ID: 961734802

View in Genome Browser
Species Human (GRCh38)
Location 3:128994630-128994652
Sequence GAGGTGAAGCGATTCGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961734800_961734802 8 Left 961734800 3:128994599-128994621 CCAACTCAGAGATCAGAAAACAA 0: 1
1: 0
2: 3
3: 34
4: 443
Right 961734802 3:128994630-128994652 GAGGTGAAGCGATTCGCCCGAGG 0: 1
1: 0
2: 2
3: 36
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961734802 Original CRISPR GAGGTGAAGCGATTCGCCCG AGG Intronic
900457169 1:2782797-2782819 GAGGTGAAGTGATTCGGCTGCGG + Intronic
900794381 1:4699126-4699148 GAGGTGAAGGGGCTCGCCCCAGG + Intronic
902266706 1:15272155-15272177 GAGGTTAAGCGACTTGCCCAAGG - Intronic
902535273 1:17116143-17116165 GAAGTGAAGCGATTTGCTCAAGG + Intronic
902631489 1:17707152-17707174 GAGGTGAAGTCACTTGCCCGGGG + Intergenic
902661660 1:17908510-17908532 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
902694862 1:18133417-18133439 GAGGTGAAGCGACTTGTCCAGGG - Intronic
902752585 1:18527688-18527710 GAGGTGAAGCGGCTTGCCTGAGG - Intergenic
903014047 1:20350405-20350427 GAGGTGAAGTGACTTGCCCAAGG + Intronic
903187865 1:21639492-21639514 GAGGTGAAGGGACTCTCCCTAGG - Intronic
903220608 1:21867462-21867484 GAGGTGAAGCGACTTGTCCAAGG - Intronic
903229305 1:21912195-21912217 GAGGTCAAGTGATTTGCCCAGGG - Intronic
903269313 1:22177795-22177817 GAGGAGAAGAGATTCACCCAGGG - Intergenic
903338596 1:22640872-22640894 GAGGGGAAGCAATTGGCCCAAGG + Intergenic
903468097 1:23566573-23566595 GAGGTGAAGTGACTTGCCCAAGG + Intergenic
903475060 1:23613677-23613699 GAGGTGAAGTAACTTGCCCGAGG - Intronic
903807278 1:26014353-26014375 GAGGTGAAGTGATTGCCCCAAGG - Intergenic
903995648 1:27303911-27303933 AAGGTGAAGCCATTTGCCCAAGG - Intronic
904013397 1:27403177-27403199 GAGGTGAAGCGACTTGCACAGGG + Intergenic
904028790 1:27521221-27521243 GAGGGGAAGGGACTAGCCCGAGG + Intergenic
904311960 1:29634868-29634890 GAGGTGATGAGACTTGCCCGAGG + Intergenic
904478037 1:30777124-30777146 GAGGTTAAGCAATTTGCCCAAGG + Intergenic
904508901 1:30985079-30985101 GAGATTAAGCGATTTGCCAGAGG - Intronic
904542154 1:31240147-31240169 GAGGTGACGTGATTTGCCCAAGG - Intergenic
904615260 1:31746096-31746118 GAGGTGAAGAGACATGCCCGAGG - Intronic
904775199 1:32901788-32901810 GAGGGGAGGCGATTTGCCTGAGG - Intergenic
904786272 1:32985392-32985414 GAGGAGAAGTGATTTGCCCAAGG + Intergenic
904836516 1:33341039-33341061 GAGGTGAGGTGATTTGCCCAAGG + Intronic
905233181 1:36528372-36528394 GAGGTGAAGTAACTTGCCCGAGG + Intergenic
905301874 1:36991114-36991136 GAGGTGAAGTGATTTGCCTGAGG - Intronic
905391374 1:37637873-37637895 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
905431995 1:37931378-37931400 GAGGGGCAGCGAGTGGCCCGAGG + Intronic
905900356 1:41577369-41577391 GAGGTGAAGTTATTGGCCCAAGG + Intronic
905975804 1:42172806-42172828 GAGGTGAAGTGATTTGCCCAAGG - Intergenic
906942343 1:50266153-50266175 GAGGTGAATGGATTTGCCTGAGG - Intergenic
906971759 1:50522333-50522355 GAGGTTAAGCAATTTGCCCAAGG - Intronic
907337591 1:53710460-53710482 GAGGTGAAGGGACTTGCCCAAGG + Intronic
907524315 1:55045332-55045354 GAGGTGAAGGGATTTGCTCAGGG - Intronic
907582105 1:55581759-55581781 GAAGTGAAGTGATTTGCCCAAGG - Intergenic
907985101 1:59522746-59522768 GAGGTGAAGGGATTTGCCTAAGG + Intronic
909547071 1:76859857-76859879 GAGGTGAGGCCATTTGCCCAAGG - Intergenic
910221141 1:84890517-84890539 GAGGTGAAGCTATGTGCCCAAGG + Intronic
911054886 1:93701057-93701079 GAGGTGAAGGAATTTGCCCAAGG - Intronic
911196190 1:94997608-94997630 GAGGTGAAATGATTCCCCCACGG - Intronic
911431773 1:97798448-97798470 GAGGTGAAGATATTTGCCCATGG - Intronic
913329301 1:117653961-117653983 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
