAGGCAACACTGAAGTTGGCCGG + Intronic
1116092246 14:40324154-40324176 AAGGGAGATCAGAATGTGGTAGG - Intergenic
1116731566 14:48629198-48629220 AAGGGAAGACATAAAGTGTCTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116962415 14:50979787-50979809 AAGTGAAAATTGATGGTGGCAGG - Intronic
1117365689 14:55025338-55025360 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1117431963 14:55675883-55675905 AATGAAAGACAGAAGGTAGCTGG + Exonic
1118351978 14:64978731-64978753 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1118622199 14:67623836-67623858 AAAGAAAAATAAAAGGTGGCTGG - Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1118964869 14:70571390-70571412 AAGTGCAGAGAGAAGGTGGCGGG - Intergenic
1118972370 14:70647891-70647913 ATGGGACACCAGAAGATGGCTGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119826558 14:77661541-77661563 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1120709550 14:87779277-87779299 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1121299099 14:92855106-92855128 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1122124709 14:99572682-99572704 AGCAGAAAACAGATGGTGGCAGG - Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122232177 14:100311933-100311955 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1123822586 15:24045492-24045514 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1124078054 15:26464415-26464437 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1124577046 15:30919083-30919105 AAGGAAAATCATAAGGGGGCTGG + Intronic
1125123950 15:36197551-36197573 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1126081928 15:44971825-44971847 AAGGGAAAAAAGGAGGGGGGGGG - Intronic
1126406211 15:48325311-48325333 AGGGGAAAAGAGTAGGTGGAGGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127404956 15:58633934-58633956 AAGGAAAAAGAGAAGATGGGTGG + Intronic
1127434068 15:58938977-58938999 AAAGGAAATCAGAAGATAGCAGG + Intronic
1127728227 15:61772084-61772106 AAAGGAAAAAAAAAGGTGGCAGG + Intergenic
1128130949 15:65226685-65226707 AAGGGAACGCAGAGGCTGGCGGG - Intergenic
1128194017 15:65734456-65734478 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1128524023 15:68398319-68398341 AATGGAAAACAGAAAAAGGCAGG + Intronic
1129485805 15:75870997-75871019 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1130871237 15:87973849-87973871 AAGAGCAAAATGAAGGTGGCAGG - Intronic
1130944569 15:88541354-88541376 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1131044540 15:89303033-89303055 AAGGGAATAAAGAAGGTTGAAGG - Intronic
1131532653 15:93206871-93206893 AACAGAAAACTGAAGGTGGCGGG - Intergenic
1132440531 15:101860120-101860142 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1132945660 16:2530348-2530370 AAGGGGACACAGAAGATGGCAGG - Exonic
1133432941 16:5754531-5754553 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133687362 16:8178904-8178926 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1134504562 16:14794501-14794523 AAGTCAAAACATAAGGTGGTGGG - Intronic
1134576009 16:15334408-15334430 AAGTCAAAACATAAGGTGGTGGG + Intergenic
1134676799 16:16096395-16096417 AAAAGAAATCAAAAGGTGGCAGG - Intronic
1135577919 16:23600278-23600300 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1135719594 16:24803932-24803954 ACTAGTAAACAGAAGGTGGCTGG - Intronic
1136930307 16:34412200-34412222 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1136974267 16:34999606-34999628 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1136992442 16:35162332-35162354 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1137366653 16:47865261-47865283 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1137681089 16:50345586-50345608 AATGGAAAACAGAAAAAGGCAGG + Intronic
1137727159 16:50664858-50664880 AAAGGAAAATGGAAGGAGGCTGG - Intergenic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1139320419 16:66109730-66109752 AAGGGAAGAGGGAAGGTGGAAGG + Intergenic
1140418827 16:74799536-74799558 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1140605048 16:76526272-76526294 AAGGAAAAAAACAATGTGGCTGG + Intronic
1140757538 16:78081639-78081661 GAGGGAAAATATCAGGTGGCAGG + Intergenic
1140997375 16:80274299-80274321 AAGGGAACAAAGAATGTGGTGGG + Intergenic
1141174149 16:81708202-81708224 TATGGGACACAGAAGGTGGCAGG + Intronic
1141355193 16:83339000-83339022 TATAGAAAACAGATGGTGGCAGG + Intronic
1142935106 17:3323190-3323212 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1143195709 17:5074823-5074845 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1144069095 17:11651310-11651332 ACTGGAAAACAGAAGGTAACAGG + Exonic
1144169152 17:12642258-12642280 AGGGGAAAACAAAAGATGTCTGG - Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144580902 17:16458773-16458795 AAGGCTTAACAGAAGTTGGCAGG - Intronic
1144745441 17:17611071-17611093 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1145030983 17:19505101-19505123 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1145396559 17:22500773-22500795 AATGGAAAACAGAAAAAGGCGGG - Intergenic
1146181365 17:30700184-30700206 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1146268333 17:31467927-31467949 AAGGGCAAACAGGAGCTGGCAGG - Intronic
1146269694 17:31476839-31476861 AAAGGAAAACCAAAGGTGCCCGG - Intronic
1146839540 17:36140859-36140881 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1147281470 17:39364619-39364641 AAAGAAAAAAAGAATGTGGCAGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1148076784 17:44941721-44941743 AAGGGAAGGCAGAGGGTGCCTGG + Intronic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1149202419 17:54202376-54202398 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1149205002 17:54233826-54233848 AATGGAAAACAGACAGTGGGAGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150242554 17:63646933-63646955 AAAGGAAAGCTGAGGGTGGCAGG - Intronic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150487496 17:65554088-65554110 AGGGGAAAACAGAAAGCAGCCGG - Intronic
1150985846 17:70196225-70196247 ATGGGAAGAGAGAAGGTGGCTGG + Intergenic
1151142350 17:72005949-72005971 AAGAGAATACAGCAGGTGGTAGG + Intergenic
1151144337 17:72026966-72026988 AAGGGGAAAAAGAGGGTGGGGGG + Intergenic
1151361911 17:73593988-73594010 AAGGGAAAACAGAGGCTTGGAGG + Intronic
1151455688 17:74224529-74224551 TAGGGAAAACTCAAGGTGGAAGG + Intronic
1152869521 17:82744673-82744695 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1153422027 18:4917422-4917444 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1155467918 18:26159543-26159565 AAATGCAAACAGAAGATGGCAGG - Intronic
