ID: 961724001

View in Genome Browser
Species Human (GRCh38)
Location 3:128913979-128914001
Sequence TCTTACATGCCAATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961723994_961724001 26 Left 961723994 3:128913930-128913952 CCTTCTGGAAGGGGGCTTCACTC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 961724001 3:128913979-128914001 TCTTACATGCCAATGGAGAATGG 0: 1
1: 0
2: 1
3: 19
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961724001 Original CRISPR TCTTACATGCCAATGGAGAA TGG Intronic
902655668 1:17866256-17866278 TTTTACATGCCAATGGGAAGGGG - Intergenic
902721905 1:18309523-18309545 ACTTCCACGCCAATGGGGAAAGG - Intronic
902742909 1:18452353-18452375 AGTCACATGCCAATGTAGAAAGG - Intergenic
904005685 1:27362016-27362038 TCTAGCATGCCAATGGACATAGG + Intronic
905535680 1:38720014-38720036 TCTTCAATGCCCATGGTGAATGG - Intergenic
907798924 1:57744733-57744755 TCACACCTGCCAGTGGAGAATGG - Intronic
908907344 1:69030973-69030995 ACTTACAGGCCAGTGGAAAATGG + Intergenic
909674827 1:78227324-78227346 TCTTACATGGCAAAAGTGAAAGG - Intergenic
910101523 1:83583092-83583114 TCTTACATGGCAGTGGCAAAAGG - Intergenic
911822483 1:102438938-102438960 TCTTACATGCTAAATGAGAAGGG - Intergenic
911874582 1:103143290-103143312 TCTTCCTTGCATATGGAGAAGGG - Intergenic
912280402 1:108306963-108306985 TCTTACAGGCCAGTAGAGAGTGG - Intergenic
912287824 1:108387394-108387416 TCTTACAGGCCAGTAGAGAGTGG + Intronic
912588504 1:110788837-110788859 TCTTACAGGCCAGGAGAGAATGG + Intergenic
912902075 1:113662139-113662161 TTTTACCTGTCAATGGGGAATGG - Intronic
912935021 1:113995533-113995555 CCTTACAGGCCAAGAGAGAATGG + Intergenic
913142043 1:115951066-115951088 TGATACAGCCCAATGGAGAATGG + Intergenic
913314622 1:117539511-117539533 GTGTACATGCAAATGGAGAAGGG + Intergenic
914460375 1:147878189-147878211 GCAAAGATGCCAATGGAGAACGG - Intergenic
914672192 1:149879369-149879391 TGTGACATGCCTGTGGAGAAGGG + Intronic
915735629 1:158083104-158083126 TCTTAGAAGCCTATGGAGATAGG + Intronic
916614665 1:166427786-166427808 TCCTACAAGCCAACAGAGAATGG - Intergenic
917446844 1:175113383-175113405 TCTTACAGGCCAGGAGAGAAAGG - Intronic
918525215 1:185457095-185457117 GCTTACATCCCAGTGGAGGAAGG - Intergenic
922014302 1:221628968-221628990 CCTTACAGGCCAAGAGAGAATGG - Intergenic
922043924 1:221925090-221925112 ACTTACATGTGAATAGAGAAGGG + Intergenic
923461918 1:234215364-234215386 CCTTGCTTTCCAATGGAGAAGGG + Intronic
923989480 1:239419795-239419817 TCTTATAAGCCCATGAAGAATGG - Intronic
924375544 1:243404108-243404130 GCTTACATGCGAAGGGATAAAGG + Intronic
1062859445 10:798899-798921 TCTTACAAGCCAAGAGAGACTGG + Intergenic
1063594229 10:7418964-7418986 GCTTGCATGGCAATGGAGGAAGG + Intergenic
1065272132 10:24045159-24045181 TCTCAAAAGACAATGGAGAAAGG - Intronic
1065420438 10:25537827-25537849 TCTTACATGGCAGAGGAGGAAGG - Intronic
1068446633 10:57133444-57133466 TAATACATGCCAAAGCAGAAAGG + Intergenic