914760997 1:150598170-150598192 GGGGTCAAGCGATTCACCTGAGG + Intergenic
916582193 1:166118955-166118977 GAGGTGAAGTGACTGGCCCAGGG + Intronic
917088403 1:171327516-171327538 GAGGTTAAGCCATTTGCCCAGGG + Intronic
917818931 1:178740866-178740888 GAGTTTAAGCGATTTGCCCAAGG - Intronic
917922768 1:179764790-179764812 GAGGTCAAGTGATTTGCCCCAGG - Intronic
918321184 1:183366257-183366279 GAGGTGAAGTGATTTGCCCAAGG - Intronic
921545740 1:216472903-216472925 GAGGTGAAGGGATTTTCCCAAGG - Intergenic
922422276 1:225467959-225467981 GAGGTGAAGCGACACCGCCGAGG - Intergenic
924235920 1:241999482-241999504 AAGGTGAAGTGATTTGCTCGAGG + Intergenic
1069823948 10:71243948-71243970 GAGATGAAGCAACTTGCCCGAGG + Intronic
1069825451 10:71252695-71252717 GAGGTGAAGTGATTTGCCCAAGG + Intronic
1070530149 10:77329811-77329833 GAGGTGAAGCAATTTGCCCAAGG - Intronic
1070792146 10:79195870-79195892 GAGGTGAAGCAAATTGCCCAAGG - Intronic
1070828877 10:79406708-79406730 GAGGTTAAGAGATTTGCCTGAGG + Intronic
1072259431 10:93654409-93654431 GAGGTGAAGTAACTTGCCCGAGG - Intronic
1072345365 10:94499736-94499758 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1072742035 10:97915329-97915351 GAGGAGAAGGGACTCGCCCAAGG - Intronic
1072903209 10:99427836-99427858 GAGGTGAAGCAATTTGCCCCAGG - Intronic
1073564262 10:104521792-104521814 GAGGTGAAGCAACTTGCCCAGGG + Intergenic
1075088219 10:119428254-119428276 GAGGTGAAATGAGTTGCCCGAGG - Intronic
1075675587 10:124293694-124293716 GAAGTGAAGTGACTCGCCCAAGG + Intergenic
1075677807 10:124308412-124308434 GAGGTTAAGCAGTTTGCCCGAGG + Intergenic
1076381112 10:130025062-130025084 GAGGTGAAGCCACTTGCCCAAGG - Intergenic
1077532836 11:3105314-3105336 GAGGCGAAGCCATTTGCCTGAGG - Intronic
1078225286 11:9385569-9385591 GAGGTTAAGCGACTGGCCCAAGG - Intronic
1078915639 11:15775995-15776017 GAGGTGGAGTGATTTGCCCAAGG + Intergenic
1079060388 11:17243670-17243692 GAGGTGAAGCAACTCTCCCCTGG + Intronic
1079462745 11:20698506-20698528 GAGATGAAGCAATTTGCCCAAGG - Intronic
1080056457 11:27911575-27911597 GAGGTGAAGCCATTTGTCCACGG - Intergenic
1081658334 11:44872747-44872769 GAGGTGAAGCAACTTGCCCAAGG + Intronic
1081742021 11:45447630-45447652 GAGGTGAAGCCAGTCACCTGGGG + Intergenic
1083174392 11:60940255-60940277 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1083181932 11:60992378-60992400 CATGTGAAGAGATTCGCCCAGGG + Intronic
1083640091 11:64140756-64140778 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1084148661 11:67278049-67278071 GAGGTGAAGCAACTTGCCCAAGG - Intronic
1084307476 11:68296538-68296560 GAGGTGAAGCGCCTGGCCTGGGG - Intergenic
1084433269 11:69123206-69123228 GAGCTGACTCGATTTGCCCGAGG - Intergenic
1084542803 11:69797922-69797944 GAGGTGAAGCCATCTGCCCCAGG - Intergenic
1084547763 11:69822850-69822872 GAGGTGAAGTGACTTGCCCGGGG + Intergenic
1084574656 11:69981287-69981309 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
1084591639 11:70093951-70093973 GAGGTGAAGCCACTTGCCCAGGG - Intronic
1086076852 11:82863939-82863961 GAGGTTAAGTAATTTGCCCGAGG - Intronic
1087050310 11:93880302-93880324 GAGGTGAAGCAATTTGCTCAGGG - Intergenic
1087842398 11:102934028-102934050 GAGGTGAAGAGACTTGCCCTAGG - Intergenic
1089180233 11:116578547-116578569 GAGGTGAAGCGACTCATCCAGGG - Intergenic
1089534600 11:119153224-119153246 GAGGTTAAGCAACTTGCCCGAGG + Intronic
1089878905 11:121754280-121754302 GAGGTGAAGTGACTTGCCCTAGG + Intergenic
1091020957 11:132099548-132099570 GAGGTGAAGTGACTTGCCCCGGG + Intronic
1092145552 12:6212233-6212255 GAGGTAAAGCGACTTGCCCGTGG - Intronic
1092770797 12:11894758-11894780 GAGGTGAAGTGACTTGCCCTAGG + Exonic
1094147988 12:27250650-27250672 GAGGTGAAGTGACTTGCCCAGGG + Intronic
