ID: 961727155

View in Genome Browser
Species Human (GRCh38)
Location 3:128938953-128938975
Sequence AAAGCCTTGCTGAAACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961727155_961727157 30 Left 961727155 3:128938953-128938975 CCAGTGAGTTTCAGCAAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 201
Right 961727157 3:128939006-128939028 TCTATTTTCAGATATAGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961727155 Original CRISPR AAAGCCTTGCTGAAACTCAC TGG (reversed) Intronic
900946920 1:5836142-5836164 AAAGCCTTGATCAAACTCTTGGG - Intergenic
900946941 1:5836310-5836332 AAAGCCTTGATCAAACTCTTGGG - Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905307244 1:37028224-37028246 AAAGCCTTGAGGAAACCCAAGGG - Intronic
906750843 1:48258252-48258274 GCAACCTTGCTCAAACTCACAGG - Intergenic
906870759 1:49477580-49477602 AAAGCCTTCCTGAGAATGACAGG + Intronic
907302396 1:53496467-53496489 AGAGCCTTGGATAAACTCACGGG - Intergenic
907814083 1:57901134-57901156 ACAGACTTGCTGCAACTCTCAGG - Intronic
907950247 1:59176353-59176375 ACACCCTTGTTGAAAATCACTGG + Intergenic
908008186 1:59748464-59748486 AAGGCCTTTCTGAATCTCTCAGG - Intronic
909633559 1:77791341-77791363 ACAGCTTTGCTGGAACTCAAGGG - Intronic
910323070 1:85971299-85971321 AAAACCTTGCTGAAGCTGACTGG + Intronic
915009316 1:152670540-152670562 ACAGCCTTGTTGAGACTCATGGG - Intergenic
916716158 1:167448347-167448369 AAAGACTTGCTGATCCTCAGAGG + Intronic
918357585 1:183720195-183720217 AAGGCCTTGCTATAACTCCCTGG - Intronic
923258322 1:232241768-232241790 AAAACATTGGTGAAACTCTCTGG + Intergenic
924062611 1:240191303-240191325 AAAGCCTTTCCTCAACTCACAGG + Intronic
1064897642 10:20257129-20257151 AAAGACTTTCTGACACTCACAGG + Intronic
1065508932 10:26458089-26458111 AAAGTATTACTGAAACTCTCTGG + Intronic
1069161106 10:65093416-65093438 AATGCCTGGAGGAAACTCACAGG + Intergenic
1071488651 10:86120988-86121010 AGATCCTTCCAGAAACTCACAGG - Intronic
1072817017 10:98519412-98519434 AAGGGCTTGCTGAAGCCCACAGG - Intronic
1073061131 10:100734561-100734583 ACAGCCTGGCTCACACTCACGGG - Intergenic
1073331762 10:102674538-102674560 AAAGTCTCGCTAAGACTCACTGG + Exonic
1074662670 10:115679360-115679382 CAACCCTCTCTGAAACTCACTGG + Intronic
1075623456 10:123944927-123944949 AAAACATTGCTGAGACTCAAAGG + Intergenic
1076945595 10:133647018-133647040 CAAGCCTTGCTCTAATTCACTGG + Intergenic
1079002967 11:16773155-16773177 AAAGCCTTGGAGAAGCCCACAGG + Intergenic
1079310301 11:19359757-19359779 GAAGCCTGGCTGACACTCAAAGG - Intronic
1080935082 11:36854565-36854587 AAATCCTTGCTGAAACAAAAGGG - Intergenic
1082813488 11:57493191-57493213 AATGACTTGCTCAAGCTCACAGG + Intronic
1087054476 11:93920232-93920254 AACGCCTAGCTAAAATTCACTGG - Intergenic
1089639057 11:119835111-119835133 ATAGACCTGCTGAAACTAACAGG - Intergenic
1091423082 12:360246-360268 AGAGTCTTGCTGTAACTCCCAGG - Intronic
1091991972 12:4962726-4962748 AAAGCCCTGGTGTGACTCACAGG - Intergenic
1093871192 12:24293345-24293367 AAAGCCTTGGTGAAAACCACAGG - Intergenic
1094675491 12:32615995-32616017 AAGGCCTTGTTGACACTGACAGG - Intronic
