ID: 961724708

View in Genome Browser
Species Human (GRCh38)
Location 3:128919832-128919854
Sequence CTGGAGGCCTAGAGGTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961724708_961724713 4 Left 961724708 3:128919832-128919854 CCCTGGTACCTCTAGGCCTCCAG 0: 1
1: 0
2: 3
3: 13
4: 159
Right 961724713 3:128919859-128919881 GAATTCAGAAAATCTGCTTTAGG 0: 1
1: 0
2: 5
3: 33
4: 443
961724708_961724714 11 Left 961724708 3:128919832-128919854 CCCTGGTACCTCTAGGCCTCCAG 0: 1
1: 0
2: 3
3: 13
4: 159
Right 961724714 3:128919866-128919888 GAAAATCTGCTTTAGGAGTAAGG 0: 1
1: 0
2: 2
3: 15
4: 198
961724708_961724715 12 Left 961724708 3:128919832-128919854 CCCTGGTACCTCTAGGCCTCCAG 0: 1
1: 0
2: 3
3: 13
4: 159
Right 961724715 3:128919867-128919889 AAAATCTGCTTTAGGAGTAAGGG 0: 1
1: 0
2: 4
3: 32
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961724708 Original CRISPR CTGGAGGCCTAGAGGTACCA GGG (reversed) Intronic
900797822 1:4719910-4719932 CTGGGGGCCTGGTGGGACCATGG + Intronic
900874434 1:5331363-5331385 CAGGAGGCCTGCAGGCACCACGG - Intergenic
903697572 1:25219486-25219508 CTGAAAGTCTAGAGGGACCAAGG - Intergenic
904289342 1:29474058-29474080 CTGCAGGTCTAGAGGGTCCAGGG + Intergenic
911944328 1:104087030-104087052 ATAGAGGCTTAGAGGTAGCATGG - Intergenic
912234541 1:107835277-107835299 CTGGAGGCCTAGGAGCACTATGG + Intronic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
919938612 1:202271319-202271341 CTAGAGGACTAGAGATCCCAGGG + Intronic
920194364 1:204217060-204217082 CTGGAGGCATAGAAGTGGCAGGG + Intergenic
921188004 1:212686252-212686274 CTGAAGGCCTAGAAGTGGCAAGG + Intergenic
924107442 1:240663136-240663158 CTTGAGGCCTAAAGCTTCCAGGG - Intergenic
924558458 1:245137498-245137520 CTGGAAGGCTAGAGGTGCGAAGG + Intergenic
1064302951 10:14138973-14138995 TTGGAGGTCCAGAGGTCCCAGGG - Intronic
1064348638 10:14556591-14556613 CTTGTGGCCTAGATGGACCAGGG - Intronic
1065390406 10:25176072-25176094 CTGGAGACCGAGTGGTTCCACGG + Exonic
1065926565 10:30439132-30439154 TTAGTGGCCAAGAGGTACCATGG + Exonic
1069852984 10:71422657-71422679 GTGGAGGCCTTGAGATCCCAGGG - Intronic
1071465371 10:85934911-85934933 CTGGAGGCCTTAAAGTACCGAGG - Intronic
1072799185 10:98380984-98381006 CTGGGGGCTTGGAGGAACCAAGG + Intergenic
1075158473 10:120001666-120001688 ATGGAGGCCAAGAAGTCCCATGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1077332759 11:1990584-1990606 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1082073946 11:47961951-47961973 CTGTAGGCCTAGAAGGACCTGGG - Intergenic
1082156686 11:48828404-48828426 CTGGAGGCCTATAGGTGAAAAGG + Intergenic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1202815742 11_KI270721v1_random:45760-45782 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG + Intronic
1096237509 12:49939769-49939791 CTGGAGTCCTAGGGGACCCAGGG + Intergenic
1100584522 12:95967418-95967440 CTGGAGGACTTGAGGTCCAAGGG - Intronic
1102796823 12:115696124-115696146 CTGGAGCCCTAGGGAAACCAGGG + Intergenic
1103952195 12:124557395-124557417 CTGGAAGCCAAGAAGTGCCAGGG - Intronic
1105394926 13:20022008-20022030 CTTGAGGCCTAGAAGTAGCTGGG - Intronic