1069227649 10:65963542-65963564 TTTTACATGCCAATGTTGTATGG + Intronic
1069658689 10:70109191-70109213 TCTTACCTGCCGCTGGGGAAAGG - Exonic
1069757660 10:70782960-70782982 CCTTAGAGGCGAATGGAGAATGG - Intronic
1070127263 10:73632457-73632479 CCTTACATGACAATGTAGAAAGG + Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1073437873 10:103532588-103532610 CCTTACAGGCCAGTAGAGAATGG - Intronic
1074180897 10:111061822-111061844 CCTTACAGGCCAAGAGAGAATGG + Intergenic
1076590475 10:131578831-131578853 TCTTCCAACCCAATGGAGCAGGG - Intergenic
1078713081 11:13813922-13813944 TCTTACATGGCAATGGCAAGAGG + Intergenic
1079028541 11:16967946-16967968 CTTTCCATGCCAAGGGAGAATGG - Intronic
1079074771 11:17377529-17377551 TTTTACATGCTAAATGAGAAAGG - Intergenic
1079648636 11:22898378-22898400 TATTATAAGCCAATGGGGAATGG + Intergenic
1082238751 11:49851332-49851354 TCTTCCATGCCTACTGAGAAGGG - Intergenic
1082823939 11:57564272-57564294 TCTTACAGGCCAAGAGAGAGTGG + Intronic
1083137750 11:60695037-60695059 TCTTACAGGCCAGAAGAGAAGGG + Intergenic
1083934119 11:65861424-65861446 TCTTCCATGCCAGTGAGGAAGGG + Exonic
1085647370 11:78234534-78234556 ATATAGATGCCAATGGAGAAAGG - Intronic
1085981475 11:81731464-81731486 TCTTACAAGCCAGGGGAGAGTGG - Intergenic
1086464687 11:87040850-87040872 TCTTAAGTGCCACCGGAGAAGGG - Intronic
1086853172 11:91835563-91835585 TCATACATGCAAACTGAGAATGG - Intergenic
1088176642 11:107060130-107060152 TTTTTAAAGCCAATGGAGAAAGG + Intergenic
1088941375 11:114460723-114460745 TATCACAAGCCAGTGGAGAAAGG - Intergenic
1089251589 11:117166800-117166822 TCTGACAGCCAAATGGAGAATGG + Intronic
1090128554 11:124115880-124115902 TCTTACATTTCTATAGAGAAGGG - Intronic
1091911851 12:4238903-4238925 TCTTACAGGCCAGGAGAGAATGG - Intergenic
1093981294 12:25478424-25478446 TCTTACATGATAAAAGAGAAAGG + Intronic
1095326500 12:40900573-40900595 TTTGACATGCTAATGGAAAATGG + Intronic
1096624251 12:52883988-52884010 TCTTAAATGCCAATGGGGGCAGG - Intergenic
1097595434 12:61622719-61622741 TCTTACAGGCCAGAAGAGAATGG + Intergenic
1097636383 12:62127342-62127364 TTATACCTGCCAATGGAGAAAGG - Intronic
1097791441 12:63819482-63819504 TCTTACAGGCCAAGGGAGAGTGG + Intergenic
1098696927 12:73571567-73571589 TCATACATGGTAATAGAGAAAGG - Intergenic
1099587836 12:84544381-84544403 TCTTATAGGCCAAGAGAGAATGG - Intergenic
1099645208 12:85344321-85344343 GCTTACATTCCAATGGAAGAAGG + Intergenic
1099743521 12:86671431-86671453 TCTTACATGCCAGGAGAGAGTGG + Intronic
1099784397 12:87241969-87241991 TCTGACATTCCACTGTAGAAAGG - Intergenic
1100163888 12:91894480-91894502 TCTAAGATGCCAATAGTGAATGG - Intergenic
1101126504 12:101640674-101640696 ACTTACATGGCAATGTAAAATGG + Intronic
1104549134 12:129739845-129739867 TGTTAATTACCAATGGAGAAGGG - Intronic
1105478787 13:20754307-20754329 TCTTACATGCCAGGAGGGAATGG - Intronic