1096411911 12:51383128-51383150 GAAGCCTTCCTCAAACCCACAGG - Intronic
1101881201 12:108627272-108627294 CATGCCTTCCTGAACCTCACTGG - Intronic
1102235988 12:111295107-111295129 AAATCCTGGCAGAAACTAACAGG + Intronic
1104104526 12:125646452-125646474 AAACCCTTGCTGAAACTTGAAGG + Intronic
1105794805 13:23840753-23840775 AAAGCCTTAGTGACACACACAGG + Intronic
1107062917 13:36179989-36180011 AAATGCTTGCTGAAATTCATTGG + Intronic
1107094209 13:36517150-36517172 AAAGCCTTCCTGAAATTCCAAGG + Intergenic
1107206222 13:37792143-37792165 AAACCCTTGATGAAACTCACTGG - Intronic
1107930601 13:45304236-45304258 GTAGCACTGCTGAAACTCACAGG + Intergenic
1108915036 13:55597996-55598018 AAAGCCTCATTGAAACACACTGG + Intergenic
1111211437 13:85084913-85084935 AAACTCTTGTTGAAACTCAGGGG - Intergenic
1116965842 14:51014315-51014337 AAACCCCTGCTGAAACTCCCCGG - Intronic
1117472871 14:56064109-56064131 AAAGCTTTGCTCAAAGTCCCAGG - Intergenic
1120887835 14:89465627-89465649 AGAGACTCCCTGAAACTCACAGG + Intronic
1121122948 14:91387674-91387696 AAAGCCTTGTGGAAACTCCCTGG - Intronic
1121383678 14:93497411-93497433 AAATCCTTTCTGAAACTAAGTGG + Intronic
1121788690 14:96682423-96682445 AAAACCTGGCTGAGGCTCACAGG - Intergenic
1122158151 14:99763516-99763538 AAAGACAGGCTGAAGCTCACAGG + Intronic
1125602499 15:40923326-40923348 GAAGCCTTGCTGGGAGTCACTGG - Intergenic
1125952649 15:43766533-43766555 AATGCCTTACTGAACTTCACTGG - Intronic
1127871616 15:63078719-63078741 AAAGCCTTCCATAAACACACAGG - Intergenic
1127920573 15:63491228-63491250 AAAGGATTGATGAAACTCTCAGG - Intergenic
1128171568 15:65517864-65517886 AGCGACTTGCTGAAAGTCACAGG + Intergenic
1130649709 15:85755563-85755585 AAAGCGTTGAGGAAGCTCACAGG + Intergenic
1131152978 15:90058426-90058448 AAAGCCTTGGTAGAACTCTCAGG + Intronic
1131327178 15:91459268-91459290 TAAGCATTTCTGAAACTCATTGG - Intergenic
1131520387 15:93109885-93109907 ACAGCCTCGCAGCAACTCACAGG - Intergenic
1133079539 16:3307541-3307563 AAAGTCTTGCTCTAACTCCCAGG + Intronic
1135794798 16:25431560-25431582 AGAGCCATTCTGAAACTCAAAGG + Intergenic
1135816469 16:25638882-25638904 AAAGTCCTACTGAATCTCACTGG - Intergenic
1135962676 16:27010791-27010813 TGCCCCTTGCTGAAACTCACTGG - Intergenic
1135963009 16:27013338-27013360 GATTCCCTGCTGAAACTCACTGG - Intergenic
1139286860 16:65823037-65823059 AAGGCCATGCAGAAAGTCACAGG + Intergenic
1149265833 17:54926562-54926584 AAAGCCTTACTCTAACTTACTGG + Intronic
1149297374 17:55273034-55273056 ACAGGCTTGCTGACATTCACAGG + Intronic
1151250278 17:72828860-72828882 ACAGATTTGATGAAACTCACAGG + Intronic
1151433541 17:74080655-74080677 CAAGGCTTGGCGAAACTCACTGG + Intergenic
1152650267 17:81489332-81489354 AAAGCATTCCTGGAACCCACAGG + Intergenic
1153541483 18:6160381-6160403 AAAACCTTGTTTAATCTCACAGG + Intronic
1156052110 18:32950180-32950202 AAAGCCTTGCAGATTCTCTCTGG - Intronic
1156454576 18:37285711-37285733 AAGGCCTGACTCAAACTCACAGG - Intronic
1158098058 18:53797580-53797602 AATGCCTTGAAGAATCTCACTGG - Intergenic
1158233243 18:55282943-55282965 AAAGACTTGGTGAAACTCATAGG + Intronic
1158441741 18:57480810-57480832 AAATCCTTGAGTAAACTCACTGG - Exonic