1107483822 13:40807594-40807616 CTGGATGCCTGAAGGTAACATGG + Intronic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1108180851 13:47838352-47838374 TTGGAGGCGTGGAGGTAGCAGGG + Intergenic
1111215688 13:85138367-85138389 CTGCAGGCCTAGTGGTGCTAAGG - Intergenic
1113518689 13:110922550-110922572 CAGGAGCCCAAGAGGCACCAGGG - Intergenic
1114634742 14:24181156-24181178 GTGGTGGCCCAGAGGTACCCTGG + Intronic
1118512111 14:66486825-66486847 CTGGATTCCTAGAGGTAAAAAGG + Intergenic
1122246112 14:100404630-100404652 CTGGAGGCCTGGCGTTCCCATGG + Intronic
1122557326 14:102588548-102588570 CTGGAGGCCTCAAAGTACCTGGG + Intergenic
1122913305 14:104844191-104844213 CTGGGGGACTAGGGGTACTAGGG - Intergenic
1123476914 15:20597087-20597109 CTGGAGGCCTGGAGGCACTCAGG + Intergenic
1123641097 15:22403277-22403299 CTGGAGGCCTGGAGGCACTCAGG - Intergenic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1130700040 15:86169165-86169187 CTGAAGGCCTGGAGAAACCAAGG + Intronic
1132406058 15:101542500-101542522 CTGGAGGCTTAGAGGAACCTGGG - Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132670579 16:1100762-1100784 CTGGGGGCCTAGAGGTGCAGGGG + Intergenic
1136518152 16:30780220-30780242 CTGGAGGGCTCCAGGTACCAGGG + Exonic
1136778050 16:32882045-32882067 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1136892571 16:33979469-33979491 CTGGGGGACTGGAGGTGCCAGGG + Intergenic
1138299008 16:55910878-55910900 GTGGAAGACTGGAGGTACCAGGG + Intronic
1138331667 16:56220381-56220403 CTGGAAGCCTGGACTTACCAGGG - Intronic
1138350787 16:56345280-56345302 CTGGGGACCTAGATGTGCCATGG + Exonic
1138814130 16:60184535-60184557 CTGGAGTCTTAGAGGGAGCATGG + Intergenic
1140454971 16:75099680-75099702 CTAGGGGCCTGGAGATACCAGGG + Intronic
1140918653 16:79516774-79516796 CTGGAGCTCTAGAGGTTCCATGG + Intergenic
1203080469 16_KI270728v1_random:1144154-1144176 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1143305528 17:5943553-5943575 CTGGTGGCGTTGAGATACCAGGG + Intronic
1143787368 17:9265972-9265994 CTCGAGTCCTAGGGATACCAGGG + Intronic
1146275002 17:31510810-31510832 CAGGAGGCCAGGAGGTACCCTGG + Intronic
1146968253 17:37051264-37051286 TTGGAGGCCTGGGGGTTCCAGGG + Intronic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1148971946 17:51491344-51491366 CTGGAGGCTGAGAGGTCCAAGGG - Intergenic
1150600193 17:66644417-66644439 CTGGAAGCCTAAAGGTACAAGGG + Intronic
1152450585 17:80376793-80376815 CAGGAGGCCTAGAGGAAGAAAGG - Intronic
1154411714 18:14145366-14145388 CTGGAGGCCTAGAGGCCCTCAGG - Intergenic
1156490189 18:37491553-37491575 CTGGAGACCAAGAGGGACTATGG + Intronic
1160057028 18:75492639-75492661 CAGGAGGCTTAGAGATGCCAGGG + Intergenic
1160544566 18:79644147-79644169 CCGGAGGCCTGCAGGTGCCACGG + Intergenic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1160933144 19:1580214-1580236 GAGGGGGCCCAGAGGTACCACGG + Intronic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165156935 19:33794940-33794962 CTGGAAGCCCGGAGGTACCGGGG + Intergenic
1165424629 19:35739087-35739109 CTGGTGGCCCAGAGGCACCTGGG + Exonic
1167527497 19:49994143-49994165 CTGGAGGGATGGACGTACCAAGG - Intronic
1168291291 19:55358949-55358971 CTGGAGGCCTTCAGGGGCCAGGG - Exonic
926151909 2:10429940-10429962 ATGGAGGCTGAGAGGTCCCAAGG + Intergenic