1105668288 13:22585195-22585217 TCTTACAAGCCAAAAGAGAATGG - Intergenic
1110322196 13:74173232-74173254 CCTACCATGCCAGTGGAGAAAGG + Intergenic
1110909509 13:80938703-80938725 CCTTACATGCCAGGAGAGAATGG - Intergenic
1111223709 13:85241484-85241506 TTTTATATGCCAAGGAAGAATGG - Intergenic
1111327285 13:86715669-86715691 CCTTACATGTCAAAAGAGAATGG + Intergenic
1112219473 13:97473452-97473474 TCTTACTTGCCAAGGGAAAGAGG + Intergenic
1112395220 13:99023765-99023787 GCTGACAGGCCAATGGAGAGAGG - Intronic
1115275881 14:31608060-31608082 CCTTACAGGCCAAGAGAGAATGG + Intronic
1115673064 14:35637886-35637908 TCTTACAGGCCAGGAGAGAATGG + Intronic
1115923137 14:38400314-38400336 TTTTACAAGAAAATGGAGAAAGG + Intergenic
1119582475 14:75799305-75799327 TATTCCATGCAAATGGATAACGG - Intronic
1120934056 14:89875949-89875971 TGTCAGATGCCAATGGAAAAGGG + Intronic
1121804620 14:96806268-96806290 TCTTATATACCCATGGAGGATGG - Intronic
1123935559 15:25192408-25192430 TCACACTTGCCAATGGGGAAGGG - Intergenic
1126435723 15:48635696-48635718 TCTTAAAAGCAAATGGAAAATGG + Intronic
1127438136 15:58978784-58978806 TTTTAAATGACAATAGAGAATGG - Intronic
1127516955 15:59705132-59705154 TCAGACATGACAATGGAAAATGG + Intergenic
1127673922 15:61222417-61222439 TCTTACATGCTAATGCTAAAAGG - Intronic
1128934444 15:71733259-71733281 TCTTCCATGTCAATGGAGTCTGG + Intronic
1129571946 15:76697092-76697114 TCTTACATGTCAAAGAAGAAAGG + Intronic
1129971586 15:79782152-79782174 TCCTACATGCCAAAAGAGATGGG + Intergenic
1131091422 15:89627412-89627434 TCATTTATGCAAATGGAGAAAGG + Exonic
1131536384 15:93241261-93241283 TCTTACCAAGCAATGGAGAAAGG - Intergenic
1131588634 15:93723323-93723345 TCTAACATGCAATTTGAGAAAGG + Intergenic
1133697647 16:8280157-8280179 CCTTATATGGCAATGGTGAAGGG + Intergenic
1134494635 16:14723044-14723066 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134500018 16:14762164-14762186 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134545843 16:15107563-15107585 TCTCACAAGCAAAGGGAGAATGG + Intronic
1136488731 16:30590700-30590722 TGGTAAAGGCCAATGGAGAAAGG - Intergenic
1137937321 16:52646877-52646899 TGTTATATGGCAATAGAGAATGG - Intergenic
1138639252 16:58369955-58369977 TCTTTCATGGCATTGGAGATGGG + Intronic
1140630917 16:76851236-76851258 TACTACATGCCATTAGAGAAGGG + Intergenic
1142870092 17:2814475-2814497 CCTTCCATGCCGATGGGGAAGGG - Intronic
1143510783 17:7394098-7394120 ACTTACCTGCCATGGGAGAAGGG + Exonic
1148629366 17:49094832-49094854 TCTTCCAAACCAATAGAGAAGGG - Intergenic
1149507691 17:57209102-57209124 ACAGACAAGCCAATGGAGAAAGG + Intergenic
1151265847 17:72954411-72954433 TGTTACACGCCAGTGGAAAAGGG + Intronic
1151423451 17:74014147-74014169 TCTTGCCTGACAAAGGAGAATGG - Intergenic
1153352520 18:4096651-4096673 TCTTAGATCTCAAGGGAGAATGG + Intronic
1156391974 18:36659476-36659498 TCTTACATCCCATTTGACAAGGG - Intronic
1158361319 18:56677287-56677309 TCTTACAGGCCAGGGGAGAGTGG - Intronic