1159431849 18:68362612-68362634 AAAGCCTGGCTAAAAGTCCCAGG + Intergenic
1162077029 19:8194736-8194758 ATAGCCTTGCTCAGACACACAGG + Intronic
1163789671 19:19299099-19299121 AAATCTTTGCTGAAACTGGCAGG - Intronic
1164742990 19:30590434-30590456 AAAGCCTTGCTGAAAGGCATTGG - Intronic
1164787158 19:30942687-30942709 GAAGCCTTGCTGTAGCTGACTGG - Intergenic
1166158591 19:40934694-40934716 ATAACGTGGCTGAAACTCACAGG - Intergenic
1166167567 19:41002924-41002946 ACAACGTGGCTGAAACTCACAGG - Intronic
925857916 2:8148510-8148532 AATACCATGCTGAAATTCACAGG - Intergenic
926038973 2:9657497-9657519 AAAGCTTTGCAGAAACTAATGGG + Intergenic
926956886 2:18311419-18311441 AGAACCTTGCTGAAAAACACGGG - Intronic
928993242 2:37257842-37257864 AAAGTGTTGCTGTTACTCACTGG - Intronic
931575998 2:63719415-63719437 AAAACCTAGCTGAAAATCAGAGG + Intronic
931959211 2:67463280-67463302 AAAGCCATGATGTAACACACAGG + Intergenic
934760057 2:96850022-96850044 AATGCCTTGCCCAAAGTCACAGG + Intronic
935356040 2:102200796-102200818 AAAGCATTCCTGAGACTCACTGG + Intronic
935839716 2:107095990-107096012 AAAGCCTTGCTTATTCTCTCTGG - Intergenic
937636444 2:124160935-124160957 AAAGCCTTTGTGAAACTGGCAGG - Intronic
939599283 2:144168054-144168076 AAATCCTTACGGAAACTAACTGG + Intronic
939647308 2:144716571-144716593 ATGGGCTGGCTGAAACTCACAGG + Intergenic
941484686 2:166065494-166065516 AAAGCTTGGCTTGAACTCACAGG - Intronic
943905007 2:193488213-193488235 AAAACCTTTCTGGAATTCACTGG + Intergenic
946559777 2:220899422-220899444 AAAGCGTAGCTCAAACACACAGG - Intergenic
1169431518 20:5540362-5540384 ACAACCTTGCTGAAAGTCAGTGG + Intergenic
1171187695 20:23134737-23134759 ACATCCTTGCTGAAAATCAAGGG - Intergenic
1172039006 20:32030892-32030914 AAATCCCTGCTGTCACTCACTGG - Intronic
1176346809 21:5756005-5756027 GAAGTCTTGCTGAAGCTCCCAGG - Intergenic
1176353623 21:5876589-5876611 GAAGTCTTGCTGAAGCTCCCAGG - Intergenic
1176498018 21:7568450-7568472 GAAGTCTTGCTGAAGCTCCCAGG + Intergenic
1176541130 21:8154075-8154097 GAAGTCTTGCTGAAGCTCCCAGG - Intergenic
1176560081 21:8337120-8337142 GAAGTCTTGCTGAAGCTCCCAGG - Intergenic
1176667031 21:9697168-9697190 TAAGGATTGCTGAAAATCACAGG - Intergenic
1178409177 21:32349670-32349692 TAAGCCTTGGTGAAACACAAAGG + Intronic
1179152450 21:38820741-38820763 AAAGCTTTGCTGTAAAGCACGGG - Intronic
1182636609 22:31732726-31732748 TCAGAGTTGCTGAAACTCACAGG - Intronic
1182860489 22:33555483-33555505 AAAGCCTTGCTGAGAAGCTCAGG + Intronic
1203246072 22_KI270733v1_random:70494-70516 GAAGTCTTGCTGAAGCTCCCAGG - Intergenic
949881343 3:8663450-8663472 AAAGCCCTGATGAAACTATCAGG - Intronic
959271061 3:104210786-104210808 TAGTTCTTGCTGAAACTCACTGG + Intergenic
961191811 3:124968478-124968500 GAAGCATTGTTGGAACTCACAGG + Exonic
961727155 3:128938953-128938975 AAAGCCTTGCTGAAACTCACTGG - Intronic
964883487 3:161451412-161451434 AAAGCCCTGTTGACTCTCACTGG - Intergenic
965760386 3:172069163-172069185 GAAGCCCTGGCGAAACTCACCGG - Intronic
966681317 3:182644651-182644673 AAAGCCTTCCTGGAACAGACAGG - Intergenic
967391949 3:188965009-188965031 AAAGCCTTAGCTAAACTCACAGG - Intronic
