ID: 961737020

View in Genome Browser
Species Human (GRCh38)
Location 3:129008758-129008780
Sequence GAGTCTTCCCCAGCTCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961737020_961737023 -10 Left 961737020 3:129008758-129008780 CCTCCTAGAGCTGGGGAAGACTC 0: 1
1: 0
2: 1
3: 11
4: 287
Right 961737023 3:129008771-129008793 GGGAAGACTCAGGTACTCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 150
961737020_961737026 11 Left 961737020 3:129008758-129008780 CCTCCTAGAGCTGGGGAAGACTC 0: 1
1: 0
2: 1
3: 11
4: 287
Right 961737026 3:129008792-129008814 GGCCCAGCCCCTGCCTGCTGAGG 0: 1
1: 1
2: 14
3: 82
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961737020 Original CRISPR GAGTCTTCCCCAGCTCTAGG AGG (reversed) Intronic
902332304 1:15736560-15736582 GCGTCTTCACCACCTCCAGGGGG - Exonic
903373676 1:22852704-22852726 GTGTGTTCCCCAGTTGTAGGGGG - Intronic
904430156 1:30459204-30459226 GAGCCTACCGCAGCTCAAGGAGG - Intergenic
905840849 1:41176769-41176791 GAGCCTACCGCAGCTCAAGGAGG + Intronic
907998057 1:59653255-59653277 GAGTCCACCACAGCTCAAGGAGG - Intronic
908452960 1:64273931-64273953 GAGCCTACCACAGCTCAAGGAGG + Intergenic
911492661 1:98589153-98589175 GAGTCCACCACAGCTCAAGGAGG + Intergenic
914198644 1:145465223-145465245 GTTTCTTCCCTGGCTCTAGGAGG + Intergenic
914477751 1:148038358-148038380 GTTTCTTCCCTGGCTCTAGGAGG + Intergenic
914863344 1:151404867-151404889 AAGTCTTCACCAGCTCTTTGAGG - Exonic
916809328 1:168291701-168291723 GCTTTTTACCCAGCTCTAGGAGG + Intronic
918311216 1:183286885-183286907 GGCTCTTCCTCAGCTCTGGGTGG - Intronic
918368389 1:183834050-183834072 GAGTCTAGGCCAGGTCTAGGTGG + Intronic
919786067 1:201259543-201259565 CAGCCTCCCCCAGCTCCAGGAGG - Intergenic
919937836 1:202266357-202266379 GTGTCTTCACCTGCTCAAGGAGG - Intronic
922164920 1:223107607-223107629 GGTTTTCCCCCAGCTCTAGGGGG - Intergenic
1063498635 10:6533127-6533149 GACTCATCCCCAGCTCTGGTGGG - Intronic
1065000865 10:21336579-21336601 GAGGCTCCACCAGCCCTAGGGGG - Intergenic
1065473058 10:26103023-26103045 GAGTCCACCACAGCTCAAGGAGG - Intronic
1073016858 10:100406835-100406857 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1073987318 10:109224114-109224136 GAGCCCACCACAGCTCTAGGAGG + Intergenic
1074771927 10:116740508-116740530 CAGTCATCTCCAGCTCAAGGTGG - Intronic
1075490795 10:122867310-122867332 GAGTCCACCACAGCTCAAGGAGG + Intronic
1075964926 10:126603219-126603241 GAGGCCTCCCCAGCCCTAAGGGG - Intronic
1076401985 10:130190645-130190667 GAGCCTTTCCAAGCTCGAGGGGG + Intergenic
1076464601 10:130670286-130670308 CTGTCCTCACCAGCTCTAGGTGG + Intergenic
1076624462 10:131812929-131812951 AAGTCTTCCCCATCCCGAGGAGG - Intergenic
1077450439 11:2639834-2639856 GAGTCCACCACAGCTCAAGGAGG - Intronic
1078166415 11:8889761-8889783 GAGTCCACCGCAGCTCAAGGAGG + Intronic
