ID: 961723341

View in Genome Browser
Species Human (GRCh38)
Location 3:128910115-128910137
Sequence GTTGCGGAGCCCAATGCGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961723341_961723348 16 Left 961723341 3:128910115-128910137 CCATCCGCATTGGGCTCCGCAAC 0: 1
1: 0
2: 0
3: 2
4: 107
Right 961723348 3:128910154-128910176 GCCCAGCCCAGCCTCACACAGGG 0: 1
1: 1
2: 5
3: 63
4: 617
961723341_961723347 15 Left 961723341 3:128910115-128910137 CCATCCGCATTGGGCTCCGCAAC 0: 1
1: 0
2: 0
3: 2
4: 107
Right 961723347 3:128910153-128910175 AGCCCAGCCCAGCCTCACACAGG 0: 1
1: 0
2: 3
3: 77
4: 454
961723341_961723351 21 Left 961723341 3:128910115-128910137 CCATCCGCATTGGGCTCCGCAAC 0: 1
1: 0
2: 0
3: 2
4: 107
Right 961723351 3:128910159-128910181 GCCCAGCCTCACACAGGGCCTGG 0: 1
1: 0
2: 6
3: 79
4: 853
961723341_961723343 -10 Left 961723341 3:128910115-128910137 CCATCCGCATTGGGCTCCGCAAC 0: 1
1: 0
2: 0
3: 2
4: 107
Right 961723343 3:128910128-128910150 GCTCCGCAACCACGACCACGAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961723341 Original CRISPR GTTGCGGAGCCCAATGCGGA TGG (reversed) Exonic
902938310 1:19780688-19780710 GTAGCTGAGCCCACTGCAGAGGG - Exonic
904691605 1:32297296-32297318 GTTTGGGAGGCCAAGGCGGAAGG + Intronic
906425970 1:45712898-45712920 CTTTGGGAGCCCAAGGCGGATGG - Intronic
908193871 1:61729680-61729702 CTTCGGGAGCCCAATGTGGAAGG + Intergenic
908534181 1:65063558-65063580 GTTTGGGAGGCCAAGGCGGATGG + Intergenic
919726817 1:200890155-200890177 CTTTCGGAGGCCAATACGGACGG - Intergenic
924531952 1:244900914-244900936 CTTTGGGAGCCCAAGGCGGACGG - Intergenic
1065986122 10:30953898-30953920 CTTTGGGAGGCCAATGCGGATGG + Intronic
1067142749 10:43670277-43670299 CTTTGGGAGGCCAATGCGGAAGG - Intergenic
1068990342 10:63143693-63143715 CTTGCGGAGGCCAAGGCGGGTGG - Intronic
1069963284 10:72091651-72091673 CTTTGGGAGGCCAATGCGGATGG - Intergenic
1070012996 10:72495410-72495432 CTTTGGGAGCCCAAGGCGGATGG + Intronic
1072349669 10:94544843-94544865 CTTTCGGAGCCCAAGGCGGGTGG - Intronic
1076875688 10:133214542-133214564 GTGGCGGAGCCCAGTGCTGGGGG - Intronic
1080893259 11:36427722-36427744 TTTGCAGAGCCCAGTGCAGAAGG + Intronic
1083585042 11:63850905-63850927 CTTGGGGAGGCCAATGCGGGAGG - Intronic
1089233038 11:116996574-116996596 CTTGGGGAGCCCAAGGCGGGTGG + Intronic
1092502229 12:9059921-9059943 GTTTGGGAGGCCAAGGCGGATGG - Intergenic
1092549965 12:9487484-9487506 CTTGGGGAGGCCAAGGCGGATGG + Intergenic
1093459838 12:19397976-19397998 GTTGGGGAGGCCAAGGCGGGTGG + Intergenic
1095888001 12:47208747-47208769 GTTTAGGAGCCCAAGGTGGAAGG - Intronic
1098268399 12:68746451-68746473 GTTGAGGAACACAATGCAGATGG - Exonic
1098551827 12:71771057-71771079 GTTTAAGAGCCCAATGCGTATGG - Intronic
1101228114 12:102710027-102710049 GTTTGGGAGGCCAATGCGGGAGG + Intergenic
1103727432 12:123005045-123005067 GTTGGGGAGCCCACTGGGGCAGG + Intronic
1104305759 12:127609869-127609891 GTTGCAGAGCATAATGGGGAGGG - Intergenic