1156403979 18:36766943-36766965 AAGGGAAAACAGGAAATTGCGGG + Intronic
1157052784 18:44187754-44187776 AAGAGAAAACAGAAGGTTTAGGG + Intergenic
1157241023 18:46009524-46009546 AAGGGAACTTAGAGGGTGGCAGG + Intronic
1157452787 18:47800858-47800880 TTGGGAAAACAGAGGCTGGCTGG + Intergenic
1157453245 18:47803615-47803637 AAGGGAAAACGGAGGATGTCAGG - Intergenic
1157618738 18:49003239-49003261 AAGGGAAAAAGGAAGGGGACAGG - Intergenic
1157636987 18:49168511-49168533 TAGGGTACACAGATGGTGGCAGG + Intronic
1157849196 18:51031028-51031050 AAGACAAAACAGAAATTGGCTGG - Intronic
1157916508 18:51668802-51668824 AGAGGAAAACAGCTGGTGGCAGG + Intergenic
1158359748 18:56658559-56658581 ATGTGAAAACAGAAGGTAACTGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159484866 18:69042995-69043017 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1160602705 18:80026222-80026244 AAGGAAAAACAGAAGATTGCTGG + Intronic
1160675241 19:387472-387494 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162668078 19:12231972-12231994 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1162783528 19:13020168-13020190 AGGGGAGAAGAGAAGGAGGCTGG + Intronic
1162962324 19:14135725-14135747 TAGGGAAAATAGGAGATGGCTGG + Intronic
1163509178 19:17725263-17725285 CATGGAAAACAGCAGGTCGCTGG - Intronic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164122908 19:22284338-22284360 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1164124025 19:22293788-22293810 AAAGGTAGACAAAAGGTGGCTGG - Intronic
1164153740 19:22575740-22575762 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1164273346 19:23693421-23693443 AAGGGAACTCAGAAGCTGGCGGG + Intergenic
1164370294 19:27637733-27637755 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164717286 19:30402576-30402598 AAAGGCAAATGGAAGGTGGCTGG - Intronic
1165595156 19:37006961-37006983 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1165634871 19:37332207-37332229 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1165655643 19:37529946-37529968 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1165691470 19:37866979-37867001 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1166653706 19:44594898-44594920 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1167112035 19:47468260-47468282 AAGGGGGAACAGCAGGTGCCAGG - Intronic
1167261414 19:48461018-48461040 AATTTAAAAAAGAAGGTGGCTGG + Intronic
1167336641 19:48890438-48890460 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1167433077 19:49464368-49464390 AGAGGAAAACAGACGGTGGCAGG - Intronic
1167675475 19:50882024-50882046 AAGAGAAAAAACAAGGTAGCTGG + Intergenic
1167818899 19:51908334-51908356 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1167833188 19:52043935-52043957 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1167876856 19:52421100-52421122 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1167910455 19:52697883-52697905 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1168219514 19:54950425-54950447 AAGGGAACTCAGAAGCTGGCGGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168304469 19:55427995-55428017 AAAGGTAAAAAGGAGGTGGCAGG - Intergenic
925077378 2:1028591-1028613 AAGGGAAAGCAGAGGGTTTCTGG - Intronic
925172969 2:1762228-1762250 AATGGAAAACAAAAGAAGGCAGG + Intergenic
925226596 2:2188883-2188905 TAGGGAAATCAGACTGTGGCAGG - Intronic
925257805 2:2505257-2505279 AAGGGATAGCAGAAGCTGGGAGG - Intergenic
925334520 2:3084681-3084703 AATGGAAAACAAAAGAAGGCAGG + Intergenic
925484602 2:4313811-4313833 AAGAGAAAACAGGGGGTGGCTGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
926225050 2:10961372-10961394 AAGGAAGACCAGAAGGCGGCTGG + Intergenic
926715865 2:15922990-15923012 AAGAAAAAAAAGAAGGTGTCAGG - Intergenic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927099584 2:19777678-19777700 AAGGTAGAACAGAAGATGGCTGG + Intergenic
927405935 2:22766812-22766834 AAAGGAAAGCAATAGGTGGCAGG + Intergenic
927426449 2:22986340-22986362 AATGGAAAACAAAAGAAGGCAGG + Intergenic
927486194 2:23489859-23489881 AAGGGAGAGGAGGAGGTGGCTGG + Intronic
927830748 2:26347625-26347647 AAGGCAAAACAGGAGGTATCTGG - Intronic
927992901 2:27460781-27460803 AAGGGAACTCAGAGGCTGGCGGG + Intronic
928216989 2:29370125-29370147 AAGAGAAAGCAGAAAGTGACAGG - Intronic
928320688 2:30280833-30280855 AAGAGAAAACAGCACGTGGATGG - Intronic
928539961 2:32275725-32275747 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
928762362 2:34599805-34599827 ATGGAAAAACAGAAGGTAGGAGG - Intergenic
928891375 2:36207280-36207302 AGTGAAAAACAGAAGTTGGCAGG + Intergenic
928959726 2:36911658-36911680 AAGTGAAGACACAAGGAGGCTGG - Intronic
928990299 2:37226120-37226142 AAGGGAACTCAGAGGCTGGCGGG + Intronic
929208169 2:39321964-39321986 AAGGGAACTCAGAGGCTGGCGGG + Intronic
929382288 2:41367287-41367309 AATGGAAAACAGAAGAAAGCAGG + Intergenic
929420929 2:41788826-41788848 AAGGTTACACAAAAGGTGGCAGG + Intergenic
929757292 2:44778416-44778438 AAGGGAAAACAGGAGTTGGAGGG + Intergenic
929789543 2:45013099-45013121 AGGGAAAAAGAGAAGGGGGCGGG + Intergenic
929897333 2:45973444-45973466 ATGGAAAAACAGAAGGTCACAGG - Intronic
929959306 2:46484510-46484532 AAGTGAAAAAAGGAGGTGCCTGG - Intergenic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930251087 2:49034718-49034740 AAGGGAATACAGAATGGGGCAGG - Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930801213 2:55444407-55444429 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931130361 2:59328611-59328633 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931194414 2:60037166-60037188 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931477851 2:62607539-62607561 AATGGAAAACAAAAAATGGCAGG + Intergenic
931557556 2:63521375-63521397 AATGGAAAACAGAAGAAAGCAGG + Intronic
931825109 2:65992287-65992309 AAGGGAAGAAAGCAGATGGCAGG - Intergenic
932067567 2:68582517-68582539 AAGGGAATACAGAAAGTAGAGGG + Intronic
932529638 2:72515185-72515207 AAGGGAAAAGAGAAGGTCCCAGG + Intronic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932731777 2:74226857-74226879 ACAGGAAGGCAGAAGGTGGCAGG + Intronic
933052670 2:77618909-77618931 AATGGAAAACAGAAACAGGCCGG + Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933404616 2:81842233-81842255 AATGGAAAACAAAAGAAGGCAGG + Intergenic
933838114 2:86262102-86262124 AAGGGAACTCAGAAGCTGGCGGG + Intronic
933846544 2:86331515-86331537 AAGGAAAAAAAAAAGGTGGGGGG + Intronic
933982951 2:87568480-87568502 AAAGGAAAAGAGGAGGGGGCAGG - Intergenic
935003500 2:99045891-99045913 AATGGAAAACAAAAAATGGCAGG + Intronic
935937914 2:108206959-108206981 AATGGAAAACAGAAAAAGGCAGG - Intergenic