1078353802 11:10618219-10618241 TTCTCTTCCCCAGCTCAAGGTGG + Intronic
1078526278 11:12103967-12103989 GAGTCCACCCCAGCTCTAGGAGG + Intronic
1078979896 11:16520993-16521015 GAGCCTACCACAGCTCAAGGAGG + Intronic
1080596687 11:33779417-33779439 GTGGCTTCCCCAGCCCTATGGGG - Intergenic
1082122200 11:48391511-48391533 GAGACTACCGCAGCTCAAGGAGG - Intergenic
1082606351 11:55238456-55238478 GAGCCTGCCACAGCTCAAGGAGG - Intergenic
1082623926 11:55460417-55460439 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1084676155 11:70635989-70636011 GAGTCTTTCCCTGGTCCAGGTGG + Intronic
1084907403 11:72358701-72358723 GAGGCATCTCTAGCTCTAGGAGG + Intronic
1085967025 11:81539909-81539931 GAGCCTACCACAGCTCAAGGAGG - Intergenic
1086873973 11:92073039-92073061 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1087878914 11:103392122-103392144 GAGTCCACCGCAGCTCAAGGAGG - Intronic
1089365686 11:117919591-117919613 AAGTCTTCCCCAACTTCAGGGGG + Intronic
1091225867 11:133956325-133956347 GAGTTTCCCGCAGCTCTGGGAGG + Intronic
1091627698 12:2135809-2135831 GAGCCTACCACAGCTCAAGGAGG - Intronic
1093986253 12:25537216-25537238 GAGCCTACCACAGCTCAAGGAGG + Intronic
1095073848 12:37892907-37892929 GAGACTGCCACAGCTCTAGGAGG + Intergenic
1096433799 12:51571274-51571296 GAGCCTACCACAGCTCAAGGAGG - Intergenic
1097569666 12:61317237-61317259 GAGACTGCCACAGCTCAAGGAGG + Intergenic
1097652728 12:62321775-62321797 GATTATTCCCAAGCTCAAGGAGG - Intronic
1098015519 12:66100352-66100374 GAGCCCTCCACAGCTCAAGGAGG - Intergenic
1098376987 12:69826517-69826539 AGGTCTTCCCTAGCTCTAGAAGG - Intronic
1098772299 12:74567995-74568017 GAGAGTGCCCCAGCTCCAGGGGG + Intergenic
1099514830 12:83584770-83584792 GAGCCCTCCACAGCTCAAGGAGG + Intergenic
1101241479 12:102843728-102843750 CTGTCTTCTCCAGCTCCAGGGGG + Exonic
1101745866 12:107541102-107541124 GACTGTTCACCAGCTTTAGGGGG - Intronic
1102518553 12:113465563-113465585 GAGTCTTCCCCACCATTACGGGG + Intronic
1103131341 12:118471279-118471301 TAGTCTCCACCAGCTCTAGTGGG - Intergenic
1103894943 12:124266709-124266731 GGGGCTTCCCCTGCTCCAGGTGG + Intronic
1106077920 13:26476590-26476612 GAGTCATCCCCACATCCAGGCGG + Intergenic
1106220372 13:27741883-27741905 CAGTGGTCCCCAGCTCTTGGTGG - Intergenic
1107380680 13:39853899-39853921 GAGACCACCCCAGCTCAAGGAGG - Intergenic
1110275865 13:73641024-73641046 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1111306617 13:86421046-86421068 GATTATTTCCCATCTCTAGGAGG + Intergenic
1112132309 13:96537402-96537424 GAGTCTTCCTCAGGTATAGGAGG - Intronic
1112793410 13:103028856-103028878 AAGCCTTTCCCAGCTCTCGGAGG + Intergenic
1114394920 14:22349426-22349448 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1115868250 14:37772306-37772328 GAGCCTACCACAGCTCAAGGAGG - Intronic