1159416715 18:68159528-68159550 CCTCACATGCCAGTAGAGAATGG - Intergenic
1160440446 18:78885760-78885782 CTTTACATGCCAAGGGAGATTGG + Intergenic
1164398154 19:27884154-27884176 TTTGACATGCCAAGTGAGAAGGG - Intergenic
1167962485 19:53117548-53117570 CCTTACAGGCCAACAGAGAATGG + Intronic
1167997998 19:53422110-53422132 TTTTACATGTCAATGGAAACCGG + Intronic
926860449 2:17303182-17303204 TCATACATTGCAATGGAGAAGGG - Intergenic
928311644 2:30215593-30215615 TGTTACACGCCAGTGGGGAAAGG + Intergenic
929758797 2:44789233-44789255 TCTACCTTGCCAATGAAGAATGG - Intergenic
930489215 2:52046759-52046781 TCTAACACACCACTGGAGAATGG - Intergenic
931895735 2:66727481-66727503 TCTTATATTACAATGGAGACCGG + Intergenic
935132788 2:100273837-100273859 TCTTTCATGCTAGTGGAGAGTGG - Exonic
935500152 2:103829563-103829585 TCTTACAAGCCAGAGGAGATTGG - Intergenic
936794777 2:116192198-116192220 CCTTACAGGCCAAGAGAGAATGG - Intergenic
940098207 2:150002739-150002761 ATTTACATGCAAATGAAGAAGGG - Intergenic
941116870 2:161481792-161481814 CCTTACAAGCCAAGAGAGAATGG + Intronic
941560058 2:167033700-167033722 CCTTACAGGCCAAGAGAGAATGG + Intronic
941858783 2:170256448-170256470 TCTTACAAGCCAGAAGAGAATGG + Intronic
943283283 2:185964829-185964851 TTTTACATGCTAAGTGAGAAGGG + Intergenic
943833335 2:192488993-192489015 TGTTACATGACAAAGGAAAAAGG + Intergenic
944113989 2:196167871-196167893 CCTTAAATGCCTATGTAGAAAGG - Intronic
944842506 2:203637888-203637910 GCTTACATTGCACTGGAGAAGGG + Intergenic
945959889 2:216122066-216122088 TCTTCCTTGCCAAGTGAGAAAGG - Exonic
946457920 2:219843800-219843822 TATTATATCCCAATGGAAAATGG - Intergenic
948181375 2:235983415-235983437 TCTTACAGGAAAAAGGAGAATGG - Intronic
1169038317 20:2471352-2471374 TCTTACATTCTAATGGGGAGGGG - Intronic
1173383760 20:42569640-42569662 TCCTAGATGCCAAATGAGAATGG + Intronic
1175594607 20:60220958-60220980 TCTTCCATGCCACTGGGGAGGGG + Intergenic
1176785916 21:13255637-13255659 TCTTGCCTGCCAATGATGAAAGG + Intergenic
1178804822 21:35830292-35830314 TCAAACATTCCAGTGGAGAATGG + Intronic
1182863101 22:33578209-33578231 TCATACATGAGAATGCAGAAGGG + Intronic
949830457 3:8208773-8208795 GCTTACATTCCAATGGAAGAGGG - Intergenic
951605316 3:24427063-24427085 TCTCACATGTCAATGATGAATGG - Intronic
953234336 3:41093130-41093152 TATAACATGCGAGTGGAGAATGG - Intergenic
954481085 3:50802599-50802621 ACTTACAGGCCAATAGAGAGTGG - Intronic
955659651 3:61283838-61283860 TCATAGATGCCTTTGGAGAATGG - Intergenic
956067179 3:65409278-65409300 TGTTACATGCCAGGAGAGAAGGG + Intronic
957369425 3:79272926-79272948 TCTCACAGGCCAGGGGAGAATGG + Intronic
957445967 3:80313301-80313323 TCTTACAAGCCAGAAGAGAAAGG + Intergenic
957819522 3:85353309-85353331 TCTTACATTGCAATTGAGAGGGG - Intronic
957843159 3:85697652-85697674 TCTTTTATGCCATTAGAGAAAGG - Intronic
959807795 3:110578350-110578372 TTTTACATACTAATTGAGAAAGG - Intergenic