1096439968 12:51632936-51632958 GAGGTAAAGCAATTTGCCCAAGG - Intronic
1096511642 12:52133185-52133207 GAGGTGAAGTGAATAGCCCAAGG + Intergenic
1101197602 12:102401247-102401269 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1101806151 12:108065588-108065610 GAGGTTAAGTGATTCTCCCAAGG - Intergenic
1101816769 12:108151571-108151593 GAGGGGAAGGGACTCGCCCAAGG + Intronic
1101840490 12:108324359-108324381 GAGGTTAAGCGACTTGCCCAAGG - Intronic
1101873212 12:108582168-108582190 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
1101896819 12:108763192-108763214 GAGGTGAAGTGACTTGCCCAGGG - Intergenic
1102023982 12:109703002-109703024 GAGGGGAAGTGATTGGCCCAAGG + Intergenic
1102024523 12:109706622-109706644 GAGGTGAAGCAACTTACCCGAGG + Intergenic
1102251828 12:111392708-111392730 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
1102301755 12:111776419-111776441 GAAGTGAAGGGATTTGCCCAGGG + Intronic
1102502271 12:113360547-113360569 GAGGTGAAGGGATTTGCCCAAGG - Intronic
1102623324 12:114214408-114214430 GAGGTGAAGTGATTTGGCTGTGG - Intergenic
1102855267 12:116288202-116288224 GAGATGAAGTGATTTGCCCAAGG + Intergenic
1103000308 12:117380649-117380671 GAGGTGAAGTGACTAGCCCAAGG + Intronic
1103043371 12:117714574-117714596 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1103128133 12:118442593-118442615 GAGATGAAGCAACTCGCCCAAGG + Intergenic
1103226729 12:119294117-119294139 GAGGTGAAGCGACCTGCCTGAGG - Intergenic
1103571725 12:121849431-121849453 GAGATGAAGCGACTTGCCCAGGG + Intronic
1103809575 12:123602526-123602548 GAGGTTAAGCCATTTGCCCGAGG - Intronic
1103870044 12:124084890-124084912 GAGGTGAAGTAATTAGCCCAGGG - Intronic
1111245986 13:85541796-85541818 GAGGTTAAGCAATTTGCCCAAGG + Intergenic
1116699308 14:48218554-48218576 GAGGTTAAGTGATTTGCCCAGGG - Intergenic
1118314790 14:64719485-64719507 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1118611315 14:67542469-67542491 GAGGTGAAGGGACTTGCCCAGGG - Intronic
1118720274 14:68589019-68589041 GAGGTTAAGGGACTCGCCCCAGG - Intronic
1119469357 14:74884453-74884475 GAGGTTAAGCGACTAGCCCAAGG - Intronic
1121093388 14:91198858-91198880 GAGGTTAAGCAATTTGCCCAAGG + Intronic
1121168981 14:91836828-91836850 GAGGGGAAGCTATTGGCCTGAGG + Intronic
1121538432 14:94707265-94707287 GAGATGAAGCGCTTTGTCCGAGG - Intergenic
1121646938 14:95525025-95525047 GAGGTGAAGCGAAGCGCCCAAGG + Intergenic
1121848948 14:97201607-97201629 GAGGTGAAGGGATTTGCCCAAGG - Intergenic
1122158290 14:99764330-99764352 GAGGCTAAGCGATTTGCCCAAGG + Intronic
1122214638 14:100194744-100194766 GAGGTGAAGTAATTCGCCCAAGG - Intergenic
1122416778 14:101553597-101553619 GAGGTGAAGTGATTTGCCTATGG - Intergenic
1122547555 14:102532535-102532557 GAGGTGAAGGGATTTGCCCAAGG - Intergenic
1125196628 15:37055047-37055069 GAGGTGGAGCAATTTGCCCAAGG + Intronic
1125735746 15:41924362-41924384 GAGGTGAAGTAATTTGCCCAAGG - Intronic
1128080399 15:64853791-64853813 GAGGTGAAGGGATTTGCCCTAGG - Intronic
1128729375 15:70010525-70010547 GAGGTGAAGCGATTCTCCCATGG + Intergenic
1129113962 15:73354608-73354630 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1129686867 15:77691301-77691323 GAGGAGAAGGGATTTGCCCGAGG + Intronic
1130253836 15:82316739-82316761 GAGGCGAAGGGACTTGCCCGAGG - Intergenic
1131509611 15:93042495-93042517 GAGGTGAAGTGACTTGCCCATGG + Intronic
1133326701 16:4946267-4946289 GAGGTGAAGACATTTGCCCAGGG - Intronic
1133336822 16:5011724-5011746 GAGGAAAAGTGATTTGCCCGAGG - Intronic
1133703220 16:8328870-8328892 GAGATGAAGCAATTTGCCCAAGG + Intergenic
1133905897 16:10021924-10021946 GAGGTGAAGCGACTTGCCCAAGG - Intronic
1134019622 16:10912522-10912544 GAGGTTAAGTGACTTGCCCGTGG + Intronic
1134024823 16:10945591-10945613 GAGGTGAAGTAATTTGCCCAAGG - Intronic
1134456727 16:14400487-14400509 GAGGTGAAGCGACAGGCCCCGGG - Intergenic
1134667416 16:16028806-16028828 GAGGTGAAGGGACTTGCCCAAGG + Intronic
1135534384 16:23281835-23281857 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1136076712 16:27822229-27822251 GAGGTGAAGCGAGTTACCTGGGG + Intronic
1136109913 16:28058231-28058253 GAGGTGAAGTGAGTTGCCCAAGG - Intronic
1136168852 16:28475474-28475496 GAGGTGAAGTGACTTGCCCAAGG + Intergenic
1136179318 16:28539904-28539926 GAGGTGAAGGGACTCGCCCAAGG - Intergenic
1136249197 16:28992690-28992712 GAGGTGAAGTGACTTGCCCAAGG + Intergenic
1137290647 16:47049920-47049942 GAGGGAAAGGGATTCGCCCAAGG + Intergenic
1137384662 16:48030313-48030335 GAGGTGAAGGGAGTTGCCTGGGG - Intergenic
1137500699 16:49009857-49009879 GAGGTGAAGTCATTTGCCCAAGG + Intergenic
1138220407 16:55245544-55245566 GAGGTTAAGCCCTTCGCTCGAGG - Intergenic
1138535286 16:57656776-57656798 GAGGTTAAGCAATTTACCCGTGG + Intronic
1140258281 16:73355727-73355749 GATGTGAAGCGACTTGCCCAAGG - Intergenic
1141031129 16:80589862-80589884 GAGATGAAGTGACTCGCCCAAGG - Intergenic
1141127789 16:81413466-81413488 GAGGTAAAGGGATTGGACCGAGG - Intergenic
1141431519 16:83972644-83972666 GAGGTTAAGCAATTTGCCCCAGG + Intronic
1141624900 16:85256014-85256036 GAGGTTAAGGGACTTGCCCGAGG - Intergenic
1141661377 16:85443378-85443400 GAGGTGAAGACACTGGCCCGAGG - Intergenic
1141768370 16:86073500-86073522 GAGGTTAAGTGATTTGCCCAAGG - Intergenic
1141887591 16:86903241-86903263 GAGGTCAAGCAATTTGCCCAAGG - Intergenic
1142175632 16:88643713-88643735 GAGGTTAAGTGACGCGCCCGAGG + Intronic
1142514239 17:416570-416592 GAGGTGAAGCAATCTGCCAGGGG - Intronic
1143223517 17:5281849-5281871 GAGGTGAAGTGACTCTCCCAAGG + Intergenic
1143550853 17:7629707-7629729 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1144218267 17:13076687-13076709 GAGGTGAAACGACTTGCCCAAGG - Intergenic
1144569250 17:16385602-16385624 GGGCTGAAGCGATCCACCCGAGG + Intergenic
1144839714 17:18178489-18178511 GAGGTGAAGCGATAGACCCTGGG + Intronic
1145250570 17:21294847-21294869 GAGGTGAAGCCACTTGCCTGAGG + Intronic
1145250919 17:21296611-21296633 GAGGTGAAGCCACTTGCCCCAGG - Intronic
1145737611 17:27244088-27244110 GAGGTGAAGTGACTTGCCTGAGG + Intergenic
1146914555 17:36670141-36670163 GAGGGGAAGCGATTTGGCCAGGG + Intergenic
1146943339 17:36858811-36858833 GAGGTGAAGTTATTTGCCCAAGG - Intergenic
1147983076 17:44286979-44287001 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
1147995717 17:44359469-44359491 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1148866218 17:50630098-50630120 GAGGTTAAGTGAATTGCCCGTGG + Intergenic
1149649685 17:58269038-58269060 GGGGTGAAGCGACTCGTCTGAGG - Intergenic
1150308744 17:64109722-64109744 GAGGTGAAGTGACTTGCCCAGGG + Intronic
1156550463 18:38010999-38011021 GAGGTTAAGCGATTTGCCCAAGG + Intergenic
1156553678 18:38044000-38044022 GAGGTGAAGTGACTCGCTCAAGG - Intergenic
1157558401 18:48628653-48628675 GGGATGAAGCGATTTGCCCAAGG + Intronic
1157600259 18:48889286-48889308 GAGGGGAAGTGATTTGCCCAAGG - Intergenic
1158447722 18:57535757-57535779 GAGGTGAAGCGACTTGACCATGG - Intergenic
1160489793 18:79326989-79327011 GAGGTGCAGCCATTTGCCCAGGG + Intronic
1161113655 19:2484450-2484472 GAGGTGAAGCAACTTGCCCGAGG - Intergenic
1162077037 19:8194787-8194809 GAGGTGGAGCGACTTGCCCAAGG - Intronic
1162110942 19:8399454-8399476 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1162316768 19:9943930-9943952 GAGGTTAAGTAATTTGCCCGAGG + Intergenic
1162383945 19:10349994-10350016 GAGGTGAAGCCATTAGCCTGAGG + Intergenic