1116351414 14:43868614-43868636 AAGTCTTCCCAAGTTCTATGGGG + Intergenic
1118251100 14:64162120-64162142 GAGTCTGCTCCAGCTCTGGAAGG + Exonic
1118415187 14:65528171-65528193 GAGTCCACCGCAGCTCAAGGAGG - Intronic
1118955276 14:70475706-70475728 GAGCCTACCACAGCTCAAGGAGG + Intergenic
1121109125 14:91300513-91300535 GAGGCTTCTCCAGCCCTTGGAGG - Intronic
1121394221 14:93604919-93604941 CAGTCTGCTCCAGCTCTCGGTGG + Intronic
1125401561 15:39310005-39310027 GAGTCCTCCTCAGTTCGAGGTGG - Intergenic
1125472344 15:40016450-40016472 GAGTCTTCCCCTGCTGTGGATGG + Intronic
1127527078 15:59803858-59803880 GAGTCCACCGCAGCTCAAGGAGG + Intergenic
1129556246 15:76512927-76512949 GAATCTTCCTTAGCTCCAGGTGG - Intronic
1133318535 16:4898926-4898948 GGGTCTGCCCGAGCTCCAGGCGG + Intronic
1133366584 16:5215137-5215159 GAGTCTTCCCCAGGGCCTGGAGG - Intergenic
1133730228 16:8572304-8572326 GGATTTTCCCCAGCTCTAGTAGG - Intronic
1134570315 16:15285016-15285038 GAGGATTTCCCAGCACTAGGTGG + Intergenic
1134732062 16:16471037-16471059 GAGGATTTCCCAGCACTAGGTGG - Intergenic
1134935379 16:18240926-18240948 GAGGATTTCCCAGCACTAGGTGG + Intergenic
1137017369 16:35391456-35391478 GAGTCTTCCCCAACTCTCCCAGG + Intergenic
1137395326 16:48113021-48113043 GCATCTTGCCCACCTCTAGGAGG - Intronic
1140529907 16:75656261-75656283 GAGTCTTCCTCAGGTGTGGGTGG - Exonic
1141642393 16:85348881-85348903 GACTCTCCCCCATCTCTCGGGGG - Intergenic
1143571245 17:7760046-7760068 GAGTTTTCCCCAGGTCAGGGAGG - Intronic
1143776318 17:9201506-9201528 GACTGTTCCCCAGCTCTAGCAGG + Intronic
1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG + Exonic
1146732314 17:35204432-35204454 GAGCCCACCCCAGCTCAAGGAGG - Intergenic
1147789804 17:43006702-43006724 GAGGCTTCCCCACCCCTGGGAGG - Intergenic
1149059841 17:52409341-52409363 GAGCCTACCACAGCTCAAGGAGG - Intergenic
1149349039 17:55768821-55768843 GAGGCTACTCCAGCTCTAAGTGG - Intronic
1149858782 17:60108638-60108660 GATTCTTTCCCAAATCTAGGAGG + Intergenic
1150113159 17:62520097-62520119 AATGCTACCCCAGCTCTAGGAGG + Intronic
1152803672 17:82344389-82344411 GATTCTTCCTCAGCCCCAGGTGG + Intergenic
1153402392 18:4695168-4695190 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1153727022 18:7966945-7966967 GAGCCCACCACAGCTCTAGGAGG + Intronic
1153735508 18:8062960-8062982 GAGCCCACCACAGCTCTAGGAGG - Intronic
1154320648 18:13348694-13348716 GAGCCTACCGCAGCTCAAGGAGG - Intronic
1156301595 18:35841116-35841138 CAGTCTTCCCGAGCACTGGGGGG - Intergenic
1159143484 18:64424775-64424797 GAGTCCACCGCAGCTCAAGGAGG + Intergenic
1159242340 18:65758403-65758425 GACTCTTCCCCTGCTATAGAGGG + Intronic
1161793791 19:6375317-6375339 GCGGCTGCCCCAGCTCTCGGCGG - Exonic
1164165647 19:22672184-22672206 GAGCCTACCACAGCTCAAGGAGG + Intergenic