1106995427 13:35475519-35475541 GTGGCGGAGGTCAAGGCGGAAGG - Exonic
1107831378 13:44376529-44376551 CTTTCGGAGGCCAAGGCGGATGG + Intronic
1113952495 13:114079821-114079843 GGTGGGGAGGCCAGTGCGGACGG - Intronic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1119911140 14:78350374-78350396 ATTGCTGAGCCCAATGCTGAAGG + Intronic
1122887096 14:104714922-104714944 CTTGCAGTGCCCAATGGGGAAGG - Intronic
1125545004 15:40496931-40496953 CTTTCGGAGGCCAAGGCGGACGG + Intergenic
1125688465 15:41578031-41578053 GCTGAGGAGCCCACTGCGGGAGG + Exonic
1133672898 16:8041400-8041422 GTTGGGGAGGCCAAGGCGGGCGG + Intergenic
1139713410 16:68793646-68793668 CTTGGGGAGGCCAAGGCGGATGG + Intronic
1141180471 16:81749595-81749617 GTTTGGGAGGCCAAGGCGGATGG - Intronic
1141964095 16:87429848-87429870 CTTTGGGAGCCCAAGGCGGACGG - Intronic
1142641943 17:1289390-1289412 GTTGAGGAGCCCATGGGGGATGG - Intronic
1145718804 17:27049351-27049373 GTTGGGGAGCCCTGTGGGGAGGG - Intergenic
1148057863 17:44812069-44812091 CTTTGGGAGCCCAAGGCGGATGG + Intronic
1148141111 17:45329508-45329530 CTTTGGGAGCCCAAGGCGGACGG - Intergenic
1148697022 17:49566868-49566890 GTTGCGCAACCCAATGAGGTAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155052022 18:22156841-22156863 GTTTGGGAGGCCAAGGCGGACGG + Intergenic
1157374154 18:47148232-47148254 CTTTGGGAGCCCAAGGCGGATGG - Intronic
1157977549 18:52342599-52342621 GTTTGGGAGACCTATGCGGACGG + Intronic
1162601452 19:11673291-11673313 TTTTGGGAGGCCAATGCGGATGG - Intergenic
1162813021 19:13176059-13176081 GTTTGGGAGGCCAAGGCGGACGG - Intergenic
1165851284 19:38851653-38851675 CTTGGGGAGGCCAAGGCGGAAGG + Intronic
1166848553 19:45745813-45745835 CTTTCGGAGGCCAAGGCGGATGG - Intronic
1167003333 19:46758771-46758793 CTTTGGGAGCCCAAGGCGGACGG + Intronic
1167003785 19:46762127-46762149 GTTTGGGAGGCCAAGGCGGATGG + Intronic
1168519537 19:57037480-57037502 GGTGGGGAGCCCCATGAGGAGGG - Intergenic
929674379 2:43910476-43910498 CTTTCGGAGGCCAAGGCGGAAGG - Intronic
935650602 2:105378640-105378662 GTTGCGGAGCTGAGTGCAGATGG - Intronic
937869067 2:126774831-126774853 GTTTCCGAGCCCAAGGCAGATGG + Intergenic
938892102 2:135716081-135716103 CTTTGGGAGGCCAATGCGGAAGG + Intronic
941011260 2:160302436-160302458 TTTGGGGAGGCCAAGGCGGAAGG - Intronic
942322953 2:174751921-174751943 CTTTCGGAGGCCAAGGCGGATGG - Intronic
944419914 2:199518582-199518604 GTTTGGGAGCCCAATGCCGGTGG - Intergenic
947496355 2:230640287-230640309 CTTTCGGAGGCCAAGGCGGATGG + Intergenic
1174016104 20:47489610-47489632 GTTTGGGAGGCCAAGGCGGAAGG + Intergenic
1182805618 22:33067736-33067758 GTTTGGGAGGCCAAGGCGGATGG + Intergenic
950280074 3:11699561-11699583 GTTTGGGAGGCCAAGGCGGATGG + Intronic
950817129 3:15716851-15716873 CTTGGGGAGGCCAAAGCGGAAGG + Intronic
950873232 3:16247441-16247463 GCTGCGGCGCTCAATGCAGACGG - Intergenic
955372980 3:58369580-58369602 CTTGGGGAGGCCAATGCGGGTGG + Intronic
958858013 3:99410206-99410228 GTTGGGGAGGCCAGTGAGGAAGG - Intergenic
960292281 3:115900269-115900291 GTTTGGGAGCCCAATGTGGGTGG + Intronic
961246651 3:125459680-125459702 CTTTGGGAGCCCAAGGCGGATGG - Intronic
961723341 3:128910115-128910137 GTTGCGGAGCCCAATGCGGATGG - Exonic
962557759 3:136572930-136572952 GCTTTGGAGGCCAATGCGGAAGG + Intronic
963207560 3:142652046-142652068 GTTGGGGAGTCAAATGGGGAGGG + Intronic
967898739 3:194424975-194424997 GTTCCTCAGCCCACTGCGGAGGG - Intronic
969423645 4:7111338-7111360 GTTGGGGAGCCCAAGGCTGGTGG + Intergenic
972572652 4:40324897-40324919 CTTTCGGAGGCCAAGGCGGACGG + Intergenic
973253148 4:48082425-48082447 GTTGTGGAGACCAATACAGATGG - Intronic
975554876 4:75652377-75652399 GTTTGGGAGGCCAATGCGGGTGG + Intronic
975590633 4:75996323-75996345 CTTGGGGAGGCCAAGGCGGACGG - Intergenic
979192910 4:117885116-117885138 GTTGGGGAGGCCAAGGCGGGTGG - Intergenic
985977459 5:3431673-3431695 GTTGCAGAGCCCAAGGTGGAAGG - Intergenic
991068396 5:62449140-62449162 TTTGGGGAGGCCAATGCAGAAGG - Intronic
992943712 5:81789065-81789087 CTTGGGGAGGCCAATGCGGGCGG - Intergenic
994937727 5:106277103-106277125 CTTGGGGAGGCCAAGGCGGACGG + Intergenic
1003050955 6:2781063-2781085 GGTGTGGAGGCAAATGCGGACGG - Intronic
1004519133 6:16345878-16345900 GTTTGGCAGCCCAATGCTGAAGG - Intronic
1007567314 6:42862091-42862113 CTTGAGGAGGCCAAGGCGGATGG + Intronic
1013529071 6:111002574-111002596 GTTGGGGAGGCCAAGGCGGGAGG - Intronic
1019461740 7:1162813-1162835 CTTGGGGAGGCCAAGGCGGATGG - Intergenic
1021247360 7:18280206-18280228 GTTTGGGAGGCCAAGGCGGAAGG + Intronic
1026913271 7:74105195-74105217 GTTGGGGAGGCCAAGGTGGATGG - Intronic
1029836620 7:103318966-103318988 CTTTGGGAGGCCAATGCGGACGG + Intronic
1035463652 7:159062014-159062036 CTTGCGGAGCCCCATCCCGAGGG + Intronic
1040087900 8:43364902-43364924 GATGCGGAGCCCAAAGGGCAGGG + Intergenic
1051422806 9:16905434-16905456 GTTTGGGAGCCCAACGCGGGTGG - Intergenic
1053817236 9:41925348-41925370 GTTTGGGAGGCCAAGGCGGACGG + Intronic
1054107488 9:61069004-61069026 GTTTGGGAGGCCAAGGCGGACGG + Intergenic
1054613369 9:67262121-67262143 GTTTGGGAGGCCAAGGCGGACGG - Intergenic
1055315307 9:75028387-75028409 CTGGCGGAGCCCAGCGCGGATGG - Exonic
1057024284 9:91723955-91723977 GGTGCAGATCCCAATGCAGATGG - Exonic
1057078813 9:92156506-92156528 CTTTCGGAGCCCAAGGTGGAAGG + Intergenic
1057336307 9:94158091-94158113 CTTTCGGAGGCCAATGCGGGAGG + Intergenic
1060930978 9:127489437-127489459 GTTGCAGAGCGCGATGCAGAAGG + Exonic
1062615048 9:137392529-137392551 GTAGGGGAGCCCACTGGGGAGGG + Intronic
1185454495 X:301867-301889 CTTTGGGAGGCCAATGCGGATGG - Exonic
1185640232 X:1586438-1586460 CTTGCGGAGGCCAAGGCGGGTGG - Intergenic
1189790857 X:44603317-44603339 GAGGCGGAGGCCAAGGCGGATGG + Intergenic
1190843648 X:54170374-54170396 CTTGGGGAGGCCAAGGCGGATGG - Intronic
1190846102 X:54192058-54192080 GTTTGGGAGGCCAAGGCGGATGG + Intergenic