929506369 2:42531211-42531233 CTGGAGGCTGTGAGGTCCCAAGG - Intronic
930249473 2:49019507-49019529 CTGGAGTAGTAGAGGAACCAAGG + Intronic
932741193 2:74292334-74292356 ATGGAGGGCCAGAGGTAGCATGG - Intronic
932910139 2:75797927-75797949 ATGGAGGCCCAGAAGTCCCACGG + Intergenic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
939698116 2:145353984-145354006 CTGGAAGCAGAGAGGTATCAGGG - Intergenic
939723055 2:145679071-145679093 CTGTAGGTCTAGATGTAACATGG - Intergenic
945279473 2:208022578-208022600 CTGGAGGCCTAGAGTTGCTGAGG - Intronic
948135777 2:235635109-235635131 CTGGTGGTCTAGAGGTACTGTGG + Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
948986298 2:241526553-241526575 CTGGAGGCTGAGAGGTCCAAGGG + Intergenic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1168734047 20:115209-115231 CTAGAGGCCTATAGGGGCCAAGG - Intergenic
1169371125 20:5028899-5028921 TAGGACTCCTAGAGGTACCAAGG + Intergenic
1171425233 20:25044720-25044742 CTGTAGGCCTAGTGGCCCCAAGG - Intronic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1173759068 20:45543860-45543882 ATGGAGGTATAGAGGTAGCACGG - Intronic
1174309010 20:49635906-49635928 CTGAAGGCCAAGAGGCTCCAAGG + Exonic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1177731374 21:25031039-25031061 ATAGAGGCCTAGAGATGCCAGGG - Intergenic
1179613088 21:42564945-42564967 GTGGAGGCCTGCAGGTGCCAAGG - Intronic
1182880844 22:33732134-33732156 CTTCAGGCCTAGAGGTGACATGG - Intronic
1184174169 22:42777337-42777359 CTGCAGGCCCAGCGGTGCCAGGG + Intergenic
1184278201 22:43422382-43422404 CTGGAGGCCTACAGCTCACAGGG - Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
952412028 3:33057894-33057916 CTGTAGGCCAAGAGCTTCCAGGG - Intronic
953173044 3:40524924-40524946 CCGGGGGCCTAGAGGGACCCTGG + Exonic
954292944 3:49659290-49659312 CTGCAGGCACAGAGGTCCCATGG + Intronic
954662108 3:52231748-52231770 CTGGAGAGCAAGAGGTACCCAGG + Intronic
955038597 3:55292943-55292965 CTGGTGCCCTAGATGGACCAGGG + Intergenic
957127791 3:76184631-76184653 CTGGAGGCTGAGAAGTCCCATGG + Intronic
957495394 3:80985007-80985029 ATAGAGGCCTAGAGGTACCATGG + Intergenic
961383389 3:126510218-126510240 CTGGAGGCCTTGTGGGAACATGG - Intronic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
964478504 3:157119370-157119392 ATACAGGCCTAGAGGTCCCAGGG - Intergenic
966811256 3:183846998-183847020 CTGAAGTCCTAGAGTGACCAAGG - Intronic
969317690 4:6391767-6391789 CTGGAGGCCTGGAGGTGCCATGG + Intronic
969574579 4:8029623-8029645 CTGGGGGCTCAGAGGAACCAGGG + Intronic
971612932 4:28749173-28749195 CTGGATGCCCAGAGATCCCAAGG - Intergenic
972032071 4:34474324-34474346 CTGAAGGCCTAAAGTGACCAAGG + Intergenic
973034591 4:45390465-45390487 CTGGTGCCCTAGAGGGATCAAGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
986064497 5:4222635-4222657 CTGGAGGCATAGCAGAACCATGG - Intergenic
989352314 5:40500240-40500262 CTCCAGGCTTTGAGGTACCAAGG - Intergenic
995225318 5:109693791-109693813 TTGGAGGACTAGAGGCAACAGGG + Intronic
995335410 5:110992877-110992899 CTGGAGGCCTATTGGGAACATGG + Intergenic
995760615 5:115557628-115557650 GTGGAGGCCTAGTGGTAGCGTGG - Intergenic
997874157 5:137533404-137533426 TTGGAGGCTGAGAGGTCCCAAGG - Intronic