969039086 4:4280419-4280441 AAATCCATCCTAAAACTCACAGG + Intronic
970598512 4:17621788-17621810 AAAGCCTGAATGAAACTCGCAGG - Intronic
971151321 4:24035129-24035151 AAACACTTGTTGAAACTAACAGG + Intergenic
971228863 4:24781163-24781185 AAAACCTTGCTGGAACACTCAGG - Intergenic
973193932 4:47418138-47418160 AAAGCCATGCCAAAAATCACAGG - Intronic
973928921 4:55769315-55769337 AAAGCCTGGCTGAGAATGACTGG - Intergenic
974656105 4:64824786-64824808 AATGCCGTGATGAAACTCAAAGG - Intergenic
976612904 4:87047944-87047966 AAAACCTTCCTGAAACTTTCTGG - Intronic
977736490 4:100423001-100423023 AAGGCATTGCTGTTACTCACTGG + Exonic
977864176 4:102003247-102003269 AAAGCCATCCTAAAACTCAGTGG + Intronic
981227757 4:142317062-142317084 AAGCCTTTCCTGAAACTCACAGG - Intronic
981774931 4:148355521-148355543 AAAGCCTTCCTGAATTTCCCAGG + Intronic
983560245 4:169093884-169093906 CAAGCCATGCTGAGACTTACGGG + Intergenic
984470932 4:180172428-180172450 AAAGAGTTAATGAAACTCACTGG + Intergenic
984955090 4:185037102-185037124 AAAGCCTTGCTGACACCTGCTGG - Intergenic
985407982 4:189655169-189655191 TAAGGATTGCTGAAAATCACAGG + Intergenic
985448983 4:190047530-190047552 CAAGCCTTGCTCTAATTCACTGG + Intergenic
986167936 5:5291982-5292004 AATGCCTCTGTGAAACTCACAGG - Intronic
986650315 5:9957142-9957164 GAAGCCTAGCTGAGACTGACAGG + Intergenic
986654519 5:9998223-9998245 ACAGGATTGCTGAAATTCACTGG + Intergenic
988839364 5:35068104-35068126 AAAGGCTGGCTGAAACTACCAGG + Intronic
993441258 5:87959633-87959655 AAAGACTTGCAGTTACTCACTGG - Intergenic
996977131 5:129448435-129448457 AAGCGCGTGCTGAAACTCACGGG - Intergenic
997090499 5:130850853-130850875 TAAGCCTTGCTAAAACTATCTGG - Intergenic
997677570 5:135724640-135724662 AAAGCCTTGCCTAAGGTCACAGG + Intergenic
1001684297 5:173581895-173581917 AAAGCTTTGCTGATTCTCCCAGG + Intergenic
1001822922 5:174724086-174724108 AAGTCGGTGCTGAAACTCACAGG - Intergenic
1002214805 5:177623331-177623353 AAAGACTTGCTGAAAGTAAAAGG - Intergenic
1002692138 5:181057792-181057814 AAAGCCTTGCTGTAAATATCTGG + Intronic
1003972911 6:11316211-11316233 AAAGCCTTCAGGAAACTCAAAGG - Intronic
1005073795 6:21887777-21887799 AAAGCCTTTTTTAAACTCAGTGG - Intergenic
1005148316 6:22718445-22718467 AAATCTTTGCTGAAACTAAATGG - Intergenic
1005711765 6:28510025-28510047 AAAGCCTAGCTGTGACTCCCAGG - Intronic
1007088685 6:39168436-39168458 CAAGCCTCACTGGAACTCACGGG + Intergenic
1007908356 6:45487438-45487460 TAAGCATTGTTGAAAGTCACTGG - Intronic
1008717203 6:54303320-54303342 AACCCCTTGTTGAAACCCACTGG + Intergenic
1012704711 6:102507685-102507707 AAAGATTTACTGAAACTCAGAGG - Intergenic
1014729698 6:125018681-125018703 AAAGACTTTCTGAGATTCACTGG - Intronic
1015703846 6:136066015-136066037 AAAGCCTTTATGGAAATCACTGG - Intronic
1017966449 6:159271054-159271076 AAAGCCCAGCTGTAACTCAGGGG - Intronic
1018830858 6:167442414-167442436 CAAGCCTTGCTGAATCTCCCAGG - Intergenic
1022454238 7:30544609-30544631 AGAGACTTGCAGGAACTCACAGG + Intronic
1024198305 7:47081630-47081652 AATGACTTGCTCAAAATCACAGG + Intergenic
1025604273 7:63028096-63028118 AAAGCCTTGCTGCATCTCGAGGG + Intergenic
1028967294 7:96816553-96816575 AAAGCCTTTCTGAAACTGCAAGG - Intergenic
1030245838 7:107383886-107383908 AAAGAATTTCTCAAACTCACTGG + Intronic
1030881134 7:114881894-114881916 AAAGCCTTCCTGAAAAGGACAGG - Intergenic
1031426598 7:121613087-121613109 AAATCTTGGCTGAAACTCAGTGG - Intergenic
1031588301 7:123559135-123559157 ATAGCCTTGCTGAAATAAACAGG + Intergenic
1031996022 7:128231673-128231695 AAATCCTCCCTGAAACTCAGGGG + Intergenic
1034067888 7:148154185-148154207 AAAGCCTGACTGAGACTCAGTGG + Intronic
1035348446 7:158225415-158225437 ACAGCCTCGCTGAATCTCCCCGG + Intronic
1036780706 8:11645070-11645092 AAAGCCTTGCTGCACCTCGAGGG - Intergenic
1041864102 8:62549149-62549171 TAAAATTTGCTGAAACTCACAGG + Intronic
1042639363 8:70916311-70916333 AAAGGTTTGCTGAAAATCAACGG - Intergenic
1042967303 8:74368635-74368657 CAAGCAGTGCTGAAAATCACTGG + Intronic
1044074416 8:87801321-87801343 AAATGTTTGCTGAAATTCACTGG - Intergenic
1044249165 8:89986059-89986081 AAAGCCATGCTGAAAATAAGTGG - Intronic
1046884860 8:119354964-119354986 AAATCCTTGTTGAAAGGCACTGG - Intergenic
1046926864 8:119800725-119800747 TTTGCCTTGCTGAAATTCACAGG - Intronic
1047066113 8:121284948-121284970 AACAACTTGATGAAACTCACTGG + Intergenic
1047910262 8:129519623-129519645 AAAGCCTTCCTAAAAATGACAGG + Intergenic
1048690510 8:136956971-136956993 AAAACTTTGCTGAAAATCAATGG - Intergenic
1048887879 8:138923164-138923186 AGAGCCTTGGTGAAAGTGACTGG - Intergenic
1050456233 9:5837114-5837136 AAAGCCTTTCTGAAACAAATGGG + Intergenic
1050932719 9:11349905-11349927 AAAGCCTAGCTGCAAGTCCCAGG - Intergenic
1051774943 9:20622675-20622697 AAAGCCTCGCTTAAAGTAACAGG + Intergenic
1051897680 9:22005849-22005871 CAAGCCTGTCTGAGACTCACAGG - Exonic
1056023794 9:82469568-82469590 AAAGCCTTGGCCAAACCCACGGG - Intergenic
1056089006 9:83186092-83186114 AAAGATCTGCTGAAACTAACGGG + Intergenic
1058248695 9:102664140-102664162 AAAGCATTGGAGAAACTCTCTGG - Intergenic
1062367386 9:136217424-136217446 AAACCCGAGCTGAAGCTCACAGG + Intronic
1203462405 Un_GL000220v1:53566-53588 GAAGTCTTGCTGAAGCTCCCAGG - Intergenic
1203659065 Un_KI270753v1:24594-24616 TAAGGATTGCTGAAAATCACAGG + Intergenic
1186287855 X:8065062-8065084 AAAATCTTGCTCAAATTCACTGG - Intergenic
1188814930 X:34701201-34701223 AAAACATTGGGGAAACTCACTGG + Intergenic
1190535333 X:51421060-51421082 CAAGCCTTTCTGTACCTCACTGG - Intergenic
1190560484 X:51681518-51681540 AACGTCTACCTGAAACTCACAGG + Intergenic
1190563807 X:51711803-51711825 AACGTCTACCTGAAACTCACAGG - Intergenic
1192592036 X:72368339-72368361 AAAGCCTTGTGGAAACACACGGG - Intronic
1194950290 X:100117917-100117939 AAATCCTAGCTGAAACATACTGG - Intergenic
1196130699 X:112152346-112152368 AAAGCATTTCGGAAACTCAATGG + Intergenic
1197562657 X:128043303-128043325 AAAACATTGCTGAAAAACACTGG - Intergenic
1199950362 X:152701274-152701296 GAAGCTTTGCTGAAGATCACAGG - Exonic
1199959317 X:152767187-152767209 GAAGCTTTGCTGAAGATCACAGG + Exonic
1200250720 X:154552445-154552467 ACAGCCTTGCTGGATCTTACAGG + Intronic
1200304361 X:155008914-155008936 ACAGCCTTGCTGGATCTTACAGG - Intronic
1200916886 Y:8579098-8579120 AAAGGCTGGCTGAGACCCACTGG + Intergenic