960499105 3:118413608-118413630 TCTTACAGGCCAGTAGAGAGTGG + Intergenic
961724001 3:128913979-128914001 TCTTACATGCCAATGGAGAATGG + Intronic
962603516 3:137012682-137012704 GCTTACATTCCAATGGGGTAAGG + Intergenic
963879110 3:150507574-150507596 CCTTACAGGCCAATAGAGAATGG + Intergenic
964704088 3:159600037-159600059 TCTTACAGGCCAGAAGAGAATGG - Intronic
965982978 3:174715524-174715546 TCTCACATTTCACTGGAGAATGG + Intronic
965995939 3:174883536-174883558 TGTCACATGATAATGGAGAAAGG + Intronic
970439050 4:16064215-16064237 TCTCAAATGCCAATGCAGTAGGG + Intronic
970970274 4:21975334-21975356 TCTTACATGACTATGCTGAATGG + Intergenic
971490489 4:27207098-27207120 TATTATATTCCAATTGAGAAAGG - Intergenic
971624009 4:28895396-28895418 TCCTACAAGCCAGAGGAGAATGG + Intergenic
974688239 4:65260756-65260778 ACTAACATGTCAATTGAGAAAGG - Intergenic
975173333 4:71258725-71258747 TTTTATGTGCCAAGGGAGAAAGG - Intronic
975259330 4:72277880-72277902 TCTTATATGCCAAGGGAAGAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976436287 4:85022324-85022346 TCTTACATGGCAGTGGGCAACGG + Intergenic
977742502 4:100504153-100504175 TCTTCCATCCCCAAGGAGAAGGG + Intronic
978708096 4:111741385-111741407 TCTTACAAACCAAAGGAAAAGGG - Intergenic
979275511 4:118810760-118810782 GAGTAAATGCCAATGGAGAAAGG + Intronic
979496049 4:121383608-121383630 TGTTAAATGGCAATGGAGAATGG + Intergenic
979884584 4:126010707-126010729 TCTTACAGGCCAGTAGAGAATGG + Intergenic
980432029 4:132713744-132713766 TCTCACATACTAATGGGGAAAGG - Intergenic
980499567 4:133630892-133630914 GCTTCCAGGCCAACGGAGAATGG - Intergenic
980629790 4:135416401-135416423 TGTCACATGGCAAAGGAGAAAGG - Intergenic
980825423 4:138066225-138066247 TCTTACAGGCCAGGAGAGAATGG + Intergenic
981443340 4:144808097-144808119 TCTTACAGGCCAGAAGAGAATGG + Intergenic
982643150 4:157987843-157987865 TCTTACTGGCCAATAGACAAGGG - Intergenic
986196289 5:5539066-5539088 TGTTAGATGCAAATGGATAATGG - Intergenic
986232582 5:5880241-5880263 TGTTACATGCCACTGCGGAAGGG + Intergenic
988336968 5:29920175-29920197 TCTTACATGCTAAGTAAGAAGGG + Intergenic
988824402 5:34920557-34920579 ACTTACATTCTAATGGAGACAGG + Intronic
990254126 5:53947326-53947348 TCTTTCCAGCTAATGGAGAAAGG - Intronic
990826534 5:59905998-59906020 TGTTTCCTGGCAATGGAGAAGGG + Intronic
992454044 5:76900058-76900080 CCTTACAGGCCAAGAGAGAATGG - Intronic
993437283 5:87913379-87913401 TCTTACAGGCCAAAAGAGATGGG + Intergenic
993958770 5:94270661-94270683 TATCACAGACCAATGGAGAAGGG + Intronic
995775997 5:115725577-115725599 TGTTACATGATAAAGGAGAAAGG + Intergenic
996208459 5:120774219-120774241 TCTTAGCTACCTATGGAGAAGGG + Intergenic
996593561 5:125175984-125176006 TCTTACATTCTAATGAACAAAGG + Intergenic
996983887 5:129535301-129535323 TCTTTCAAGCCAATTGTGAATGG - Intronic
999485964 5:151996560-151996582 TCTTACAGGCCAATAGAGAATGG - Intergenic