1000641628 5:163709834-163709856 CTGAAGGCTTAGAGTTACCTTGG + Intergenic
1001327684 5:170741216-170741238 ATGGTGGCCTATAGGTCCCAGGG - Intergenic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1004221799 6:13753704-13753726 CTGTAGGCCTGGAGGTACCTGGG + Intergenic
1004705089 6:18117257-18117279 CTGGTGCCCTGGAGGTAACATGG + Intergenic
1004840709 6:19580950-19580972 CTGGAGGCCTAGGAGAACCAAGG + Intergenic
1005222109 6:23598630-23598652 CTGGTGGCCAAGAGGAGCCATGG + Intergenic
1007746183 6:44044155-44044177 CTGGAGGCCTGGAGGGGCCATGG - Intergenic
1007766205 6:44161775-44161797 CTGGGGGCCTGGAAGGACCAGGG - Intronic
1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG + Intronic
1012969215 6:105708718-105708740 TTTGAGGCATAGAAGTACCATGG + Intergenic
1015638370 6:135303643-135303665 TTGGAGGCCCAGAGTTACCAAGG + Intronic
1015807019 6:137119947-137119969 CAGGAGGACTAGAGAGACCACGG - Intergenic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1018857306 6:167683917-167683939 CTGGAGGCCTGGAGCTCCAAGGG + Intergenic
1019070335 6:169340423-169340445 CTGGAGGCCTCGAAGCAGCAGGG - Intergenic
1021202343 7:17741148-17741170 CTGGAGGACCAGAGGGGCCAGGG - Intergenic
1024000402 7:45185547-45185569 CTGGAGGCTTGGAGGTCCCAGGG + Intronic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1030744709 7:113151250-113151272 CTGTAGGTCTAGAGGTACTATGG + Intergenic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1035111363 7:156484918-156484940 ATGGAGGCCTAGAGAGATCAAGG - Intergenic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1039792407 8:40886365-40886387 CTGGAGGCCTGGAGGAGCGAGGG - Intronic
1041084897 8:54247704-54247726 CTCCAGGCCTAGGGGTCCCATGG - Intergenic
1041351587 8:56952579-56952601 CTGGAGGCCCACAGGCACTAGGG + Intergenic
1046226376 8:111285748-111285770 CTGGAGGCCTAGGGGTAAAAAGG - Intergenic
1046576897 8:116040903-116040925 CTTGAGGACTTGAAGTACCAAGG + Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1052448957 9:28601470-28601492 CTGGAGGACTAGAGGTATCAGGG + Intronic
1055177398 9:73336627-73336649 CTTGAGGCCTAGGGATGCCAAGG + Intergenic
1055303463 9:74905400-74905422 CTGGAGGCCCAGTGGTACTGAGG + Intergenic
1055938753 9:81628393-81628415 CCGGAGGCCTATGGGAACCATGG - Intronic
1057174796 9:92988304-92988326 CTGGAGGCCCACAGGTACTGGGG - Intronic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1060412226 9:123407341-123407363 CTGGAGGCCTCGATGTATCTCGG - Intronic
1186975694 X:14901690-14901712 CTGGAGGCCTTAAGGAATCAGGG - Intronic
1187043915 X:15626397-15626419 CTGGTGACCTCTAGGTACCAAGG - Intergenic
1189090739 X:38080079-38080101 CTGGAGGCCTAGAAATGCCCTGG - Intronic
1190105044 X:47553910-47553932 CTGGTGGCCTGCAGGTACCCAGG - Intergenic
1193649056 X:84108648-84108670 CTGGAGGCCTAGGGGATTCAAGG - Intronic
1194114006 X:89873573-89873595 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1196318990 X:114266544-114266566 CTGGAGGCTGAGAGCTACAATGG + Intergenic
1197954777 X:131934229-131934251 CTGGAAACCTAGAAATACCATGG - Intergenic
1200101783 X:153691995-153692017 CTGGGGGACTGGAGGTGCCAGGG + Exonic
1200466746 Y:3528929-3528951 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic