ID: 961736887

View in Genome Browser
Species Human (GRCh38)
Location 3:129007636-129007658
Sequence AGGAAATAGACCCTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961736880_961736887 14 Left 961736880 3:129007599-129007621 CCCTCTAAGGTTGGTATTATGTC 0: 1
1: 0
2: 5
3: 17
4: 118
Right 961736887 3:129007636-129007658 AGGAAATAGACCCTTGGGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 182
961736881_961736887 13 Left 961736881 3:129007600-129007622 CCTCTAAGGTTGGTATTATGTCG 0: 1
1: 0
2: 0
3: 6
4: 53
Right 961736887 3:129007636-129007658 AGGAAATAGACCCTTGGGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961736887 Original CRISPR AGGAAATAGACCCTTGGGGT TGG Intronic
901133376 1:6976846-6976868 AGGTAATAGAACCATGGGGACGG + Intronic
901185387 1:7369526-7369548 AGGGAAGAGACACATGGGGTAGG + Intronic
901196730 1:7444469-7444491 AGCAAACAGAACCTTGGGCTGGG - Intronic
901635912 1:10670069-10670091 AGGAACCAGACCCCTGGGTTGGG + Intronic
901877607 1:12175716-12175738 AGGAAATTGAGCCAAGGGGTGGG - Intronic
906720561 1:48001252-48001274 AGGAGATAGAGCCTGAGGGTGGG - Intergenic
909939662 1:81596467-81596489 AGGAAAAACACCCTTGGAGCCGG - Intronic
914240358 1:145849032-145849054 AAGAAATAGAGCCATGGGTTTGG + Exonic
915960692 1:160263881-160263903 AGGAAAAAAACCCTAGGGCTGGG - Intergenic
918289023 1:183088097-183088119 AGAAAATAGACCTTTCTGGTTGG - Intronic
919831160 1:201540941-201540963 AGGAAATAGACCCTAGGGGCTGG - Intergenic
923730587 1:236545976-236545998 AGGAAGTTGAGCCTTGTGGTGGG + Intronic
924028747 1:239865952-239865974 TGAAAATAGACCCTTGTGGGAGG - Intronic
1064750460 10:18523077-18523099 AGGAAATAGACCCTTTAGCTTGG + Intronic
1069770840 10:70898809-70898831 AGGAAAGAGACCTATAGGGTGGG - Intergenic
1069915843 10:71786240-71786262 AGCAAACAGTCCCTTTGGGTTGG + Intronic
1070741015 10:78903347-78903369 ATGAAACAGACCCTTGGAGCAGG + Intergenic
1072565341 10:96612317-96612339 AGCAAACAAACCCCTGGGGTTGG + Intronic
1072936538 10:99718707-99718729 AGGAAGCAGAATCTTGGGGTGGG - Intronic
1074596513 10:114872859-114872881 AGGAAATAGACCCTCAGGGATGG - Intronic
1076032342 10:127170177-127170199 AGGTACTAGACTCTTTGGGTTGG + Intronic
1076074709 10:127524005-127524027 AGGAAATAGGTCCTTGAGATTGG - Intergenic
1078361012 11:10667595-10667617 AGAAAATCGACTCCTGGGGTAGG + Intronic
1081774265 11:45666562-45666584 AGGAAACAGGCCACTGGGGTGGG - Intergenic
1082270835 11:50167699-50167721 AGATAATAGACCCTTGGGTTAGG - Intergenic
1083504129 11:63139453-63139475 AGGAAATATACCTTAGGGGATGG + Intronic
1084482407 11:69429657-69429679 AGGAAATGTACCCTTCGTGTGGG - Intergenic
1085604152 11:77882312-77882334 AGGAAAAAGAACCTTGAGCTTGG + Intronic
1086412328 11:86555015-86555037 GAGAAGTTGACCCTTGGGGTGGG + Intronic
1087478949 11:98674948-98674970 AGGAAATACACCCTGTTGGTGGG - Intergenic
1091096343 11:132825806-132825828 AGGGAATACACCTTTGGGTTGGG + Intronic
1091411422 12:242584-242606 AGGAAGTGGACCCTTGGGTGAGG + Intronic