999659351 5:153842732-153842754 TGTCACATGGCAAGGGAGAAAGG - Intergenic
999936244 5:156488470-156488492 TCTTACAGGCCAGGAGAGAATGG + Intronic
999975495 5:156908129-156908151 TCTTTCATCTCAGTGGAGAAGGG + Intergenic
1000433717 5:161181810-161181832 TCTTACATGCCAGGAGAGCATGG + Intergenic
1000916907 5:167093696-167093718 TCTTACCAGCCAGTGTAGAAAGG + Intergenic
1002024436 5:176387493-176387515 TCTTTCATGCCAGAGGAAAATGG + Intronic
1002678452 5:180938778-180938800 TCTTACAGGCCAAGAGAGAAAGG + Intronic
1003047475 6:2747042-2747064 TCTTACTTGTAAATGGAGAAGGG - Intronic
1006265761 6:32921886-32921908 TCTAAGATGTCAATGGAGATGGG + Intergenic
1006757024 6:36424972-36424994 AATTACATGCCACTTGAGAAAGG - Intronic
1008303966 6:49877926-49877948 TCTTATATGCGAATGGAGTATGG + Intergenic
1009474660 6:64075372-64075394 TATTACATGCTATTGGAGATTGG + Intronic
1009557978 6:65199336-65199358 TCTGACAGGTCATTGGAGAATGG - Intronic
1009683551 6:66927825-66927847 TTTGACATGCCAAGTGAGAAGGG - Intergenic
1010573470 6:77505994-77506016 TCTTACATGCAAAATTAGAAGGG + Intergenic
1013763399 6:113545405-113545427 CCTTGCATGCCAAGAGAGAATGG + Intergenic
1014357105 6:120426189-120426211 CCTTACAAAGCAATGGAGAAGGG + Intergenic
1014756295 6:125304936-125304958 TATTACATGGCAAAGGAGAATGG + Intergenic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1017974145 6:159339797-159339819 TCTTACAGGCCAGGAGAGAATGG + Intergenic
1018610439 6:165643020-165643042 TTTGACTTGCCACTGGAGAATGG - Intronic
1020995246 7:15255508-15255530 TCTTACATGGCTTTGGAGACAGG - Intronic
1022870205 7:34470261-34470283 CCTTACAGGCCAAGAGAGAATGG - Intergenic
1023232359 7:38048557-38048579 TCTTACGGGCCAGTAGAGAATGG - Intergenic
1023559891 7:41462830-41462852 TCAGAAATGCCACTGGAGAACGG + Intergenic
1026517937 7:71088785-71088807 CCTCACTTGCCAATGGAGGAAGG - Intergenic
1028057440 7:86264009-86264031 TCTTATATACCAAAGGAGAATGG - Intergenic
1028799742 7:94949056-94949078 TCTTAAATACCAAGGGAGAATGG + Intronic
1030045887 7:105495063-105495085 TTTTCCATGCTAATGGAAAAAGG - Intronic
1030230801 7:107206333-107206355 TCTTGCATGCCAGTTGAGAGTGG - Intronic
1030476585 7:110042104-110042126 TCTTATATGCCAAGCGAGAATGG - Intergenic
1031397920 7:121294580-121294602 GCTTATATGCCATTGGAAAAGGG + Intronic
1033981824 7:147174509-147174531 CCTTACATTCCCATGAAGAAAGG + Intronic
1035910893 8:3565295-3565317 TCTCCCATGCCACTGGGGAAAGG - Intronic
1037126309 8:15354539-15354561 TGTTACATGGCAACAGAGAATGG - Intergenic
1038056599 8:23864181-23864203 TACTACATGTGAATGGAGAAAGG - Intergenic
1038411424 8:27362394-27362416 TCTTCTAGCCCAATGGAGAAGGG + Intronic
1045171485 8:99675265-99675287 TCTTACAGGCCAGAGGAGAGTGG - Intronic
1046956033 8:120063785-120063807 TCTTACAGGCCATCTGAGAAAGG - Intronic
1048878178 8:138852833-138852855 TCTTAAATGTCAAATGAGAAGGG + Intronic
1048984040 8:139721660-139721682 TATCACATACCAGTGGAGAAAGG - Intergenic
1050022729 9:1301844-1301866 TCATGCATTCCAATGGAAAAGGG + Intergenic
1050196152 9:3086522-3086544 TGTTACATGCTAAATGAGAAGGG - Intergenic
1050906283 9:11011159-11011181 GCTTACAAGTCAAAGGAGAAAGG + Intergenic
1050906676 9:11014128-11014150 GCTTACAGGCCAGTAGAGAATGG - Intergenic
1052477371 9:28977258-28977280 TATTATATACAAATGGAGAACGG + Intergenic
1055165521 9:73186822-73186844 TCTTACAGGCCAGAAGAGAATGG + Intergenic
1055251326 9:74310067-74310089 TCTAACATGTCAAGAGAGAAGGG + Intergenic
1055600500 9:77912693-77912715 TCAGACAAGCCAATGGAAAAAGG + Intronic
1055824038 9:80302685-80302707 TCTTTCATCCCAGTGGGGAAGGG - Intergenic
1056002653 9:82233250-82233272 CCTTACAGGCCAGGGGAGAATGG + Intergenic
1056021778 9:82445500-82445522 TCTTCCAGGCCTATGGTGAAGGG - Intergenic
1058042270 9:100315726-100315748 CCTTACAGGCCAAAAGAGAATGG - Intronic
1058512502 9:105735609-105735631 TCTTACAGGCCAAGAGAAAATGG - Intronic
1059487068 9:114634983-114635005 TCCTACGTGCCAACGGATAAAGG - Intronic
1060244962 9:121937576-121937598 TACTATATGCCAATAGAGAAGGG - Intronic
1061619572 9:131803052-131803074 TCTAACATCCCATTGGACAATGG + Intergenic
1187845120 X:23526873-23526895 CCTTACAGGCCAAGAGAGAATGG + Intergenic
1188168758 X:26894372-26894394 TCTTACAGGCCAGGAGAGAATGG + Intergenic
1188839253 X:34994964-34994986 CCCCACATGCCAAGGGAGAAAGG + Intergenic
1188865823 X:35312056-35312078 AGTTACATGCCACTGGAAAAAGG - Intergenic
1189589088 X:42493022-42493044 ACTTACATTCCAATGGAGAGTGG - Intergenic
1193185241 X:78503739-78503761 TGTTACATGCCAAAAGAGAGTGG + Intergenic
1193296142 X:79832912-79832934 CCTTACAGGCCAGGGGAGAAGGG + Intergenic
1193352889 X:80482667-80482689 TTTGACATGCCAAGTGAGAAGGG - Intergenic
1193489312 X:82129632-82129654 TATTACAGGCCTAAGGAGAATGG + Intergenic
1193575759 X:83193791-83193813 GACTACATGCCAATGGAGGAGGG + Intergenic
1193749446 X:85325020-85325042 TCCTACAAGCCAAAAGAGAATGG - Intronic
1193956952 X:87875214-87875236 TGATACATACCAATGGAGAGGGG + Intergenic
1193981848 X:88190527-88190549 TATTCCATGCCAATGGAAACAGG + Intergenic
1193986637 X:88250964-88250986 TCTTACATGCCGAGGGAGAGTGG - Intergenic
1194136747 X:90152998-90153020 TCTTACAGGCCAAAAGAGAGTGG + Intergenic
1194800432 X:98265962-98265984 ACTTACAGGCCAAAAGAGAATGG + Intergenic
1195316353 X:103682974-103682996 TATTTCATACCAATGGGGAAAGG - Intronic
1195933738 X:110105606-110105628 TCTTGCGTGCCAATGGGGCAAGG - Intronic
1197074169 X:122335726-122335748 TGTCACATGCTAAGGGAGAAAGG + Intergenic
1198483746 X:137065707-137065729 TCTTGCTTCTCAATGGAGAATGG + Intergenic
1199159753 X:144595297-144595319 TCTTACAGGCCAGGTGAGAATGG - Intergenic
1199536573 X:148909071-148909093 TTTTAAAGGCCAAAGGAGAAAGG - Intronic
1199748700 X:150794002-150794024 GATTACATGCCAAAGGTGAAGGG + Intronic
1199774420 X:150998324-150998346 TCCTTCATGCCACTGTAGAATGG + Intergenic
1200482493 Y:3722948-3722970 TCTTACAGGCCAAAAGAGAGTGG + Intergenic