1164340685 19:24394541-24394563 GAGCCCTCCACAGCTCAAGGAGG + Intergenic
1166570970 19:43797246-43797268 GAGCCTGTCGCAGCTCTAGGAGG - Exonic
926052917 2:9756208-9756230 CAGGCCTCCCCAGCTCTGGGTGG - Intergenic
926893607 2:17660194-17660216 GGGTATTCCACAGCTCAAGGCGG + Intergenic
928522703 2:32106083-32106105 GAGTCCACCACAGCTCAAGGAGG - Intronic
929274819 2:40014094-40014116 GAGTCCACCACAGCTCAAGGAGG - Intergenic
929295124 2:40238107-40238129 GAGTCCACCACAGCTCAAGGAGG - Intronic
929843915 2:45501808-45501830 GAGTCCACCGCAGCTCAAGGAGG + Intronic
930166812 2:48211141-48211163 GAGTCTGGCCCAGCTGTAGGAGG - Intergenic
930835956 2:55793736-55793758 GAGCCTACCACAGCTCAAGGAGG - Intergenic
931012240 2:57930017-57930039 CACTCTTCCCCAGCCCCAGGTGG - Intronic
932660509 2:73647825-73647847 GAGCCTACCGCAGCTCAAGGAGG - Intergenic
932935391 2:76096279-76096301 GAGCCTACCACAGCTCAAGGAGG - Intergenic
937064043 2:119003956-119003978 GAGCCCACCCCAGCTCAAGGAGG - Intergenic
937632923 2:124123422-124123444 GAGTCCACCGCAGCTCAAGGAGG + Intronic
938174095 2:129108238-129108260 GGGTGTTCACCAGCTCTAGCGGG + Intergenic
939866983 2:147483635-147483657 GACTCTAACCCAGCTGTAGGTGG - Intergenic
940891604 2:159041414-159041436 GAGTCCACCGCAGCTCAAGGAGG - Intronic
944912590 2:204325004-204325026 GAGTTTTCCTTGGCTCTAGGGGG - Intergenic
948315117 2:237022633-237022655 GTGGCTTCTCCAGCTCTAGGTGG - Intergenic
1171114905 20:22516837-22516859 GACTCGTCCCAAGCTCTAAGAGG - Intergenic
1171772145 20:29330989-29331011 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1173389570 20:42620443-42620465 GAGCCCACCACAGCTCTAGGAGG - Intronic
1173865378 20:46309227-46309249 GAGACTTCTCCAGGTCAAGGTGG - Intergenic
1174136415 20:48383022-48383044 CAGTCTTCCCCATCTCTAAATGG - Intergenic
1174354308 20:49988100-49988122 CAGCCTTCCCCAGCTCCAGCAGG + Exonic
1174728777 20:52893227-52893249 GACTCTTCCCCAGATCCAGGGGG - Intergenic
1175356627 20:58374104-58374126 GAGTCCTCCCCAGATCCAAGAGG + Intergenic
1175418447 20:58816574-58816596 GAGACTCCGCCAGCTCTAGCAGG + Intergenic
1175553417 20:59831497-59831519 GTGGCTTCCCCAGCTCCAGGCGG + Intronic
1181483573 22:23216962-23216984 AAGTCTTGCCCAGATCTAAGCGG + Intronic
1181577767 22:23806416-23806438 AACTCTTCCTCAGCTCTGGGTGG + Intronic
1181800438 22:25344477-25344499 GAGTCCACCGCAGCTCAAGGAGG - Intergenic
1183614436 22:38934838-38934860 AAGTATTCACCATCTCTAGGTGG - Intergenic
1184690956 22:46117043-46117065 GAGTCTTCCCAGGCTCAGGGTGG - Intergenic
952073745 3:29670769-29670791 GAGCCCACCCCAGCTCAAGGAGG + Intronic
953080303 3:39610328-39610350 GAGTCTTATCCGGCTTTAGGAGG - Intergenic
955075532 3:55609629-55609651 GAGCCTACCCAAGCTGTAGGTGG - Intronic
955918904 3:63934142-63934164 CAGACTTCCCCAGCTCCTGGAGG - Intronic
955957842 3:64308812-64308834 GAGTCTTCCCCAGGACTATTTGG + Intronic
957101813 3:75837388-75837410 GAGCCCACCACAGCTCTAGGAGG - Intergenic
957583879 3:82110516-82110538 GAGCCTACCACAGCTCAAGGAGG - Intergenic
958205678 3:90387931-90387953 GAGCCTACCACAGCTCAAGGAGG - Intergenic
958210550 3:90468500-90468522 GAGCCCACCCCAGCTCAAGGAGG - Intergenic
959724906 3:109532612-109532634 CACTCATCCCCAGCTCTAGCTGG - Intergenic
961133271 3:124488324-124488346 GAGGCTTCCCCAGTGCTGGGAGG - Intronic
961737020 3:129008758-129008780 GAGTCTTCCCCAGCTCTAGGAGG - Intronic
962045941 3:131759066-131759088 GAATCTTGCCCAGCCCTAGTAGG + Intronic
962366541 3:134789658-134789680 GAGTCTTTCCCTTCTCAAGGAGG - Intronic
962664378 3:137639211-137639233 GAGTCCACCACAGCTCAAGGAGG - Intergenic
963175230 3:142290707-142290729 GAGCCCTCCACAGCTCAAGGAGG + Intergenic
963435195 3:145258111-145258133 GAGCCCTCCACAGCTCAAGGAGG - Intergenic
963658061 3:148084868-148084890 GAGTCTTCTCCAGGTTTTGGCGG - Intergenic
964149472 3:153506906-153506928 GAGTCCACCACAGCTCAAGGTGG + Intergenic
964286579 3:155124921-155124943 GAGTCCACCACAGCTCAAGGAGG - Intronic
964688460 3:159423571-159423593 GAGTCCACCACAGCTCAAGGAGG + Intronic
965161584 3:165140000-165140022 GAGTCCACCGCAGCTCAAGGAGG - Intergenic
966361281 3:179132340-179132362 GAGCCTGCCACAGCTCAAGGAGG - Intergenic
967022679 3:185536257-185536279 AAGTCATCCCCAGCTCCAAGTGG + Intronic
967397308 3:189022730-189022752 GAGCCTGCCACAGCTCAAGGAGG - Intronic
967586799 3:191222973-191222995 GAGGCTTCCCCAGCCCTGTGGGG + Intronic
969930488 4:10626170-10626192 GCCACTTCCCCAGCTCTATGGGG - Intronic
970982995 4:22123515-22123537 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
972716162 4:41648452-41648474 GAGTAATCTCCAGCTCTAAGAGG - Intronic
972888121 4:43518522-43518544 AAGTCTTCCCCAGCTCTTAGGGG - Intergenic
974253500 4:59420166-59420188 GAGTCCACCACAGCTCAAGGAGG + Intergenic
974937029 4:68420697-68420719 GAGCCTACCACAGCTCAAGGAGG + Intergenic
976574755 4:86656847-86656869 GAGCCCACCCCAGCTCAAGGAGG - Intronic
977497904 4:97800804-97800826 GAGTCCACCACAGCTCAAGGAGG - Intronic
977617146 4:99099476-99099498 GAGCCTACCGCAGCTCAAGGAGG - Intergenic
977897403 4:102380374-102380396 GAGCCTACCACAGCTCAAGGAGG - Intronic
978186329 4:105860625-105860647 GAGACTACCGCAGCTCAAGGAGG + Intronic
978216699 4:106213857-106213879 GAGCCTACCACAGCTCAAGGAGG + Intronic
979964090 4:127056219-127056241 GAGTCTTCCCCAGGCCTATCTGG + Intergenic
981299117 4:143166965-143166987 GAGCCTACCGCAGCTCAAGGAGG + Intergenic
981687540 4:147471422-147471444 GAGCCTACCACAGCTCAAGGAGG - Intergenic
982657159 4:158164045-158164067 GAACCTTCCCAAGCTCAAGGAGG - Intronic
984300724 4:177913562-177913584 GGGTCTTCCCAAGTTCTAGCGGG + Intronic
984934757 4:184880493-184880515 GATTCTTCCCCAGGTCTATGAGG + Intergenic
988840168 5:35075556-35075578 GAGCCCACCCCAGCTCAAGGAGG + Intronic
989860662 5:46371871-46371893 GAGTCCACCACAGCTCAAGGAGG + Intergenic
990239591 5:53803290-53803312 GAGCCTGCCACAGCTCAAGGAGG + Intergenic
991610716 5:68447077-68447099 CAGTATTCCTAAGCTCTAGGAGG - Intergenic
992707100 5:79407214-79407236 GAGTCATACCCATTTCTAGGAGG + Intronic
994969653 5:106719365-106719387 GAGTCCACCACAGCTCAAGGAGG - Intergenic
995343910 5:111090385-111090407 GAGTCCACCACAGCTCAAGGAGG - Intergenic
995423328 5:111991590-111991612 GAGTCCACCACAGCTCAAGGAGG - Intronic
995690355 5:114818905-114818927 GAGCCTACCGCAGCTCAAGGAGG - Intergenic
996116299 5:119624008-119624030 ACTTCATCCCCAGCTCTAGGTGG - Intronic
996455840 5:123680179-123680201 GAGTCCACCACAGCTCAAGGAGG - Intergenic
996477893 5:123941883-123941905 GAGTCCACCACAGCTCAAGGAGG + Intergenic
998135113 5:139670339-139670361 GAATCTGTCCCAGCTCTAAGGGG - Intronic
998600435 5:143579724-143579746 CAGTCTCCCCAAGGTCTAGGGGG + Intergenic
999091742 5:148942023-148942045 GAGTGCTCTCCAGCTGTAGGGGG + Intronic
999570959 5:152919304-152919326 GAGCCTACCGCAGCTCAAGGAGG - Intergenic
999762565 5:154713822-154713844 GAGTTTACCCCACCTCTAGCTGG + Intronic
999814572 5:155163223-155163245 GAGTCCACCACAGCTCAAGGAGG - Intergenic
1000544195 5:162578537-162578559 GAGGCTACCACAGCTCAAGGAGG + Intergenic
1000647946 5:163781130-163781152 GAGCCTACCGCAGCTCAAGGAGG + Intergenic
1000747000 5:165046065-165046087 GAGCCTACCGCAGCTCAAGGAGG - Intergenic
1000795441 5:165658878-165658900 GTGTTTTCCCCAGCTTTAGAAGG + Intergenic
1001639858 5:173236537-173236559 CTGTCATCCCCAGCTCTAGAAGG - Intergenic
1001675617 5:173512276-173512298 AAGTCTTCCCCATCTCAAGAAGG + Intergenic
1002055575 5:176596472-176596494 GAGCCTGCCCCAGCTCTCAGGGG + Exonic
1005747156 6:28848931-28848953 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1006255418 6:32828902-32828924 GAAGCTTGCCCAGCTCTAGGAGG - Intronic
1007599783 6:43074745-43074767 GGCTCTTCCCCACCCCTAGGTGG + Exonic
1007787219 6:44287524-44287546 GAGTCTGTCCCTGCTTTAGGTGG - Intronic
1008978599 6:57457410-57457432 GAGCCCTCCACAGCTCAAGGAGG - Intronic
1010271233 6:73918016-73918038 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1010530241 6:76959476-76959498 GAGCCTACCACAGCTCAAGGAGG + Intergenic
1011181530 6:84626855-84626877 GAGCCCACCACAGCTCTAGGAGG + Intergenic
1011187982 6:84699839-84699861 GAGTCCACCACAGCTCAAGGAGG + Intronic
1011291068 6:85778312-85778334 CTTTCTTCCCCAGCTCCAGGTGG - Intergenic
1013704228 6:112813524-112813546 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1014928703 6:127306853-127306875 GTGTATTCTCCAGCTCTTGGAGG - Intronic
1015114716 6:129635349-129635371 GGGTTTTCCCCATCTCTAAGTGG - Intronic
1016054504 6:139565474-139565496 GTGTTTCCCCCAGCCCTAGGTGG + Intergenic