936310890 2:111382315-111382337 AAAGGAAAAGAGGAGGGGGCAGG + Intergenic
936392352 2:112087063-112087085 GAGGGACAACGGAAGGTGCCAGG - Intronic
936942338 2:117898284-117898306 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
937035040 2:118774014-118774036 AAGGGAAAACAGAAGCGGTGAGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937507459 2:122552983-122553005 AATGGAAAACAGAAAAAGGCAGG + Intergenic
938270048 2:129962108-129962130 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
938385740 2:130865737-130865759 AAGGGAAAAGAAAAGATGACTGG - Intronic
939445511 2:142304795-142304817 AAGAGAGAACACATGGTGGCAGG - Intergenic
939975008 2:148707165-148707187 AATGGAAAACAAAAAGAGGCAGG + Intronic
940033977 2:149293992-149294014 AAGAGAAAACAGAATGTTTCTGG + Intergenic
940042880 2:149378685-149378707 AGGGGAAGACACAAGGTGGCTGG - Intronic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
940819103 2:158331830-158331852 AATGGAAAACAGAAAAAGGCAGG - Intronic
941098105 2:161264348-161264370 AGAAGAAAACAGAAGGTAGCTGG - Intergenic
941520841 2:166540269-166540291 AATGGAAAACAAAAGTTGGAGGG + Intergenic
941592279 2:167434712-167434734 AAGGGAAAAAATAAGGGGGGGGG - Intergenic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942052775 2:172156182-172156204 AAGGGAGAACAGAGAGGGGCGGG - Intergenic
942256314 2:174102703-174102725 AAGGGAAAGCAGAAACTGACAGG + Intronic
942490277 2:176483054-176483076 AAAGGGAAAGAGAAGGTTGCAGG + Intergenic
942790494 2:179755756-179755778 AATGGAAAACAGAAAAAGGCAGG - Intronic
942839497 2:180342077-180342099 AAAGGAAAATAGAAGGATGCTGG - Intergenic
942976854 2:182029036-182029058 AAGGGAAAACAAAAAAAGGCAGG - Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943515076 2:188875274-188875296 AAGGGAAAACGAAAGGTAGAAGG + Intergenic
943549539 2:189321483-189321505 AATGGAAAACAAAAAATGGCAGG + Intergenic
944065448 2:195615069-195615091 AAGGGAAAATAGAGGGGGTCTGG + Intronic
944097497 2:195985422-195985444 AAGGGATAACTGAAGGAGCCAGG + Intronic
944450653 2:199838767-199838789 GAGGTAAAACACAAGGTGTCTGG + Intronic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
944907373 2:204276023-204276045 AAGCCAAAGCAGTAGGTGGCTGG - Intergenic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945023582 2:205598283-205598305 AATGGAAAACAGAAAGGAGCAGG + Intronic
945175275 2:207037628-207037650 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
945293686 2:208149696-208149718 AAGGGAAATCTGTAGGGGGCAGG + Intergenic
945481738 2:210352922-210352944 AATGGAAAACAAAAAATGGCAGG + Intergenic
945832454 2:214803687-214803709 AAGGGAACTCAGAGGCTGGCGGG + Intronic
945870653 2:215222553-215222575 AAAGGAAAACAGAAAAAGGCAGG + Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946780740 2:223191280-223191302 AAGGGAACTCAGAGGCTGGCGGG + Intronic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
947273349 2:228363785-228363807 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
947520682 2:230843780-230843802 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
947651181 2:231787148-231787170 AAGGGAAAAGAGAAGGGGAGAGG - Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
1168805662 20:670986-671008 AAAGGAAAACAGAGGCTGGGAGG + Intronic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1171081706 20:22193163-22193185 AATGGAAAACAGAAGAAAGCAGG + Intergenic
1171451951 20:25242050-25242072 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
1171464103 20:25315846-25315868 AAGGGAACACAGACAGAGGCAGG - Intronic
1171904156 20:30886709-30886731 AATGGAAAACAAAAAATGGCAGG - Intergenic
1172479439 20:35262267-35262289 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173319128 20:41971698-41971720 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1174373364 20:50109355-50109377 AAGAGAAAAGAGAATGTGGTGGG + Intronic
1174499577 20:50974857-50974879 AAGGGAAAAGAAAAAGTGGAAGG - Intergenic
1174642364 20:52055630-52055652 AAGGGACAACAGAAGATATCTGG + Intronic
1175013769 20:55766150-55766172 AAGGAAAAACAGAAGGTATCAGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1175946024 20:62559172-62559194 AAGGGACGACAGAAGGTAGCTGG - Intronic
1176350208 21:5787438-5787460 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176357022 21:5908022-5908044 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176424372 21:6538958-6538980 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1176544529 21:8185508-8185530 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176563480 21:8368553-8368575 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1177025584 21:15918405-15918427 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1177051045 21:16234346-16234368 AAGGAAAAGTAGAAGATGGCGGG - Intergenic
1177833473 21:26166292-26166314 CACAGAAGACAGAAGGTGGCAGG - Intronic
1178545482 21:33490087-33490109 AAAAGAAAAAAGAATGTGGCTGG - Intronic
1179147546 21:38781619-38781641 AAGAGAAATCAAAATGTGGCTGG - Intergenic
1179444394 21:41421012-41421034 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1179487715 21:41721648-41721670 AAGGGAAAGCAAAAGGCGGCAGG - Intergenic
1179699865 21:43147273-43147295 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1180333084 22:11550461-11550483 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180337580 22:11592846-11592868 AATGGAAAACAAAAAATGGCAGG - Intergenic
1180837794 22:18939476-18939498 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180838703 22:18947683-18947705 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1181594899 22:23907884-23907906 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1182463672 22:30500898-30500920 AAGGAAAAACAGAGGGGGTCAGG + Intronic
1182464721 22:30507234-30507256 AAAAGAAAACAGAAGTTGGCTGG + Intergenic
1182886521 22:33778462-33778484 AAGGGAAAATGGGAGGTGACTGG - Intronic
1183405324 22:37627720-37627742 AGAGGAAAACAGAAGGAAGCTGG - Intronic
1183600626 22:38838229-38838251 AGGGGAAAACTGAAGCTGGTGGG + Intronic
1183670863 22:39271776-39271798 AAAAAAAAATAGAAGGTGGCTGG - Intergenic
1183928020 22:41219689-41219711 AAGGGAACACAGAGCTTGGCAGG + Intronic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184583638 22:45433454-45433476 AAGGCAAAAAAGAAGGGGGTCGG + Intergenic
1184879598 22:47296581-47296603 AAGGGAAAGGAGAAATTGGCCGG + Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1203249399 22_KI270733v1_random:101746-101768 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1203287885 22_KI270734v1_random:164775-164797 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
949209416 3:1479780-1479802 AATGGAAAACAAAAGTAGGCAGG + Intergenic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949425473 3:3911101-3911123 AACGGAAAACAAAAGAAGGCAGG + Intronic
949600635 3:5594614-5594636 AATGGAAAACAAAAAGAGGCAGG - Intergenic
949712788 3:6891056-6891078 AATGGAAAACAAAAAATGGCAGG - Intronic
949874155 3:8613678-8613700 AATGGAAAACAAAAAATGGCAGG + Intergenic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
950030319 3:9847805-9847827 AAGGGAACTCAGAGGCTGGCGGG - Intronic
950453678 3:13079931-13079953 AAGGAAAAACAGAAGTTTCCTGG + Intergenic
950607052 3:14091328-14091350 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
951514590 3:23544806-23544828 AAGGGAACTCAGAGGCTGGCGGG - Intronic
951939457 3:28061417-28061439 AATGGAAAACAAAAGAAGGCGGG + Intergenic
952472817 3:33673760-33673782 AACGGAAAACAAAAAATGGCAGG + Intronic
952547008 3:34431564-34431586 AATGGAAAACAAAAAATGGCAGG - Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
952630248 3:35456746-35456768 AATGGAAAACAAAAAATGGCAGG + Intergenic
952635164 3:35520187-35520209 AAGGGCAAACAGAAGATATCTGG + Intergenic
952837501 3:37616788-37616810 AACGGAAAACAAAAAATGGCAGG - Intronic
952846748 3:37694287-37694309 AGAGGACAAGAGAAGGTGGCGGG + Intronic
953055444 3:39383940-39383962 AAGGGAATTGAGAAGGGGGCAGG + Intronic
953321779 3:41979050-41979072 AAAAGAAAACAGAATGTGGCTGG - Intergenic
953356636 3:42261928-42261950 AAAGCAAAACACAAGGTGGTGGG + Intronic
953848672 3:46449024-46449046 GAGGGAAGACCGCAGGTGGCTGG + Intronic
953924122 3:46972635-46972657 AAACGAAAAAAGAAGATGGCTGG + Intronic
953960147 3:47260336-47260358 AAGGGAACTCAGAGGCTGGCGGG + Intronic
954140235 3:48601161-48601183 AGGGGAACAGAAAAGGTGGCAGG + Intronic
954440729 3:50520683-50520705 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
954896234 3:53977657-53977679 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
955061209 3:55492897-55492919 GAGTGAAATCAGAAGGTGTCAGG - Intergenic
955341524 3:58129053-58129075 AAAGCAAATTAGAAGGTGGCAGG - Intronic
955451630 3:59074560-59074582 AATGGAAAACAGAATGGGGTAGG + Intergenic
956215592 3:66845101-66845123 AATGGAAAACAGAAAAAGGCAGG + Intergenic
956265900 3:67395340-67395362 AATGGAAAACAGAAAAAGGCAGG + Intronic
956394681 3:68812492-68812514 AATGGAAAACAAAAGAAGGCAGG + Intronic
956899914 3:73704577-73704599 AGGGGAAAACAGAAGATACCTGG + Intergenic
957040033 3:75329479-75329501 AAGGGAAAAAGGAAAGTAGCAGG + Intergenic
957184616 3:76925661-76925683 AAGGGAACACAGATGGGGTCAGG + Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958155418 3:89749793-89749815 AATGGAAAACAAAAAATGGCAGG + Intergenic
958208340 3:90434480-90434502 AAAGGAAAACAAAAAGAGGCAGG - Intergenic
958569649 3:95862691-95862713 AATGGAAAACAGAAAAAGGCAGG + Intergenic
958937486 3:100272637-100272659 AAGGGAACTCAGAGGCTGGCGGG - Intronic
958975713 3:100666284-100666306 AAGGGAACTCAGAGGCTGGCGGG - Intronic
959071239 3:101703976-101703998 AAGGGAACTCAGAAGCTGGCGGG - Intergenic
959946659 3:112132659-112132681 AAAGGAAGACTCAAGGTGGCAGG + Intronic
960027372 3:113024420-113024442 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
960028285 3:113032619-113032641 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
960318557 3:116207228-116207250 AATGGAAAACAGAAAAAGGCAGG - Intronic
960339516 3:116457497-116457519 AATGGAAAACAGAAAAAGGCAGG + Intronic
960949064 3:122987215-122987237 AAGGGAAAAATGCAGGTGGAGGG + Intronic
961512531 3:127411796-127411818 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
961581774 3:127888992-127889014 AAGGGAAAAGAGAACCTGGAGGG - Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961949761 3:130737247-130737269 AAGGGAAAAGGGAATGTGTCCGG - Intronic
962138591 3:132764466-132764488 AATGGAAAACAAAAAATGGCAGG - Intergenic
962397410 3:135029049-135029071 AAGGGAAAACAAAAAAAGGCAGG - Intronic
962424272 3:135256042-135256064 AATGGAAAACAAAAGAAGGCAGG - Intronic
962774198 3:138643493-138643515 AAGATAAAACACAAGTTGGCTGG + Intergenic
962836536 3:139194469-139194491 AATGGAAAACAGAAAAAGGCAGG - Intronic
964227843 3:154428257-154428279 AAGGGATGACAGAAGGTTGTGGG + Intronic
964463915 3:156968443-156968465 AATGGAAAACAAAAGAAGGCAGG + Intronic
964564675 3:158036444-158036466 AATGGAAAACAGAAAAAGGCAGG + Intergenic
965271290 3:166619736-166619758 AATGGAAAACAGAAAAAGGCAGG + Intergenic
965524571 3:169702277-169702299 AAGGGAACATAGATGGTGGCTGG - Intergenic
966073293 3:175905693-175905715 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967025801 3:185562691-185562713 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967026712 3:185570903-185570925 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967179039 3:186887017-186887039 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
967179795 3:186894021-186894043 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
967335988 3:188345319-188345341 CACGGAAAGCAGAAGGTAGCCGG - Intronic
967409988 3:189157550-189157572 AAACCAGAACAGAAGGTGGCCGG - Intronic
967418843 3:189251514-189251536 AAGGGAACTCAGAGGCTGGCGGG - Intronic
967502851 3:190220437-190220459 AATGGAAAACAGAAAGAAGCAGG - Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967821678 3:193844528-193844550 AAGGAAAAAGAGAAAGGGGCTGG + Intergenic
968095547 3:195927668-195927690 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
968387180 4:151885-151907 AAGGGAACTCAGAGGCTGGCGGG - Intronic
968520706 4:1033571-1033593 AGGGGACCACAGAAGGTGTCCGG - Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
968897103 4:3410819-3410841 AAAGGAAAACAGAAGGGTACAGG - Intronic
968923633 4:3535667-3535689 TGGGGAGACCAGAAGGTGGCAGG + Intergenic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969251101 4:5969435-5969457 AGAGGAAAGCAGGAGGTGGCAGG + Intronic
970022093 4:11581203-11581225 AAGGGAAAACAAAAAAAGGCAGG - Intergenic
970981519 4:22104138-22104160 AATGGAAAAGAGATGGTGTCAGG - Intergenic
971933239 4:33113639-33113661 AAGGGACTACAAAAGGTGGGAGG + Intergenic
972547039 4:40089731-40089753 AAGGAAAAACTGATCGTGGCTGG - Intronic
973267166 4:48222131-48222153 AAGATAAAATAGATGGTGGCTGG + Intronic
973869838 4:55155202-55155224 AAGGGACAAAAGAAGGTGAGAGG + Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974238210 4:59208770-59208792 AATGGAAAACAAAAAGAGGCAGG + Intergenic
974244969 4:59303067-59303089 AATGGAAAACAAAAAATGGCAGG - Intergenic
974427360 4:61758503-61758525 AATGGAAAACAGAAAAAGGCAGG - Intronic
974518022 4:62941680-62941702 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
974780576 4:66547380-66547402 AATGGAAAACAGAAAAAGGCAGG + Intergenic
974799739 4:66801610-66801632 AAGGGAAAAAAGAGGCAGGCAGG - Intergenic
