ID: 961727508

View in Genome Browser
Species Human (GRCh38)
Location 3:128942395-128942417
Sequence TCCAGGGGGCTCCACTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961727498_961727508 0 Left 961727498 3:128942372-128942394 CCCCAGCCCTGGCGGCCACAGTT 0: 1
1: 0
2: 5
3: 30
4: 323
Right 961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 177
961727495_961727508 12 Left 961727495 3:128942360-128942382 CCAGGCAGCTCGCCCCAGCCCTG 0: 1
1: 2
2: 7
3: 55
4: 448
Right 961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 177
961727499_961727508 -1 Left 961727499 3:128942373-128942395 CCCAGCCCTGGCGGCCACAGTTT 0: 1
1: 0
2: 2
3: 25
4: 208
Right 961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 177
961727500_961727508 -2 Left 961727500 3:128942374-128942396 CCAGCCCTGGCGGCCACAGTTTC 0: 1
1: 0
2: 2
3: 20
4: 236
Right 961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 177
961727501_961727508 -6 Left 961727501 3:128942378-128942400 CCCTGGCGGCCACAGTTTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 185
Right 961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 177
961727503_961727508 -7 Left 961727503 3:128942379-128942401 CCTGGCGGCCACAGTTTCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 188
Right 961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961727508 Original CRISPR TCCAGGGGGCTCCACTGCAC AGG Intronic
905275508 1:36815335-36815357 GCCAGGGGGCTGCAGTGCCCAGG + Intronic
906998597 1:50826508-50826530 CCCAGGTGGCTCCAGTGCAGTGG - Intronic
910482798 1:87676663-87676685 TGCAGGTGGCACCACTGCCCGGG + Intergenic
910507669 1:87968613-87968635 TACAGCTGGCTCCACTGGACTGG + Intergenic
911574376 1:99557489-99557511 TCCAGGGGGCTCTACCTCACAGG - Intergenic
912453971 1:109785643-109785665 TGCAGGAGGCTCCACTGCCAAGG + Intergenic
920206983 1:204299402-204299424 TCCCAGGGGCTCTTCTGCACTGG - Intronic
920379782 1:205528843-205528865 TCTAGGAGCCTCCACTGCCCTGG + Intronic
920657765 1:207889102-207889124 TCCAGGGAGCCCCCCTGCCCCGG + Intronic
922685980 1:227639135-227639157 TCCAGTGGGGTCCTCTGCAGAGG + Intronic
1066963488 10:42241891-42241913 TCCAGGGGACTCCAGTCCCCAGG + Intergenic
1067573542 10:47389028-47389050 TACAGGGGACCCCACAGCACAGG - Intergenic
1067777190 10:49172231-49172253 TCCAGGGGGCCCCAGTGCCTAGG + Intronic
1069718012 10:70533014-70533036 TCCAGGGGACTCCCTTGCTCGGG - Exonic
1073327477 10:102651046-102651068 TCCGGGGGGCTGCACTGGTCTGG - Intronic
1074491263 10:113941653-113941675 TCCTGGGGGCTTCACTTGACAGG + Intergenic
1075999893 10:126905860-126905882 CCCGGGGGGCTCCACGGCAGAGG - Intronic
1076065269 10:127443389-127443411 TCCTGGGGGCTGCTCTCCACAGG - Intronic
1076888241 10:133272257-133272279 TCCAGGGGTGTCGACTTCACCGG - Exonic
1078749097 11:14143141-14143163 TGCAGGGGGCACCATTGCCCAGG - Intronic
1083879020 11:65539269-65539291 TCCAGGCGGCTCCTCACCACCGG + Intronic
1084422657 11:69068110-69068132 TCATGGGGCCTCCACTGCTCAGG + Intronic
1086786206 11:90972341-90972363 TCCAGCGAGCCCCACTGCTCGGG - Intergenic
1087562038 11:99802748-99802770 TGCAGAGGGGTCCCCTGCACCGG + Intronic
1088685298 11:112280082-112280104 ACCAGGGGGCGCCGCTGCTCTGG - Intergenic
1089541024 11:119189010-119189032 TCCAGGAGGCTCAGCTGCCCGGG + Exonic
1089619502 11:119714229-119714251 TCCAGGGGCCACCACCCCACAGG - Intronic
1089688143 11:120169825-120169847 TCCACGGGGGTCCCCTGCCCAGG + Exonic
1091361633 11:134982581-134982603 CTCTGGGGGCTCCACAGCACTGG + Intergenic
1091619159 12:2073139-2073161 TCCATGGAGCTCCAGTGCACAGG + Intronic
1094682523 12:32679102-32679124 TCCAGGAGGCTGCGCGGCACCGG - Intergenic
1101726121 12:107389729-107389751 GCCGGGGGGCTCTACTGGACTGG + Intronic
1102101552 12:110281913-110281935 TGCAGGGCGCTCCGCTGCAGGGG + Intronic
1106519143 13:30481879-30481901 GCCAAGAGGCACCACTGCACTGG - Intronic
1108452550 13:50581822-50581844 TCCAGGTGACTCCAATGCACAGG + Intronic
1112565958 13:100551655-100551677 TCCAGGGGGCACCTGTGCCCAGG + Intronic
1113579437 13:111418643-111418665 TCCTGGGGGCTCATCTTCACGGG + Intergenic
1114050099 14:18914933-18914955 TCCTGGGGGCACCACTGGAGGGG - Intergenic
1114112459 14:19486998-19487020 TCCTGGGGGCACCACTGGAGGGG + Intergenic
1114237285 14:20834221-20834243 TCCAGTGGGGTCCTCTGCAGAGG + Intergenic
1115513751 14:34164566-34164588 ACCAGGGGGCTCTACTCCAGAGG + Intronic
1122180429 14:99950485-99950507 CCCATGGGGTTCCTCTGCACGGG + Intergenic
1122226978 14:100285822-100285844 TCCAGGGGGCGCTGCTCCACCGG - Intergenic
1122245661 14:100401533-100401555 TCCAGGAGGCTCCCCTGCCTGGG + Intronic
1124121791 15:26894321-26894343 TCCAGGGGCCACCCCTTCACAGG + Intronic
1124378223 15:29141909-29141931 TCCAGGGTGCCTTACTGCACAGG + Intronic
1125249869 15:37688585-37688607 TCCAGGGACATCCACTGCAGAGG + Intergenic
1128729184 15:70009254-70009276 CCAAGAGGGCTCTACTGCACAGG - Intergenic
1129672140 15:77613334-77613356 GCCAGGCGGCACCACTGCAAGGG - Exonic
1130158188 15:81371526-81371548 GCCAGGAAGCTCCACAGCACAGG + Intronic
1130534073 15:84770664-84770686 CCCAGGTGATTCCACTGCACCGG - Intronic
1130988479 15:88860338-88860360 TCCACAGGGCTCCTCTGCACAGG - Exonic
1131067324 15:89442668-89442690 TCCAGGGTGCTCTCCTGCAAAGG - Intergenic
1133906961 16:10031279-10031301 TCCAGGGGGCAGCACAGCAATGG - Intronic
1134440833 16:14298773-14298795 TCCAGGGGGCACCTCTGAAGGGG + Intergenic
1135622686 16:23969203-23969225 CCCAGTGGGCCCCACTGCAGGGG - Intronic
1136037268 16:27549805-27549827 TCCAGCCGGCTCCACAGCGCTGG + Exonic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136559622 16:31031439-31031461 TCCAGGGGACACCACTGGGCAGG + Intergenic
1136595833 16:31249265-31249287 TCCAAGGGGCTCCTCAGCAGAGG - Intergenic
1137071481 16:35908271-35908293 TCCAGTGGGGTCCTCTGCAGAGG + Intergenic
1138497341 16:57416442-57416464 GCCAGGGGGCTCCCCAGCACTGG - Intergenic
1141509847 16:84505074-84505096 CCCAGGAGGCTGCACTGCAGAGG - Intronic
1141759665 16:86019646-86019668 TCCTGGGGGCCCCACTTCAGTGG - Intergenic
1142467516 17:144745-144767 TCCAGGGCCCTCTACTGCCCAGG - Intergenic
1143274042 17:5696691-5696713 ACAAGGGGGCTCCAGGGCACTGG - Intergenic
1143584764 17:7845575-7845597 TCCAGGGGCCCGCGCTGCACGGG + Exonic
1147654091 17:42078704-42078726 ACGTGGAGGCTCCACTGCACTGG + Intergenic
1147718470 17:42523174-42523196 TCCAGGGGCCTCCAGGGCAGGGG + Intergenic
1147741721 17:42674054-42674076 TCTAGGGGGCTCCTCTGTAGGGG + Intronic
1148167899 17:45496401-45496423 TACAGGGGGCACCACCACACCGG - Intergenic
1148859517 17:50596721-50596743 TCCCAGGGACACCACTGCACGGG - Exonic
1152503118 17:80726269-80726291 TCCAGGAGGCAGCACGGCACAGG - Intronic
1152811302 17:82384052-82384074 TCCAGGCTGCTCCACTGCCCAGG - Intergenic
1152828166 17:82480442-82480464 TCCAGGAGGCTCCACTGGCTGGG + Intronic
1154493673 18:14940348-14940370 CTCTGGGGGCTCCACAGCACTGG - Intergenic
1155602750 18:27568547-27568569 TCCAGGGGGATCTACTTCTCAGG - Intergenic
1156455370 18:37290225-37290247 TTCAGGGGGCTCCACTGCCCTGG - Intronic
1156820082 18:41361721-41361743 TCCAGGGCACTCCACTGAATTGG + Intergenic
1157182557 18:45510489-45510511 TCCTGTGGGCACCACTCCACTGG - Intronic
1157785961 18:50482908-50482930 TCCATGGAACTCCACTGCAAGGG + Intergenic
1159840602 18:73394336-73394358 CCCAGGAGGCTCTATTGCACAGG + Intergenic
1160454162 18:78986195-78986217 TCCCGGGTGCTTCACTGCACAGG + Intronic
1160521495 18:79510804-79510826 TCCACGGGGCTCCTCTGCCGGGG + Intronic
1160565885 18:79786357-79786379 CCCATGGGGTTCCACAGCACGGG + Intergenic
1161217316 19:3100947-3100969 TCCAGGGAGCACCACCGCCCAGG - Intronic
1164472285 19:28546357-28546379 TCCGGAGAGCTCCTCTGCACAGG + Intergenic
1164927094 19:32139254-32139276 TGCCAGGGGCTCCACTGCTCAGG + Intergenic
1168400136 19:56080867-56080889 TCCAGGCGGCGCCACAGCAGGGG - Intergenic
925602837 2:5626625-5626647 TCCAAGAGGCTGCCCTGCACAGG - Intergenic
926436991 2:12848446-12848468 TCCAGTGGCCTCCTCTGGACTGG + Intergenic
928593408 2:32839277-32839299 TCCAGGGGCCTCCAATTCAGGGG + Intergenic
931089668 2:58871931-58871953 ACCAGGGGGCTGCACTTCAGGGG - Intergenic
931869750 2:66445355-66445377 GCCGGTGGGCTCCACTGCCCTGG + Intronic
932294478 2:70612943-70612965 TACAGAGTTCTCCACTGCACTGG - Intronic
933191203 2:79336207-79336229 ACCAGGGGGCAAGACTGCACTGG + Intronic
937033842 2:118764169-118764191 TCCAGGGAGCAGCACTTCACCGG + Intergenic
938095311 2:128457520-128457542 TCCAGGGACATCCCCTGCACTGG - Intergenic
944465405 2:199995429-199995451 ACCATGTGGCTGCACTGCACTGG + Intronic
945981867 2:216318710-216318732 TGCCAGGGGCTCCACTGCCCAGG + Intronic
947028616 2:225767399-225767421 TCCAGCAGTCTCCACTGCAGGGG - Intergenic
948524080 2:238559737-238559759 TAGAGGGGGCTCCACAGCAGTGG + Intergenic
948792716 2:240387561-240387583 TCTGGGCTGCTCCACTGCACTGG + Intergenic
1168836747 20:882575-882597 GGCAGGGGTCTCCACTGCCCAGG - Intronic
1171481899 20:25460730-25460752 TCTAGGGGGAGCCTCTGCACAGG + Intronic
1172208709 20:33182480-33182502 TCCAGCAGGCTCCACTTCCCTGG + Intergenic
1173212502 20:41046577-41046599 TCCAGGGGGCTTTGCTGCAAAGG - Intronic
1174369655 20:50078001-50078023 GCCATGGGGCCCCACTGCCCTGG - Intergenic
1174734883 20:52956485-52956507 TCCAGATGCCTCCACTGCCCAGG - Intergenic
1177559200 21:22728914-22728936 TCCCTGGGGCTCAACTGCCCAGG - Intergenic
1178566410 21:33690322-33690344 TACAGGGTGAGCCACTGCACCGG - Intronic
1179667548 21:42923115-42923137 TCCAGTGGGGTCCTCTGCAGAGG + Intergenic
1179893659 21:44350148-44350170 TGCGGGCGGCTCCACTGCACCGG + Intronic
1180017013 21:45093665-45093687 TCCAGGGGGCTCCTCACCAGGGG + Intronic
1180468579 22:15637308-15637330 TCCTGGGGGCACCACTGGAGGGG - Intergenic
1181541090 22:23573729-23573751 TCCAGAGGGCTCCAGTGGAAAGG - Intronic
1181797292 22:25319601-25319623 TCCAGAGGGCTCCAGTGGAAAGG + Intergenic
1182951183 22:34377387-34377409 TCGAAGGGGCTCCACTGCAGAGG - Intergenic
1184106013 22:42368028-42368050 TCCAGGTGGCCCCGCAGCACTGG - Intergenic
1184232252 22:43164571-43164593 CCCAGCTGGCTCCTCTGCACCGG - Intergenic
1184504886 22:44894690-44894712 TACAGGGGGCTTCCCTGCCCAGG + Intronic
1185228834 22:49668556-49668578 GGCAGGGGACTCCACTCCACAGG + Intergenic
950027794 3:9832803-9832825 TGCGTGTGGCTCCACTGCACAGG - Intronic
951907793 3:27721572-27721594 GCCAGGGGGCTCCGCTCTACGGG - Exonic
956176581 3:66478712-66478734 TCCAAGGGTCTCCACTGTACGGG + Intronic
956629934 3:71306199-71306221 TCCAGGGGACACCACTAAACAGG + Intronic
961081505 3:124032875-124032897 TCCAGGGGGCTCTGCGGCCCGGG - Intergenic
961384691 3:126516808-126516830 TCCAGTGGGCTCCGGTGCAAAGG + Intronic
961621288 3:128226985-128227007 ACCAGGGGGCCCCCCTGCCCCGG + Intronic
961650346 3:128413893-128413915 TTCAGGTGGCTCCACAGGACTGG - Intergenic
961727508 3:128942395-128942417 TCCAGGGGGCTCCACTGCACAGG + Intronic
961809512 3:129513867-129513889 TCAAGGGGGCCCCAGAGCACAGG + Intronic
963925222 3:150944201-150944223 TTCACCAGGCTCCACTGCACTGG - Intronic
966523221 3:180895107-180895129 GCCAGGGGGCTCTACTCCATTGG + Intronic
966734861 3:183180284-183180306 TCCAAGGGCCTGCACTGCGCTGG + Intronic
968003725 3:195225258-195225280 CTCAGGGGGCTCCACTGGGCAGG - Intronic
968293429 3:197555794-197555816 GGCAGGGGGCTCCGCTGCAGAGG + Exonic
969394014 4:6909377-6909399 TCGATGGGGCTCCCCTGCCCCGG - Intronic
969485804 4:7471865-7471887 TGCTGGAGTCTCCACTGCACTGG + Intronic
969904912 4:10384927-10384949 TCCAAGGGGCTCCTCAGAACAGG - Intergenic
970461648 4:16280187-16280209 TCCAGGTTTCTCCACTGCAAAGG - Intergenic
972012724 4:34205091-34205113 TACAGAGGGCGCCACTTCACAGG - Intergenic
980930333 4:139177625-139177647 TGCAGGGGGCTCTGCCGCACGGG + Intergenic
982042479 4:151409418-151409440 TCCAGCGAGCCCCACTGCTCGGG + Exonic
982585030 4:157225111-157225133 TCCAGGGAGATCCACTGAATGGG + Intronic
983666428 4:170189381-170189403 CCCAGTGGACTCCTCTGCACAGG - Intergenic
985666634 5:1184544-1184566 TACAGGGGCCTCCACTGCAGGGG - Intergenic
987640122 5:20601750-20601772 TCCAGGGAATTCCACTCCACTGG + Intergenic
988306722 5:29502247-29502269 TCCAGGGGGCTGCAGTACAGTGG - Intergenic
989585808 5:43073163-43073185 TCCAGTGGGGTCCTCTGCAGAGG + Intronic
989679507 5:44012593-44012615 GCCAGGGTGCTCCTCTCCACAGG + Intergenic
990185036 5:53202810-53202832 TCCAGTGGGGTCCTCTGCAGAGG - Intergenic
991696786 5:69280410-69280432 TCCTGGGTGGTCCTCTGCACAGG - Exonic
996586026 5:125088954-125088976 TCGGGGAGGCTCCACTGCACAGG - Intergenic
999257559 5:150218014-150218036 TCCAGGGGCCTCCCCTGCCCTGG - Intronic
1001575884 5:172763615-172763637 TGCAGTGTGCTCCACTGCAGAGG + Intergenic
1002440590 5:179262420-179262442 TCCAAAGGCCTCCACCGCACAGG + Intronic
1002642821 5:180638571-180638593 TGCAGGGGAATCCAGTGCACCGG - Intronic
1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG + Exonic
1006649996 6:35543631-35543653 TCCAGGTGACTTCAATGCACAGG + Intergenic
1007669504 6:43539668-43539690 TCCAGGCCCCCCCACTGCACCGG + Intronic
1007701056 6:43766868-43766890 TCCAAGTGGCTTCACTGCAATGG - Intergenic
1010553143 6:77247738-77247760 TCCAAGGGGCTCAAGTGCATTGG + Intergenic
1017931448 6:158959067-158959089 TGCTGGGGACTCCACTGCCCTGG + Intergenic
1018474742 6:164129681-164129703 TCCAAGGGGCTCCAGTGCAAGGG - Intergenic
1018800988 6:167222081-167222103 GCCAGGTGGCACCACTGCAGAGG - Intergenic
1018809146 6:167285090-167285112 GCCAGGTGGCACCACTGCAGAGG + Intronic
1021791449 7:24209972-24209994 TGCAGTGGGCTCCAGTGGACTGG + Intergenic
1022275131 7:28847573-28847595 CCCAGGGGTCTTCTCTGCACAGG + Intergenic
1023594474 7:41814724-41814746 TGCAGGGGGCTCTACTTTACAGG - Intergenic
1023967940 7:44972913-44972935 TCCAGAGAGCTCCACTTCAGTGG + Intronic
1023967998 7:44973245-44973267 CCCAGGGAGCTCCACTTCAGCGG + Intronic
1028609772 7:92697627-92697649 TCCCGGGGGCTTCTCTGCAGTGG - Intronic
1031658358 7:124387688-124387710 CACAGAGGGATCCACTGCACAGG + Intergenic
1035724013 8:1813684-1813706 TCCAGGGCTCTCTCCTGCACTGG - Intergenic
1035903252 8:3480320-3480342 TCCAGGGGGCTGGAGTGCAGTGG - Intronic
1036772778 8:11590506-11590528 TCCACGCAGCTGCACTGCACAGG - Intergenic
1046037704 8:108864187-108864209 GCCAGGGTACTCCACTGCAGGGG + Intergenic
1046384795 8:113495281-113495303 TCCAGGTTGCTCCACTGCTTGGG + Intergenic
1049117751 8:140704416-140704438 CTCAGGGGCTTCCACTGCACTGG + Intronic
1049342733 8:142121921-142121943 TCCACGGGCCTCCACTGACCTGG + Intergenic
1053073162 9:35112824-35112846 CCCTGGGGGGTCCACAGCACAGG - Intronic
1059176624 9:112174848-112174870 CCCAGGGACCTCCACTGCCCAGG - Intronic
1059390829 9:113998746-113998768 TCCTGGGGAGGCCACTGCACAGG - Intronic
1059457134 9:114406661-114406683 CCCAGGGACCTCCTCTGCACAGG - Exonic
1059652621 9:116329248-116329270 TACAGTGGGCTCCAATGAACGGG - Intronic
1060120356 9:120983437-120983459 CCCAGGAGGCTCCACTCCCCAGG + Intronic
1060187445 9:121572341-121572363 CCCAGGGTGCTGCACAGCACTGG + Intronic
1060213643 9:121725405-121725427 TCCAAGAGACTCCACTGCCCAGG + Intronic
1061917314 9:133762060-133762082 TGCAGGGGGCTAAACTGCAGGGG - Exonic
1062365999 9:136209366-136209388 ACCACGGGCCTCCACTGCCCTGG + Intronic
1062488334 9:136792000-136792022 ACTAGGAGGCTCCACTGCAAAGG - Exonic
1188445417 X:30249202-30249224 TCTATGGGGCTCCACTGTTCTGG - Intronic