1162735757 19:12746055-12746077 GAGGTGAAGTGATTTGCTTGAGG - Intronic
1162875506 19:13618155-13618177 GAGGTGGAGCGATTTACCCAAGG - Intronic
1163253510 19:16140926-16140948 GAGGTGAAGTGAGTTGCCCAAGG + Intronic
1163733106 19:18961639-18961661 GAGGTGAAACGATACTCCCGGGG + Intergenic
1163793799 19:19323852-19323874 GAGGTAAAGTGATTTGCCCAAGG + Intronic
1164598744 19:29547288-29547310 GAGATGAAGTGATTTGCCCCAGG - Intronic
1165354370 19:35294474-35294496 GAGGTTAAGTGACTCGCCCAAGG - Intronic
1165888680 19:39097932-39097954 GAGGTGAAGTGATGTGCCCCAGG + Intronic
1166184331 19:41129774-41129796 GAGGTGAAGTGAGTTGCCCAAGG + Intergenic
1166345922 19:42165635-42165657 GAGGTGAAGTGACTTGCCCAGGG - Intronic
1166714843 19:44960439-44960461 GAGGTGAAGTGATGTGCCCAAGG + Intronic
1167271176 19:48507288-48507310 GAGGTGAAGCGACTTGCCTAGGG + Intronic
927945999 2:27135541-27135563 GAGAGGAAGTGATTTGCCCGAGG + Intergenic
930002393 2:46869979-46870001 GAGGTGAAGGAATTTGCCCCAGG - Intergenic
931455899 2:62409707-62409729 GAGGTGAAACAATTTGCCCAAGG + Intergenic
934576334 2:95403734-95403756 GAGGTTAAGAGATTTGCCCAAGG - Intronic
936012142 2:108931578-108931600 GAGGTTAAGTGATTTGCCCCAGG + Intronic
936350846 2:111711450-111711472 GAGGTTAAGGGATTTGCCTGAGG + Intergenic
938803425 2:134784562-134784584 GAGGTGAAGTGGTTGTCCCGAGG + Intergenic
942249342 2:174034265-174034287 GAGGTGAAGGAACTCGCCCAAGG + Intergenic
945756610 2:213855388-213855410 GAGGTTAAGTGATCCACCCGAGG - Intronic
946606848 2:221414571-221414593 GAGGTTAAGTGATTTTCCCGAGG + Intergenic
948794617 2:240395891-240395913 GAGGTGAGGAGATTTGCCCAAGG + Intergenic
948984059 2:241509180-241509202 GAGGCGAAGCAACTCGCCCAAGG - Intronic
1168860480 20:1042967-1042989 GAGGTGAAGGGACTTGCCCAAGG + Intergenic
1168867837 20:1104471-1104493 GAGGTGAAGTGACTTGCCCCAGG + Intergenic
1168962056 20:1876697-1876719 GAGGTTAAGCAACTTGCCCGAGG - Intergenic
1169065772 20:2693404-2693426 GAGATGGAGGGATTCCCCCGCGG - Intronic
1169571242 20:6908412-6908434 GAGGTTAAGTGATATGCCCGAGG - Intergenic
1170594608 20:17795554-17795576 GAGGTTAAGCGATTTGCCCAAGG + Intergenic
1170971235 20:21118473-21118495 GAGGTGAAGCAAGTCGTCAGAGG - Intergenic
1172214366 20:33224587-33224609 GAGGTGAAGTGACTTGCCCAAGG - Intronic
1172357955 20:34292717-34292739 GAGGTGAAGTGATTTGCCCAAGG - Intronic
1172438982 20:34952135-34952157 GAGGTGAAATGACTTGCCCGAGG + Intronic
1172626613 20:36351031-36351053 GAGGTGAAGTCACTCGCCGGAGG - Intronic
1172847594 20:37939032-37939054 GAGGTGAAGCGATTTTCTCAAGG - Intronic
1172899422 20:38323604-38323626 GAGGTGAAGTGACTTGCCCAAGG - Intronic
1172911204 20:38410534-38410556 GAGGTGAAGTGACTTGCCCAGGG + Intergenic
1173127516 20:40353539-40353561 GAGGAGAAGTGATTTGCCCAAGG + Intergenic
1173171219 20:40725584-40725606 GGGGTGAAGTGACTTGCCCGGGG - Intergenic
1173335378 20:42108346-42108368 GAGGTTAAGTCATTTGCCCGAGG - Intronic
1173414225 20:42841294-42841316 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1173626494 20:44476481-44476503 TAGGTTAAGCGATTCGCCCAAGG - Intronic
1173676412 20:44839458-44839480 GAGGTTAAGTGATTCACCCAAGG - Intergenic
1173843427 20:46173891-46173913 GAAGTGAAGTGACTTGCCCGAGG + Exonic
1173868086 20:46325510-46325532 GAGGTGAAGCGACTTACCCAAGG - Intergenic
1174303586 20:49599909-49599931 GAGGTGAAGTAATTTGCCCACGG + Intergenic
1174395077 20:50242327-50242349 CAGGTGAAGCAACTTGCCCGAGG - Intergenic
1174545684 20:51323434-51323456 GAGGTGAAGTGACTTGCCCCAGG - Intergenic
1175134015 20:56809540-56809562 GAGGTCAAGAGACTTGCCCGAGG + Intergenic
1175270202 20:57728508-57728530 GAGATGAAGTGATTTGCCCAAGG - Intergenic
1176510727 21:7745526-7745548 GAGGTTCAGCGACTCGCCCAGGG + Intronic
1178377303 21:32077061-32077083 GAGGTGGAGCGACTGGCCCAAGG - Intergenic
1178495256 21:33080821-33080843 GAGGGGATGAGATTTGCCCGTGG - Intergenic
1178644840 21:34376055-34376077 GAGGTTCAGCGACTCGCCCAGGG + Intronic
1179469693 21:41602273-41602295 GAGGTTAAGTGACTTGCCCGAGG - Intergenic
1181880476 22:25975585-25975607 GAGTTGAAGTGATTTGCCCAAGG + Intronic
1181952550 22:26564891-26564913 GAGGTGAAGCAGTTTGCCCAGGG - Intronic
1181966746 22:26661606-26661628 GAGGTGAAGTGATGAGCCCAGGG + Intergenic
1182085303 22:27557125-27557147 GAGGTGAACCGACTCACCCAAGG + Intergenic
1182118904 22:27774410-27774432 GAGGTGAAGCAACTTGCCCAGGG + Intronic
1183105331 22:35611213-35611235 GAGGTGAAGTGAATGGCCCAAGG - Intronic
1183427009 22:37745665-37745687 GGGGTGAGCCGATTTGCCCGAGG - Intronic
1183432198 22:37772595-37772617 GAGGTGAAGCGCTTGTCCTGGGG - Exonic
1183541007 22:38429453-38429475 GAGGTGAACTGAATTGCCCGAGG - Intronic
1183743620 22:39681216-39681238 GAGGTGGAGTGATTTGCCTGAGG + Intronic
1184062179 22:42090272-42090294 GAGGTGAAGTGATGTGCCCAGGG - Intronic
1184252843 22:43270670-43270692 GAAGTGGAGCGATTTGCCTGTGG + Intronic
1184407294 22:44307371-44307393 GAGGTGAAGTGACTTGCCCAAGG + Intronic
1184607118 22:45580579-45580601 GAGGGCAAGAGATTTGCCCGAGG + Intronic
949944562 3:9179817-9179839 GAGGTCAAGCGACTAGCCCAAGG + Intronic
950041844 3:9924661-9924683 GAGGTGAAGTGACTTGCCCAAGG - Intronic
950042444 3:9928779-9928801 GAGGTGAAGTGAGTTGCCCAGGG - Intronic
950132488 3:10556906-10556928 GAGGTGAAGTGCTTTGCCCAAGG + Intronic
950133171 3:10561514-10561536 GAGGTGAAGTGATTTGCCCAAGG + Intronic
950153537 3:10706779-10706801 GAGGGGAAGCGACTTGCCAGAGG + Intronic
950159215 3:10746858-10746880 GAGGTGAAGTGACTTGCCTGAGG - Intergenic
950179716 3:10902594-10902616 GAGGTGAAGTAATTTGCCCAGGG + Intronic
950404817 3:12797620-12797642 GAGGAAAAGGGATTGGCCCGTGG + Intronic
950423530 3:12912416-12912438 GATGTGAAGGGATTCGCTCAAGG + Intronic
953662955 3:44904348-44904370 GAGGTGAAGTGAGTTGCCTGAGG + Intronic
953689741 3:45107680-45107702 GAGGTGAAGTGACTTGCCCATGG + Intronic
953791080 3:45948822-45948844 GAGGCTAAGAGATTCGCCCAAGG - Intronic
954791712 3:53137911-53137933 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
954852976 3:53618873-53618895 GAGGTGAAGTGACTTGCCCGAGG - Intronic
955554207 3:60118588-60118610 GAGGTAAAGTGACTCGCCCAAGG + Intronic
958737398 3:98024974-98024996 GAGGTTAAGAGATTTGCCCAAGG - Intronic
958924852 3:100146464-100146486 GAGGTAAAGCCATTTGCCCAAGG - Intronic
961092369 3:124125258-124125280 AAGGTGAAGAGATTTGCCCATGG + Intronic
961734802 3:128994630-128994652 GAGGTGAAGCGATTCGCCCGAGG + Intronic
961825502 3:129597146-129597168 GAGTTGAAGTGATTTGCCCAGGG + Intronic
961870566 3:129984743-129984765 AAGGTGAAGTGATGTGCCCGAGG + Intergenic
962204413 3:133423295-133423317 GAGGTTAAGCGATTTGCCTTGGG - Intronic
962941333 3:140127249-140127271 GAGGTTAAGCAATTTGCCCCGGG - Intronic
964271807 3:154964703-154964725 GAGGTGAAGTGATTTACCCATGG + Intergenic
964724393 3:159799338-159799360 GAGGTGAAGTAATTTGCCCAGGG - Intronic
965711594 3:171561297-171561319 GAGGTGAAGCGACTCGCCCAAGG + Intergenic
967045657 3:185734320-185734342 GAGGTGAAGTGACTTGCCCAAGG + Intronic
967377269 3:188818708-188818730 GAGGTTAAGCAATTTGCCCAAGG - Intronic
968309508 3:197671807-197671829 GAAGTGAAGTGGTTCGCTCGAGG + Intronic
969074826 4:4569642-4569664 GAAGTGAAGTGATTCACCCAAGG - Intergenic
969235185 4:5860521-5860543 GAGGTGAAGCAACTTGCCCAAGG - Intronic
969457643 4:7309225-7309247 GAGGTTAAGTGATTGGCCCTCGG + Intronic
970386563 4:15562739-15562761 GAGGTGAAATGATTTGCCCAAGG + Intronic
972318495 4:37950219-37950241 GAGGTGAAGTTATTTGCCCAGGG - Intronic