975143133 4:70938507-70938529 AGGGCAAAACAGAAGGTCTCTGG - Intronic
975246773 4:72129367-72129389 AAGGGAACTCAGAGGCTGGCGGG - Intronic
975319560 4:72994899-72994921 AAGGGAAAACACAAGGTTCTGGG - Intergenic
975579405 4:75893051-75893073 ATGGGAAAAGAGAAGCTGGGAGG + Intronic
975731462 4:77341878-77341900 AATGGAAAACAAAAAATGGCAGG - Intronic
975836048 4:78423032-78423054 AAGGGAAGAGATAAGGTGGCAGG - Intronic
977129846 4:93222324-93222346 AAAGAAAATCAGAAGTTGGCAGG + Intronic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
977519124 4:98058378-98058400 AATGGAAAACAGAAGAAAGCAGG + Intronic
977735521 4:100410538-100410560 AAGTGAAAACAGATGATGTCTGG - Intronic
978216885 4:106215533-106215555 AAGGGAAAACAAAAAAAGGCAGG + Intronic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
979141715 4:117183915-117183937 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
979157997 4:117422340-117422362 AAGAGAAAAAAAAATGTGGCAGG + Intergenic
979322672 4:119342677-119342699 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
979327535 4:119397167-119397189 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
980583277 4:134782619-134782641 AATGGAAAACAGAAGTGAGCAGG - Intergenic
980777854 4:137460308-137460330 AAGAGAAATCTGAAGTTGGCAGG - Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981556544 4:146001578-146001600 AATGGAAAACAGAAAAAGGCAGG - Intergenic
981607587 4:146556759-146556781 AATGGAAAACAGAAAAAGGCAGG - Intergenic
981645020 4:146989315-146989337 AATGGAAAACAGAAAATGACAGG - Intergenic
981743400 4:148027998-148028020 AAGGAAAAACCGTATGTGGCAGG - Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982512789 4:156304905-156304927 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
982598527 4:157416082-157416104 AAAGGTAAACATAAGGTGACAGG + Intergenic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
982876656 4:160659588-160659610 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983195059 4:164797888-164797910 TAGGGACAACAAAAGGTGGGAGG - Intergenic
983205395 4:164905657-164905679 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
983214555 4:164991185-164991207 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
983222936 4:165060105-165060127 AAGAGAAAACAAAAGGTTCCTGG + Intergenic
984011892 4:174381445-174381467 AAGGTTAAACAGAAAGTTGCTGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984942179 4:184942747-184942769 AAGGGAACTAAGAAGGTGGCAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985738020 5:1596120-1596142 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986130549 5:4925731-4925753 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986536227 5:8790530-8790552 AAGGAAAAACAGAACATTGCAGG + Intergenic
986549685 5:8938543-8938565 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
986654951 5:10001858-10001880 AATGGAAAACAGAAGAAAGCAGG + Intergenic
987264403 5:16236838-16236860 GAGGGAAAACAGAAACTGCCAGG + Intergenic
987490916 5:18579257-18579279 AAGGGAACTCAGAAGCTGGCGGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988379927 5:30486796-30486818 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
988380851 5:30495292-30495314 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
988850396 5:35174737-35174759 AAGGGTAAAGTCAAGGTGGCTGG - Intronic
988850664 5:35177188-35177210 AAGGGAACTCAGAGGCTGGCGGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989528543 5:42480711-42480733 AATGGAAAACAGAAAAAGGCAGG - Intronic
989608007 5:43264445-43264467 AATGGAAAACAGAAAAAGGCAGG - Intronic
989737860 5:44730630-44730652 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
989812256 5:45693428-45693450 AATGGAAAAAAGAAAATGGCAGG - Intronic
989941674 5:50158304-50158326 AATGGAAAACAAAAAATGGCAGG + Intergenic
990414351 5:55571874-55571896 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
990459469 5:56017564-56017586 AAGGAAAAAAAAAAGGGGGCCGG - Intergenic
990648254 5:57869186-57869208 AATGGAAAACAGAAAAAGGCAGG - Intergenic
990687802 5:58326887-58326909 AAGGCAAAAGAAAATGTGGCAGG - Intergenic
990789809 5:59464589-59464611 AAGGGAACTCAGAGGCTGGCGGG + Intronic
990823995 5:59876610-59876632 AAAGCAAGACAGAAGGTGGGGGG - Intronic
991077383 5:62555944-62555966 AAAAAAAAACTGAAGGTGGCTGG - Intronic
992189863 5:74281208-74281230 AAGGGAAGACAAGTGGTGGCAGG + Intergenic
992320145 5:75605976-75605998 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
992495470 5:77288994-77289016 AGGGGAAAAAAGAAGGTAACAGG - Intronic
993619310 5:90149056-90149078 AATGGAAAACAGAAAAGGGCAGG + Intergenic
994290626 5:98024919-98024941 AATGGAAAACAAAAAGAGGCAGG + Intergenic
995428817 5:112051693-112051715 AATGGAAAACAGAAGAAAGCAGG + Intergenic
995878915 5:116821933-116821955 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
995957628 5:117797205-117797227 AGAGGACAACAGAAGGTTGCAGG - Intergenic
996136243 5:119845983-119846005 AAGGGAAAAAATAGGGTGGGAGG - Intergenic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
997065938 5:130558664-130558686 AATGGAAAACAGAAAAAGGCAGG + Intergenic
997087637 5:130819915-130819937 AATGGAAAACAAAAAATGGCAGG + Intergenic
997978691 5:138455442-138455464 AAGCGAGAACTGAATGTGGCTGG - Intergenic
998241939 5:140454031-140454053 AATGGAAAACAGAAAAAGGCAGG + Intronic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
999951645 5:156657849-156657871 AAGGGAACTCAGAGGCTGGCGGG - Intronic
999952549 5:156666061-156666083 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1000114248 5:158138458-158138480 AAGGGAAGACAGAAAGTGCCAGG - Intergenic
1000366857 5:160499898-160499920 AAGGCAAATCAGAAGGTTGGTGG + Intergenic
1000565955 5:162847582-162847604 AATGGAAAACAAAAAATGGCAGG + Intergenic
1000850994 5:166340131-166340153 AAGGGAGAACAGAAGTTAGCAGG - Intergenic
1001008603 5:168076795-168076817 AAGTGAAACCAGATGTTGGCTGG + Intronic
1001059142 5:168473367-168473389 AAGGAAAAAAAAAAGGTGTCTGG + Intergenic
1001061348 5:168492144-168492166 ATGGGAAAACAGGAGGTAGTAGG + Intronic
1001225476 5:169941119-169941141 AAGGGAAAGCACAGGGTGTCGGG + Intronic
1001232046 5:169997018-169997040 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1002482740 5:179514106-179514128 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002666303 5:180828067-180828089 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1002683057 5:180983750-180983772 AAAGGGAAAAAGCAGGTGGCAGG - Intergenic
1002778107 6:345504-345526 AATGGAAACCAGAACATGGCTGG - Intronic