1096145810 12:49277798-49277820 AGAAAATAGACCCTTGGGTGTGG + Intergenic
1097068326 12:56336970-56336992 AGGAAGTAGAGCCTGGGGGATGG - Intronic
1098037624 12:66321351-66321373 AGGAAAGAGATGGTTGGGGTGGG + Intronic
1098141382 12:67453394-67453416 AGCAAAGAGACCATTGTGGTTGG + Intergenic
1098557634 12:71837670-71837692 AGGAAAGAGAGACTTGGGCTGGG + Intergenic
1100684906 12:96977124-96977146 AGGAAAAAGACTCTCAGGGTTGG - Intergenic
1102243340 12:111339318-111339340 GGGAAATAGACAGTTGGGGCTGG - Intronic
1102499782 12:113344005-113344027 AGGAATTAGGCCCATGTGGTGGG + Intronic
1102933615 12:116880066-116880088 AGGTACTAGGCTCTTGGGGTGGG - Intronic
1109845855 13:67989868-67989890 AGGTAATTGACTCATGGGGTGGG + Intergenic
1111552257 13:89829277-89829299 AGGAAAGAGACCATTTGGCTAGG + Intergenic
1113095287 13:106657106-106657128 AGGAAAGAGGAACTTGGGGTGGG + Intergenic
1113942326 13:114024751-114024773 GGCAAATAGAGCCTTGAGGTGGG - Intronic
1115784618 14:36810783-36810805 AGGAAATATATTCTTGGGATGGG + Intronic
1117444053 14:55786955-55786977 TGGAAGAAGACCCGTGGGGTGGG - Intergenic
1119818500 14:77592754-77592776 AGGAAAATGACACTTGTGGTGGG - Intronic
1121154830 14:91673224-91673246 AGGAAATCGACCCTTAGGCAAGG + Intronic
1122739882 14:103866163-103866185 TGGAATGAGGCCCTTGGGGTGGG + Intergenic
1124961568 15:34400521-34400543 AAGAAATAGAACCTTTGGCTGGG - Intronic
1124978194 15:34546744-34546766 AAGAAATAGAACCTTTGGCTGGG - Intronic
1128351409 15:66892779-66892801 AGGAAATATACCTTAGGGGGTGG - Intergenic
1130266491 15:82409697-82409719 AAGAAATAGAACCTTTGGCTGGG + Intergenic
1131152946 15:90058245-90058267 AGGAAGAAGGCACTTGGGGTGGG + Intronic
1131717930 15:95133647-95133669 AGGAAAGAGAACCTTAGGGTAGG - Intergenic
1131939448 15:97544841-97544863 AGGAAATTGACCCATAGTGTGGG - Intergenic
1133467875 16:6045266-6045288 AGGAGATAGAACATTTGGGTGGG + Intronic
1134128089 16:11630136-11630158 AGGAACCAGACCCCTGGCGTTGG + Intronic
1136528370 16:30848356-30848378 AGGAAATGCACCATTGAGGTGGG + Intronic
1137063457 16:35812608-35812630 AGGAAACAGACCCATATGGTGGG + Intergenic
1137496752 16:48975321-48975343 AGGTAATGGACTATTGGGGTGGG - Intergenic
1137903098 16:52290368-52290390 AGGGAAGTAACCCTTGGGGTGGG + Intergenic
1138263348 16:55641515-55641537 AGGAAATAGAGCTGTGGGGTAGG + Intergenic
1138654590 16:58483542-58483564 AGGAAACAGCCCCTTTGGCTGGG - Intronic
1140028464 16:71313461-71313483 AGAAACTAGTCCATTGGGGTTGG - Intergenic
1141392860 16:83679045-83679067 TGGAAATAGACCATTGGGATTGG + Intronic
1142224639 16:88871596-88871618 AGGAAATAGGCCCCGGGGCTCGG + Intergenic
1142554173 17:761850-761872 AGGGAAAAAACCCTTTGGGTTGG + Intronic
1142968890 17:3597966-3597988 AGAAAATAGACACTTGTGGCCGG - Intergenic
1142997643 17:3770424-3770446 TGGAAATAGACCCTGAGGGCTGG - Intronic
1143210190 17:5180535-5180557 AGTAATTAGACCCCTGGGGCTGG + Exonic
1146355884 17:32133778-32133800 AGGAAAAAGACACTTTGGGCTGG - Intergenic