972734274 4:41825464-41825486 GAGGTTAAGTGATTTGCCCAGGG + Intergenic
975585235 4:75941790-75941812 GAGGTGAAGCCATGTACCCGAGG + Intronic
976001979 4:80385581-80385603 GGGGTGAAGTGACTTGCCCGAGG + Intronic
979484324 4:121253776-121253798 GAGGTGAAGGGTTTCACCCTTGG - Intergenic
980880635 4:138706858-138706880 TGGGTGAAGAGATTTGCCCGAGG - Intergenic
982066730 4:151660940-151660962 GAGGTAAAGCAATTTGCCTGAGG + Intronic
982652306 4:158101497-158101519 GAGTAGAAGAGATTCGCCAGAGG + Intergenic
982732541 4:158971960-158971982 GAGGTGAACTGATTTGCCCAAGG + Intronic
985080073 4:186255550-186255572 GAGGTAAAGCAACTTGCCCGAGG - Intronic
986302150 5:6486201-6486223 GAGGTTAAGTGATTCACCCAAGG + Intronic
986417849 5:7546453-7546475 GAGATGAAGCGACTGGCCCAGGG + Intronic
988993990 5:36697128-36697150 GAGGTTAAATGATCCGCCCGAGG + Intergenic
989191016 5:38669780-38669802 GAGGTGAAGGGATTTCCCCAAGG + Intergenic
990687876 5:58328083-58328105 GAGGTGAAAGGATTTGCCCAAGG - Intergenic
990730251 5:58800803-58800825 GAGATGAAGCGATTCACCAATGG - Intronic
991085859 5:62647940-62647962 GAGGTTAAGTGATTTGCCCAAGG + Intergenic
991534113 5:67647779-67647801 GAGGTGAAGTGACTTGCCCAAGG + Intergenic
994707107 5:103220293-103220315 GAGGGTAAGCGATTTGCCCAGGG - Intergenic
997356775 5:133267495-133267517 GAGGTGAAGCAATTTGCCCCAGG + Intronic
997386824 5:133480229-133480251 GAGGTGAAGTAATTTGCCCAAGG - Intronic
997512552 5:134463507-134463529 GAGGTTAAGAGATTTGCCAGTGG - Intergenic
998311993 5:141142499-141142521 GAGGTAAAGCAATTTGCCCAAGG + Intronic
998431082 5:142070525-142070547 GAGGTGAAGTGATAAGCCCCAGG - Intergenic
999327162 5:150650484-150650506 GAGGGGAGGCGACTCGCCCAAGG - Exonic
999759784 5:154691354-154691376 GAGGGGAAGCGACTGGCCCAAGG - Intergenic
1001035752 5:168295165-168295187 GAGGTCAAGTGATTTGCCCAAGG - Intronic
1001483453 5:172103922-172103944 GAGGTTAAGCCATTTGCCCAGGG + Intronic
1001942948 5:175753608-175753630 GAGGTGAAGGGACTCGTCCAGGG - Intergenic
1002058293 5:176610760-176610782 GAGGTGAAATGATTTGCTCGAGG - Intergenic
1002086823 5:176781092-176781114 GAGGTCAGGCGAGTCGCCCAAGG - Intergenic
1002350486 5:178579944-178579966 GAGGGGCAGCGATTGGCCCCTGG - Intronic
1003569404 6:7246454-7246476 GAGGTCTAGCACTTCGCCCGCGG - Exonic
1003925948 6:10877682-10877704 GAGGTTAATCGACTCGCCCAAGG + Intronic
1004539703 6:16538236-16538258 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1005351396 6:24939140-24939162 GAGGTGAAGTGATCCACCCAAGG + Intronic
1006519908 6:34565215-34565237 GAGGGGAAGTGACTTGCCCGAGG - Intergenic
1006593196 6:35173194-35173216 GAGATGAAGCAATTTGCCCGAGG + Intergenic
1006716135 6:36121842-36121864 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
1006794850 6:36725425-36725447 GAGGTGAAGTGACTTGCCTGAGG + Intronic
1006844886 6:37055336-37055358 GAGGTGAAGTGACTTGCCCAAGG - Intergenic
1007415963 6:41691361-41691383 GAGGGGAAGAGATTTGCCCAAGG + Intronic
1007959186 6:45943149-45943171 GAGGTTAAGCAATTTGCCTGAGG + Intronic
1007979653 6:46138569-46138591 GAGGTGAAGAGAGTTGCCGGAGG - Intronic
1007987689 6:46223672-46223694 GAAGTGAAGTGATTGGCCCAAGG - Intronic
1011108737 6:83812782-83812804 GAGGTTAAGCAATTTGCCCAAGG + Intergenic
1011599051 6:89043034-89043056 GAGGTTAAACGATTTGCCCAAGG - Intergenic
1017165324 6:151402513-151402535 GAGGTTCAGTGATTCGCCCAAGG + Intergenic
1019938283 7:4270372-4270394 GAGGTGGAGCCATTTGCCCAGGG + Intergenic
1020225792 7:6278933-6278955 GAGGTGAAGCAACTTGCCCAAGG - Intergenic
1020634604 7:10681475-10681497 GAGGTGAAGAGATTTGCACAAGG - Intergenic
1022342140 7:29478643-29478665 GAGGTAAAGCAATTTGCCCAAGG - Intronic
1024294027 7:47828539-47828561 GAGGTGAAGCAATTAGACCCAGG - Intronic
1029448766 7:100629090-100629112 GAGGTGAAGTGACTGGCCCAGGG + Intronic