1003066650 6:2909465-2909487 AAGGGAACTCAGAAGCCGGCGGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1005610224 6:27516775-27516797 TAGGGAAAACTGCAGGTGACTGG - Intergenic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1005960826 6:30691793-30691815 AAGGGAAAACATAAGATGTCTGG - Intergenic
1006250352 6:32778211-32778233 AAGGGAACTCAGAAGCCGGCGGG - Intergenic
1006354150 6:33544015-33544037 AAAGGAGAGCAGAAGCTGGCTGG - Intergenic
1006399719 6:33810103-33810125 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1006538398 6:34719603-34719625 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1006893090 6:37446601-37446623 AATGGAAAACAGAAGGCTGGGGG + Intronic
1007297709 6:40839255-40839277 AATGGAACACCGAAAGTGGCTGG - Intergenic
1007309814 6:40936423-40936445 AAGGGACAGGAGGAGGTGGCTGG - Intergenic
1007756111 6:44100881-44100903 GAGGGAGGAGAGAAGGTGGCTGG - Intergenic
1007793468 6:44328191-44328213 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1008193760 6:48493132-48493154 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1008212280 6:48739526-48739548 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008412025 6:51191487-51191509 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1008583047 6:52923475-52923497 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1008861420 6:56153863-56153885 AATAGAGAAGAGAAGGTGGCAGG - Intronic
1009620678 6:66072032-66072054 AAGGGAGGAAAGAAGGTGGTGGG + Intergenic
1010237851 6:73589969-73589991 AAGAGAAATATGAAGGTGGCAGG + Intergenic
1010463596 6:76141553-76141575 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1010476708 6:76297362-76297384 AATGGAAAACAAAAAATGGCAGG - Intergenic
1010524218 6:76880568-76880590 AAAGGAGAATAGAAGGTGGAGGG + Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010591399 6:77717088-77717110 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1010592336 6:77725550-77725572 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1010686475 6:78859590-78859612 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1010780834 6:79944833-79944855 AAGGGGAAACAGAAATGGGCGGG - Intronic
1011088896 6:83572546-83572568 AAAGGAAAAAAAAAGTTGGCTGG - Intronic
1011313631 6:86007185-86007207 AATGGAAAACAAAAAATGGCAGG + Intergenic
1011950078 6:92954171-92954193 AATGGAAAACAAAAAATGGCAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012458202 6:99430173-99430195 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1012540572 6:100356886-100356908 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1012594997 6:101029174-101029196 AATGGAAAACAAAAAATGGCAGG - Intergenic
1012969966 6:105718433-105718455 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1013263432 6:108470096-108470118 ATGGGAAATCAGAAGGTGAGAGG - Intronic
1013555728 6:111255241-111255263 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1014464287 6:121736849-121736871 AATGGAAAACAGAAAGAAGCAGG - Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014800773 6:125775990-125776012 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015464290 6:133531130-133531152 AAGGGCAAAGAGAAGCCGGCTGG + Exonic
1015574722 6:134659253-134659275 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1015878182 6:137845182-137845204 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1017171054 6:151455353-151455375 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1017187763 6:151619357-151619379 AATGGAAAACAGAAAGTGACAGG - Exonic
1018024620 6:159794874-159794896 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1018316945 6:162565902-162565924 AATGGAAAACAAAAAATGGCAGG + Intronic
1018325360 6:162661968-162661990 TAGGGAATACAAAAGGTGGGAGG - Intronic
1018857974 6:167689107-167689129 AAAGGAACACAGCGGGTGGCAGG - Intergenic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1019826892 7:3291994-3292016 AAGGTTAGACAGAAGATGGCAGG - Intergenic
1019976073 7:4582569-4582591 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1019977007 7:4591073-4591095 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1019977943 7:4599576-4599598 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1020137628 7:5595583-5595605 AAGGATGAATAGAAGGTGGCAGG + Intronic
1020814479 7:12888476-12888498 AAAAGAAAAGAAAAGGTGGCTGG - Intergenic
1020907677 7:14084653-14084675 AAGGAAAACCAGAAGGAGACAGG - Intergenic
1021067844 7:16198524-16198546 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1021296022 7:18906984-18907006 AAGAGAAAACACAAGATGGAAGG + Intronic
1021671651 7:23040658-23040680 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1021907257 7:25347468-25347490 GTGGGAAAAGAGAAGGTGTCTGG + Intergenic
1022164247 7:27741797-27741819 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1022352881 7:29582113-29582135 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1022738446 7:33098419-33098441 AAGGTAAAACAGAGGGTCTCTGG + Intronic
1023280692 7:38566055-38566077 AAGGGAAAGGAGCAGGTGGTGGG - Intronic
1023906288 7:44524053-44524075 AAGGGAAAAATGAAGGTGTCGGG - Intronic
1024624828 7:51197836-51197858 AATGGAAAACAGAAGAAAGCAGG - Intronic
1024994104 7:55258138-55258160 AAGGGGAAAAAAAAGTTGGCAGG - Intergenic
1025019209 7:55467472-55467494 AACTGTACACAGAAGGTGGCTGG - Intronic
1025850911 7:65243177-65243199 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1027945489 7:84739702-84739724 AAGTGCTAGCAGAAGGTGGCAGG + Intergenic
1028211505 7:88079664-88079686 AATGGAAAACAAAAAATGGCAGG + Intronic
1028492512 7:91427974-91427996 GAGAGAAAACATAAGGTGGCTGG + Intergenic
1028562126 7:92187565-92187587 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029534702 7:101149996-101150018 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1029884574 7:103854731-103854753 AAGGGAACAAAGAACGTGTCAGG + Intronic
1029916211 7:104212049-104212071 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1030275676 7:107719079-107719101 AAGGTAAAATAAAAGGTGGAAGG + Intergenic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1030407164 7:109129137-109129159 AAGGGCAAGAAGAAGATGGCAGG + Intergenic
1030609516 7:111673610-111673632 AATGGAAGACAAAAGGGGGCAGG + Intergenic
1030760242 7:113341661-113341683 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1031323673 7:120365147-120365169 AAGGGAAAATGGAGGGTGGGAGG + Intronic
1031584349 7:123516793-123516815 TAGGGAAAACACAAGGTGGCTGG + Intronic
1031607046 7:123781439-123781461 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1031724536 7:125221313-125221335 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1033128615 7:138726377-138726399 AAGGGGAAACAGAACGTGGGGGG + Intronic
1033155294 7:138951405-138951427 AAGGGAAAAGAAATAGTGGCAGG - Intronic