1146818564 17:35965179-35965201 AGGAAATATACATTTGGGGGAGG + Intergenic
1147001201 17:37363688-37363710 AGAAAATAGAACCATGGGCTGGG + Intronic
1147381867 17:40061092-40061114 TGGAACTAGTCCCTTGGGATTGG - Intronic
1147700869 17:42394051-42394073 AAGAAAGAGAACCTTGGGGATGG + Intergenic
1147732688 17:42613939-42613961 AGGAAGTGGAGCCGTGGGGTGGG - Exonic
1147739947 17:42665768-42665790 AGGAAGTGGAGCCGTGGGGTGGG - Exonic
1148242825 17:46011649-46011671 ACGTATGAGACCCTTGGGGTGGG + Intronic
1149604935 17:57917860-57917882 AGGCAAAAAAGCCTTGGGGTGGG - Intronic
1151647805 17:75445413-75445435 AGGAACTACACCCATGGGATGGG - Intronic
1157148457 18:45190448-45190470 ATGAAATAGAGCCTCTGGGTGGG + Intergenic
1160305059 18:77725097-77725119 AGGAAACTGACTCTTGGGGGTGG + Intergenic
1161567262 19:5010525-5010547 AGGAAATATTCCCGTGGTGTTGG + Intronic
1161725431 19:5925652-5925674 AGGAAATAGTTCGTTGCGGTTGG + Exonic
1162314658 19:9931077-9931099 AGGAAAGAGCCCCTTGGGGCTGG - Intronic
1162516847 19:11153464-11153486 AGAAAATAGAGTCTTGGGCTGGG + Intronic
1164754730 19:30681190-30681212 AGGAATGAGACCCGTGGAGTGGG + Intronic
1166304833 19:41931827-41931849 AGGAGATGGAATCTTGGGGTGGG - Intergenic
1167735350 19:51291281-51291303 AGGAAACAGAGCCATAGGGTGGG - Intergenic
1167873225 19:52390529-52390551 AGGAAATGGGCTCTTGAGGTGGG + Intergenic
1167891355 19:52542361-52542383 AGGAAAGCGACCCGTGGGGCTGG - Intronic
928327513 2:30331597-30331619 AGGAAATTGAATCTTGGGGGCGG + Intergenic
936033861 2:109094063-109094085 AGGAAATATACTTTTGGGGATGG + Intergenic
938099383 2:128487888-128487910 AGAGAAGAGACCCATGGGGTTGG - Intergenic
941921848 2:170858990-170859012 AAAAAATAAAGCCTTGGGGTGGG + Intronic
942324329 2:174762858-174762880 AGGAAATAGCTCCCTGGGCTGGG + Intronic
944435551 2:199685321-199685343 TGGAAATAGAGCCTTAGAGTGGG + Intergenic
944844059 2:203651401-203651423 AGGAAATTGAGCCTTTGGGGAGG + Intergenic
946239137 2:218343346-218343368 AGGGAATAGATGCCTGGGGTGGG + Intronic
946278812 2:218651275-218651297 AGGAAATAACCCTTTGGGCTGGG - Intronic
946831462 2:223732444-223732466 AGGTAATAGAATCTTGGGGGCGG - Intergenic
947857455 2:233333722-233333744 AGGAAGAGGGCCCTTGGGGTTGG - Intronic
947961231 2:234239935-234239957 AGGGAATAGACCCAAGGGGATGG - Intergenic
1170969698 20:21105291-21105313 AGGAAACAACACCTTGGGGTGGG - Intergenic
1171034393 20:21704289-21704311 GAGAGCTAGACCCTTGGGGTGGG + Intergenic
1172903310 20:38350554-38350576 GGGAAATAGAACCTTGAGGAAGG - Intronic
1174140336 20:48408554-48408576 AGGAAAGAGCCCCTTGGTGGAGG - Intergenic
1177002694 21:15634201-15634223 AGGTGATATACCCCTGGGGTAGG + Intergenic
1177040551 21:16104760-16104782 AGGAAAAAGCTCCTTGGGGTTGG - Intergenic
1178604085 21:34020150-34020172 CAGGAATAGACCCTTGGGGCAGG + Intergenic
1179458283 21:41514796-41514818 AGATGATAGACCCTTGAGGTAGG + Intronic
1179520697 21:41942565-41942587 AAGAAACAGACTCTTGGGGCAGG + Intronic
1182849741 22:33462286-33462308 AGGAAAAACACCCTTCGGGATGG + Intronic
949914516 3:8948842-8948864 AGGAAACATACACTTGGGCTGGG + Intronic
951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG + Intronic
952119036 3:30219311-30219333 AGGAAATATACCCTCTGTGTGGG + Intergenic
952644990 3:35645595-35645617 AGGAAATAATTCCTTGTGGTAGG + Intronic
952735408 3:36686122-36686144 AAGAAATAGACCATTGGAATAGG + Intergenic
953578807 3:44135093-44135115 AGGGAATAGACTCTTGGGACAGG + Intergenic
956195464 3:66649825-66649847 TGGAGATAGAGCCTTGGGTTTGG - Intergenic
959606436 3:108245898-108245920 AGGTAATTGAACCATGGGGTTGG + Intergenic
960179320 3:114556240-114556262 AGGAAATGGACCCATTGGGAGGG - Intronic
961736887 3:129007636-129007658 AGGAAATAGACCCTTGGGGTTGG + Intronic
969121036 4:4911319-4911341 AGGAAACAGACCCTAAGGGCAGG - Intergenic
971341964 4:25778834-25778856 AGAAAATAGAGTCTAGGGGTGGG + Intronic
972201387 4:36717816-36717838 AGATAATATACCCTTGAGGTAGG + Intergenic
972515779 4:39809397-39809419 AGGTAATAGAATCATGGGGTTGG + Intergenic
973862945 4:55083779-55083801 AGGAACCAGCCTCTTGGGGTAGG - Intronic
977527172 4:98159544-98159566 AGGAAATATACTTTTGGGGATGG + Intergenic
977688458 4:99876144-99876166 AGCTGATATACCCTTGGGGTAGG - Intergenic
977696156 4:99968822-99968844 AGAAAACTGACCCTTGGGTTTGG - Intergenic
978062083 4:104351311-104351333 AGGACACAGAGCCTTGGGGATGG - Intergenic
978605387 4:110473961-110473983 AGATAATAGACCTTTGGGTTGGG - Intronic
982353694 4:154444096-154444118 AGGAAAGAGGCCCATGGGCTGGG - Intronic
982669365 4:158301858-158301880 ATGAAACAGACCATTAGGGTAGG - Intergenic
987745272 5:21962993-21963015 AGGAAAAAGAGGCATGGGGTAGG - Intronic
987817569 5:22922762-22922784 AGGTAATTGAATCTTGGGGTTGG - Intergenic
988374291 5:30414194-30414216 AGGAAATAGTCCTTTGTGCTTGG + Intergenic
988784025 5:34549396-34549418 AGGAATTGGAACCTTGGGGCCGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990963072 5:61415295-61415317 AGGATAAAAACCCTTGGGCTGGG + Intronic
991380915 5:66025318-66025340 AGGGAATAGAACATTGGGATTGG + Intronic
991765474 5:69973112-69973134 AGGAAAAAGAGGCATGGGGTAGG - Intergenic
991781848 5:70145045-70145067 AGGAAAAAGAGGCATGGGGTAGG + Intergenic
991844710 5:70848184-70848206 AGGAAAAAGAGGCATGGGGTAGG - Intergenic
991874291 5:71145356-71145378 AGGAAAAAGAGGCATGGGGTAGG + Intergenic
994881790 5:105507298-105507320 AGAAAATAGACCCTTGGAGCTGG - Intergenic
995204827 5:109467801-109467823 AAGAAATATACCATTGGGGCCGG + Intergenic
995325285 5:110882673-110882695 AGGAAATAAACCTTTAGGGATGG + Intergenic
998010946 5:138695182-138695204 AGGAAATAAAACCTAGTGGTTGG - Intronic
998897883 5:146819378-146819400 AGTAAATAGAACACTGGGGTGGG + Intronic
1001391946 5:171386797-171386819 AAGAAATAATGCCTTGGGGTGGG + Intergenic
1001492507 5:172165484-172165506 GGGAAATTGACCCTGGGGCTGGG + Intronic
1002083042 5:176748783-176748805 AGGAAAGACACCCTCGGGGCAGG - Intergenic
1006871904 6:37258585-37258607 AGGAAGAAGTCACTTGGGGTTGG - Intronic
1006970079 6:38034322-38034344 AGGATAAAGTCCATTGGGGTTGG + Intronic
1007524720 6:42481577-42481599 AAGAAATAGACCCTTCACGTGGG - Intergenic
1008604805 6:53130060-53130082 AGGAAATAGCCATTTGGGTTTGG + Intronic
1013414014 6:109908633-109908655 AAGAAATAGACCATTGGAGGAGG - Intergenic
1015703192 6:136058437-136058459 AGGAAATAGACACTGGAGGTGGG - Intronic
1017905467 6:158755045-158755067 CGGAAATGGACCCATGGGCTGGG + Intronic
1022602741 7:31777209-31777231 AGGAAGCAGAGACTTGGGGTTGG + Intronic
1024542151 7:50484780-50484802 AGGAAAAGGACCCTTGTGTTGGG + Intronic
1027426144 7:78063002-78063024 TGGAAATAGCACATTGGGGTTGG - Intronic
1028384111 7:90234281-90234303 AGGAAATAGCAAATTGGGGTGGG - Exonic
1028808349 7:95055014-95055036 AGGAAAAAGAACCTTGGTATAGG + Intronic
1029506989 7:100968642-100968664 AGCAATTAGACCCCTGGTGTTGG + Intergenic
1030865987 7:114702347-114702369 AGGAAATAGGGCCTTTGGGGAGG + Intergenic
1034101038 7:148450823-148450845 AGGAAGTAGTCCTTTGGGCTGGG + Intergenic
1039611602 8:38923693-38923715 GGGAAACAGACAATTGGGGTGGG + Intronic
1040418157 8:47214705-47214727 AGAAAATATACCTTTGGGGATGG - Intergenic
1041289172 8:56292626-56292648 GGTAAATAGGCCCTTGGCGTGGG + Intergenic
1043496922 8:80811785-80811807 AGGCCATAGACTCTTGGGTTGGG - Intronic
1046860652 8:119087557-119087579 AGGAAATGTATCCTTGGGATGGG - Intronic
1049287843 8:141786166-141786188 AGGAAAGAGGCCTTCGGGGTAGG + Intergenic
1049579453 8:143404735-143404757 GGGAACTGGAGCCTTGGGGTTGG - Intergenic
1050409934 9:5353203-5353225 AATAAAAAGACACTTGGGGTTGG - Intergenic
1051127780 9:13823691-13823713 AGGAAATAGGGTCTTTGGGTAGG - Intergenic
1051894335 9:21972245-21972267 AGGACATAGACATTGGGGGTGGG - Intronic
1052237300 9:26226855-26226877 AGGAAATAGGCACTAGGAGTGGG - Intergenic
1053469308 9:38334714-38334736 AGGAAATAAACCATTGGTTTGGG - Intergenic
1056292194 9:85154949-85154971 AAGAAATATACCCTTGTGGTGGG + Intergenic
1058222599 9:102320665-102320687 AGTAAATAGATCCTTTGTGTGGG - Intergenic
1058355732 9:104081750-104081772 AGGAAATATACTTTTGGGGATGG - Intergenic
1060394181 9:123304071-123304093 AGGAAACAGACCCTGGGGAAAGG + Intergenic
1188755022 X:33952222-33952244 AGGTAATTGAACCATGGGGTGGG - Intergenic
1189086434 X:38030189-38030211 AGGAAATATACTTTTGGGGAAGG - Intronic
1189846813 X:45145960-45145982 CGGAAGTAGAGGCTTGGGGTGGG + Intergenic
1192196510 X:69032339-69032361 AGGAAATGGAGCCTTGGAGAGGG - Intergenic
1192334053 X:70202747-70202769 TGGGAATAGACTCTTGGGGTGGG - Intronic
1194378162 X:93161668-93161690 ATGAAATACACCCTTAGGGATGG + Intergenic
1194997676 X:100609665-100609687 AGGAATGTGACCCTTGGGGTGGG - Intergenic
1198110518 X:133498745-133498767 AAGAACTTGACCCTTGGTGTTGG + Intergenic
1198181953 X:134219016-134219038 AGGAAATATACTTTTGGGGATGG - Intergenic
1199842013 X:151658980-151659002 AGGAAAAAGAGCATTGGGTTTGG + Intronic
1200096469 X:153666587-153666609 AGGAAAGAGAACCCTGGGCTGGG - Intergenic