1035640050 8:1178011-1178033 GTGGTGAAGGGATTCGGCCATGG + Intergenic
1039582846 8:38681129-38681151 GAGGTCAAGTGATTTGCTCGTGG - Intergenic
1044872789 8:96636614-96636636 GAGGTTAAGTGATTTGCCCGTGG + Intergenic
1045174558 8:99707790-99707812 GAGGTTAAGCGGTTTGCCCAGGG + Intronic
1047218386 8:122898172-122898194 GAGGTGAAGTGACTTGCCCAGGG + Intronic
1048162527 8:132034233-132034255 GAGGTGAAGTGATTTGCCCAGGG - Intronic
1048310568 8:133319540-133319562 GAGGTGAAGTGACTTGCCCATGG + Intergenic
1048456924 8:134586869-134586891 GAGGTGAAGTAATTTGCCCCAGG - Intronic
1048932024 8:139322762-139322784 GAGGTTAAGTGATTTGCCCAAGG - Intergenic
1049154670 8:141059436-141059458 GAGGGGAATCGACTCGCCCAGGG - Intergenic
1049239593 8:141530462-141530484 GAGGTGAAGTGACTTGCCCAGGG + Intergenic
1051264197 9:15295482-15295504 GAAGGGAAGTGATTGGCCCGAGG - Intronic
1052824838 9:33167207-33167229 GAGGGGAGGCGACCCGCCCGCGG + Exonic
1054801362 9:69352601-69352623 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056620792 9:88212240-88212262 GAGATGAAGTGATTTGCCCAAGG - Intergenic
1059302674 9:113327719-113327741 GACCTCAAGTGATTCGCCCGAGG - Intronic
1059393524 9:114016491-114016513 GAGGTTAAGAGACTTGCCCGAGG + Intronic
1059426086 9:114221847-114221869 GAGGTTAAGTGATTCACCCAAGG - Intronic
1059461588 9:114434257-114434279 GAGGTGAAGCTACTTGCCCAAGG + Intronic
1059465949 9:114468993-114469015 GAGGTGAAGCAACTTGGCCGGGG - Intronic
1060055930 9:120412987-120413009 GAAGTGATGCGATTTGCCTGAGG - Intronic
1060096158 9:120792657-120792679 CAGGTGAAGTGATTTGCCCAAGG - Intronic
1060112327 9:120915021-120915043 GAGGGGAAGGGATTTGCCCAAGG + Intronic
1060418338 9:123449110-123449132 GAGGTGAAGTCATTTGCCCAGGG - Intronic
1060506573 9:124202420-124202442 GAGGTGAAGAGACTCGCCCAAGG - Intergenic
1060512988 9:124247805-124247827 GAGGTAAAGTGACTCGCCCAAGG - Intergenic
1060665037 9:125427721-125427743 GAGGTGAAGGGACTTGCCCAGGG + Intergenic
1060997815 9:127885052-127885074 GAGGCGAAGTGACTTGCCCGTGG + Intergenic
1061054733 9:128216338-128216360 GAGGTGAAGTGACTCACCCAAGG - Intronic
1061264089 9:129495793-129495815 GAGGTGAAGCCAGTCCCCCAAGG + Intergenic
1061394698 9:130337599-130337621 GAGGTGAAGCAACTTGCCTGAGG + Intronic
1061452446 9:130675702-130675724 GACGTGAGGCGACTTGCCCGAGG + Intronic
1061808346 9:133148772-133148794 GAGGGGCAGGGACTCGCCCGGGG - Intronic
1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG + Intronic
1062271512 9:135711991-135712013 GAGGTGAAGTGACTCGCCGGGGG + Intronic
1186433755 X:9526481-9526503 GAGGTGAAACGACTTGCCCGGGG + Intronic
1186525833 X:10247472-10247494 GAGGTTAAACGATTTGCCCAGGG - Intergenic
1187713744 X:22080805-22080827 GAGGTGAAGTAATTTGCACGAGG - Intronic
1189753716 X:44249500-44249522 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1190436611 X:50431869-50431891 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1190464441 X:50711949-50711971 GAGGTGAAGTGACTTGCCCAAGG - Intronic
1192212771 X:69138060-69138082 GAGGTGAAGGGACTTGCCCAAGG - Intergenic
1192309976 X:70003164-70003186 CAGGTGAAGTGATTCGCCCAAGG + Intronic
1194405439 X:93491121-93491143 GAGGTCAAGCGATTTGTCCATGG - Intergenic
1194457865 X:94126783-94126805 GAGGTTAAGTGATTTGCCCAAGG + Intergenic
1198439388 X:136647338-136647360 GAGATGAAGTGATTTGCCCAAGG + Intergenic
1198441855 X:136671194-136671216 GAGGTGAAGCAACTTGCCCCAGG + Intronic
1199526115 X:148793757-148793779 GAGGTGAAATGATTTGCCCAAGG - Intronic
1199967598 X:152832732-152832754 GAGGTTAAGCGACTTGCCCAAGG - Intronic
1200145655 X:153925338-153925360 GAGGTGCAGTGACTTGCCCGTGG - Intronic
1201575024 Y:15454229-15454251 GAGGTAAAGCTACTCGCCCTAGG - Intergenic