1033212186 7:139468208-139468230 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1033349824 7:140553127-140553149 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034817270 7:154183362-154183384 AATGAAAAACAGAAGGTGCCTGG + Intronic
1035138284 7:156729767-156729789 TTGGGAAAATAGAAGGGGGCTGG - Intronic
1035220864 7:157405862-157405884 AATGAAAAAGAGAAAGTGGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035349721 7:158237593-158237615 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1035840016 8:2801174-2801196 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1035981032 8:4372358-4372380 AATGGAAAACAGCATGTGGAAGG - Intronic
1036291621 8:7498018-7498040 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1036292553 8:7506521-7506543 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1037232240 8:16672293-16672315 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1037351528 8:17963451-17963473 AAGTCAGAACAGAAAGTGGCTGG - Intronic
1037429509 8:18794751-18794773 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1037546902 8:19932462-19932484 AATGGAAAACAGAAAAAGGCAGG + Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1039097344 8:33900870-33900892 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039392584 8:37193511-37193533 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1039718970 8:40142017-40142039 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040094028 8:43426029-43426051 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1040126100 8:43739682-43739704 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1040413243 8:47176176-47176198 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1040458499 8:47623555-47623577 AATGGAAAACAGAAAAAGGCAGG + Intronic
1040707947 8:50152231-50152253 AATGGAAAACAAAAAATGGCAGG - Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041060685 8:54031824-54031846 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1041091007 8:54300541-54300563 AAGGGAAAAAAGAATGTTCCAGG - Intergenic
1041145748 8:54874618-54874640 GAGAGAAAACAGACTGTGGCAGG - Intergenic
1041302614 8:56429088-56429110 AGTGGAAAAAAAAAGGTGGCAGG + Intergenic
1041374487 8:57199746-57199768 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1041614001 8:59884160-59884182 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041732401 8:61075849-61075871 AAGGGAAGAAGGAAGGAGGCTGG - Intronic
1041855523 8:62449336-62449358 AATGGAATACAGCAGGTGGATGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041889520 8:62853278-62853300 AATGGAAAACAAAAGAAGGCAGG - Intronic
1041930116 8:63277278-63277300 AAGTGAACACAGAATGTGGGTGG - Intergenic
1041974172 8:63778004-63778026 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042010779 8:64242276-64242298 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1042016618 8:64320545-64320567 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1042134771 8:65622712-65622734 AAAGAAAAAAAAAAGGTGGCGGG + Intronic
1042574061 8:70198707-70198729 GAGGTAAAAGAGAAGGTGGCTGG + Intronic
1043050348 8:75377543-75377565 AGGGGAAAATGGAAGGTGGAGGG - Intergenic
1043209324 8:77491443-77491465 AAGGGAAGACTGAAGGTGGTGGG + Intergenic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1043870081 8:85422670-85422692 AATGGAAAACAGAAAAAGGCAGG - Intronic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044203167 8:89459819-89459841 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1044284618 8:90397206-90397228 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1044310235 8:90684834-90684856 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1044310367 8:90685681-90685703 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1044353646 8:91195668-91195690 AATGGAAAACAGAAAAAGGCAGG - Intronic
1045212659 8:100114589-100114611 AATGGAAAACAGAAAATAGCAGG + Intronic
1045293648 8:100854621-100854643 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048163947 8:132045553-132045575 AAGGGAAACCAGGAGAAGGCAGG - Intronic
1048203177 8:132393965-132393987 AAGGGCACACAGTAGGTAGCTGG - Intronic
1048480774 8:134790599-134790621 AGGAGAAAACAGAAGGTGTGAGG - Intergenic
1048682413 8:136858192-136858214 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1048784173 8:138032986-138033008 AAAGGAAATCAGAATGTTGCTGG - Intergenic
1048947154 8:139460049-139460071 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1049103404 8:140596284-140596306 TAAAGAAAACAGAAGCTGGCTGG + Intronic
1049167792 8:141137519-141137541 AACGGAAAACGGGAGGTGGAAGG - Intronic
1049556956 8:143287427-143287449 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1049663692 8:143832791-143832813 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1049845084 8:144796696-144796718 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1050047341 9:1560734-1560756 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1050048333 9:1572845-1572867 AAGGGAAAACATAAAAAGGCAGG - Intergenic
1050513668 9:6420052-6420074 AAGAAAAAAAAAAAGGTGGCGGG - Intronic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1051228416 9:14927555-14927577 TAAGGAAAACAGAAGGCGTCAGG - Intergenic
1051324560 9:15950941-15950963 AATGGAAAACAAAAAGAGGCAGG + Intronic
1051471345 9:17446163-17446185 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052279311 9:26715294-26715316 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1052429702 9:28350317-28350339 AATGGAAAACAAAAGAAGGCAGG + Intronic
1052451731 9:28639644-28639666 AATGGAAAACAAAAGAAGGCAGG - Intronic
1052658207 9:31392463-31392485 AAGGGAAAACAGTAAGGGCCAGG - Intergenic
1052676520 9:31633022-31633044 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1052724685 9:32215652-32215674 AATGGAAAACAAAAAATGGCAGG - Intergenic
1053521239 9:38781668-38781690 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1053799345 9:41754689-41754711 TGGGGAGACCAGAAGGTGGCAGG + Intergenic
1054145873 9:61560308-61560330 TGGGGAGACCAGAAGGTGGCAGG - Intergenic
1054193402 9:62005661-62005683 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1054322179 9:63681752-63681774 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1054645006 9:67583030-67583052 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1054843052 9:69763280-69763302 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1055157891 9:73087350-73087372 AAGGGAACTCAGAAGCTGGAGGG - Intergenic
1055556744 9:77481873-77481895 AATGGAAAACAGAAAAAGGCAGG - Intronic
1056755616 9:89380327-89380349 AAAAGAAAACAAAAGCTGGCCGG - Intronic
1056955039 9:91074710-91074732 AGGTGAAAAGAGAATGTGGCTGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057226955 9:93297496-93297518 AAGGGAAATCAGCAGGTGCCAGG - Intronic
1057282223 9:93721086-93721108 AAAGAAAAACAGAAGATGGCAGG - Intergenic
1057461819 9:95269914-95269936 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1057567018 9:96173793-96173815 AAGGGAAACCGAAAGGTGCCAGG - Intergenic
1057627455 9:96690347-96690369 ATGGGAAAACAGGAGGTAGTAGG - Intergenic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1058760769 9:108129493-108129515 AAGTGAAAACAGTAAGTGGGAGG + Intergenic
1058806312 9:108595407-108595429 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1059510589 9:114841564-114841586 AAAGGAAAACAGAAAGGAGCAGG + Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060167425 9:121429908-121429930 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1060316317 9:122514760-122514782 AGGGGAAACCAGAATCTGGCAGG + Intergenic
1060548923 9:124476171-124476193 AGGGGCACACAGGAGGTGGCTGG - Intronic
1061098333 9:128473032-128473054 AGCTGAAAACAGTAGGTGGCAGG + Exonic
1061450334 9:130664047-130664069 AAGGAAAAACAGGAGGGGGGAGG + Intergenic
1061456906 9:130705224-130705246 AAAGGAAAAGAAAAGGCGGCCGG + Intergenic
1061488799 9:130934027-130934049 AATGGAAAGCTGAAGGTGGCGGG + Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1061554312 9:131357513-131357535 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1061955340 9:133958576-133958598 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1061979448 9:134092579-134092601 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1062209064 9:135353416-135353438 AAGGGAAGACAGACGGGGCCAGG + Intergenic
1203440854 Un_GL000219v1:7203-7225 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203465795 Un_GL000220v1:85006-85028 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1203511732 Un_KI270741v1:125586-125608 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203511861 Un_KI270741v1:127214-127236 AATGGAAAACAGAATAAGGCAGG - Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186164491 X:6811968-6811990 AAGAGAAAATAGAAGGTACCAGG + Intergenic
1186673468 X:11791414-11791436 GAGGGAAAGCAGAAGCTGACAGG + Intergenic
1186931246 X:14393134-14393156 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1187198806 X:17115154-17115176 AAGGGAACTCAGAGGCTGGCAGG - Intronic
1187222841 X:17346304-17346326 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1187271060 X:17780085-17780107 AAGGGAAGAGAAAAGGTGGAAGG + Intergenic
1187362979 X:18645199-18645221 AAAGGAAAAAAGGAGGTGGCGGG - Intronic
1187761191 X:22587440-22587462 AAGGCAAAACAGAAGTCAGCAGG - Intergenic
1188494713 X:30771588-30771610 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1188778494 X:34251709-34251731 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1189062700 X:37770913-37770935 AATGGAAAACAGAAAAGGGCAGG + Intronic
1189251794 X:39606073-39606095 CAGGGAGAACAGAACTTGGCTGG + Intergenic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1189769481 X:44409549-44409571 ATGGCAAAACAGAAGCTGGTAGG - Intergenic
1190338949 X:49281282-49281304 AAGAGAAAACAGCAGCTGTCAGG + Intronic
1191050528 X:56186193-56186215 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1191137862 X:57085035-57085057 AATGGAAAACAGAAAGAAGCAGG + Intergenic
1191635336 X:63369727-63369749 AATGGAAAACAAAAAATGGCAGG + Intergenic
1191707771 X:64112561-64112583 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1191776182 X:64816069-64816091 AATGGAAAGCAGAATGTAGCAGG + Intergenic
1191821693 X:65316964-65316986 AATGGAAAACAGAAAATTGCAGG + Intergenic
1191828059 X:65387464-65387486 AATGGAAAACAGAAAAAGGCAGG - Intronic
1191916380 X:66206177-66206199 AAGGCAAGATACAAGGTGGCAGG - Intronic
1192077224 X:68011476-68011498 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1192883878 X:75317341-75317363 AATGGAAAACAAAAAATGGCAGG - Intergenic
1192918820 X:75684211-75684233 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1192965260 X:76170473-76170495 TGGAGAAAACAGAAGGTGTCTGG + Intergenic
1193059213 X:77186769-77186791 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1193786890 X:85770710-85770732 AATGGAAAACAAAAAATGGCAGG - Intergenic
1193893188 X:87077529-87077551 AAGGGAAAAGAGAAGGGGAGAGG + Intergenic
1193923332 X:87455980-87456002 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1194231950 X:91335376-91335398 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1194390073 X:93306278-93306300 AGTGGGAAAGAGAAGGTGGCTGG - Intergenic
1195092364 X:101473125-101473147 AATGGAAAACAAAAAGAGGCAGG + Intronic
1195104493 X:101591102-101591124 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195147698 X:102033744-102033766 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1195328500 X:103777287-103777309 AAGGGAAAAGAGAAGATAGAGGG - Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195832070 X:109070448-109070470 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1195875440 X:109535792-109535814 AACGGAAAACGGAAGCTGGCTGG + Exonic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1197383912 X:125780313-125780335 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1197543174 X:127791079-127791101 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1198796246 X:140398853-140398875 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1199256158 X:145720984-145721006 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1199365813 X:146981269-146981291 AAGGGAAAACAGAAAAAAGCAGG - Intergenic
1199465096 X:148127294-148127316 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1201258817 Y:12137163-12137185 AATGGAAAACAAAAAATGGCAGG + Intergenic
1201263507 Y:12183144-12183166 AATGGAAAACAAAAAATGGCAGG + Intergenic
1201321110 Y:12699449-12699471 AAGTGCAGACTGAAGGTGGCTGG + Intergenic
1201558591 Y:15290933-15290955 AAGAGAAAATAGAAGGTGCCAGG + Intergenic
1201933815 Y:19384587-19384609 AACGGAAAACAGAAGAAAGCGGG - Intergenic
1202061703 Y:20896077-20896099 AAGGGCAAGAAGAAGATGGCAGG - Intergenic
1202241658 Y:22777109-22777131 AAGGGAAAACAAAAAATGGCAGG - Intergenic
1202253092 Y:22893182-22893204 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1202394641 Y:24410853-24410875 AAGGGAAAACAAAAAATGGCAGG - Intergenic
1202406082 Y:24526931-24526953 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1202464700 Y:25143150-25143172 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1202476143 Y:25259239-25259261 AAGGGAAAACAAAAAATGGCAGG + Intergenic