1017275820 6:152566712-152566734 GAGTCAGGCCAAGCTCTAGGTGG - Intronic
1018215971 6:161528290-161528312 GAGTCTTCCATAGCTGTAGTGGG + Intronic
1018749335 6:166789377-166789399 GAGTCCACCACAGCTCAAGGAGG + Intronic
1019378260 7:707790-707812 GTGTCTCCCCCAGCTCCGGGTGG - Intronic
1019378288 7:707905-707927 GTGTCTCCCCCGGCTCCAGGTGG - Intronic
1021464927 7:20931653-20931675 AAGTCTGGCTCAGCTCTAGGAGG - Intergenic
1023559917 7:41463043-41463065 GAGTCTTCCCAAGCTCACTGTGG - Intergenic
1027557513 7:79684909-79684931 TGGTCTTCCTAAGCTCTAGGTGG - Intergenic
1028234838 7:88347878-88347900 GACTCTTGCCCAGCTCAATGAGG + Intergenic
1029829858 7:103245101-103245123 GAGCCTCCCGCAGCTCAAGGAGG + Intergenic
1030342178 7:108393188-108393210 GAGTCCACCTCAGCTCAAGGAGG - Intronic
1030592618 7:111500324-111500346 GAGACTACCACAGCTCAAGGAGG + Intronic
1032004827 7:128292516-128292538 GAGCCTACCACAGCTCAAGGAGG + Intergenic
1032042373 7:128574034-128574056 AATGCTACCCCAGCTCTAGGAGG + Intergenic
1032191924 7:129770493-129770515 GAGGCCTCCCCAGCTCCTGGGGG - Intergenic
1032463465 7:132128593-132128615 GTGTCTGCCCCAGGTGTAGGCGG - Exonic
1033844115 7:145411817-145411839 GAGGCTTCCTCAGCTCTATGTGG - Intergenic
1034201503 7:149285586-149285608 GAGCCCTCCCCAGTTCCAGGAGG - Intronic
1034369226 7:150580096-150580118 GAGCCCACCACAGCTCTAGGAGG - Intergenic
1034379548 7:150678861-150678883 GAGCCCACCACAGCTCTAGGAGG + Intergenic
1034382152 7:150706741-150706763 GAGCCCACCACAGCTCTAGGAGG + Intergenic
1034872320 7:154695622-154695644 GAGTCTGCCCCATCTCCTGGAGG - Intronic
1035935584 8:3834415-3834437 GAGTCTGCCCCACTTCCAGGGGG - Intronic
1036134443 8:6147177-6147199 GCCTCTTCCCCAGCTTTTGGTGG - Intergenic
1037545415 8:19915623-19915645 GAGTCCACCACAGCTCAAGGAGG - Intronic
1040749907 8:50692873-50692895 GAGCCTACCACAGCTCAAGGAGG - Intronic
1041295859 8:56356824-56356846 GAGTCCACCACAGCTCAAGGAGG - Intergenic
1041357677 8:57017812-57017834 TAACCTTCCCCAGCTCAAGGAGG - Intergenic
1042686917 8:71452288-71452310 GAGTCCACCACAGCTCAAGGAGG + Intronic
1043219686 8:77644956-77644978 GAGTCTTGCCCAGCTTCATGGGG - Intergenic
1044082914 8:87907211-87907233 GAGTCATTCCCAGCTCCAAGAGG - Intergenic
1044284821 8:90399006-90399028 GAGCCCTCCACAGCTCAAGGAGG - Intergenic
1044548305 8:93483745-93483767 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1045788720 8:105956174-105956196 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1049836437 8:144738503-144738525 GGGTCTTCCCAAACTCCAGGAGG + Intronic
1050478252 9:6063276-6063298 GAGCCTACCACAGCTCAAGGAGG - Intergenic
1050796229 9:9547013-9547035 TAGTCTTCCCCTGCTCTATTAGG - Intronic
1050824724 9:9931716-9931738 GAGTCCACCACAGCTCAAGGAGG + Intronic
1052696806 9:31888772-31888794 GAGTCCACCGCAGCTCAAGGAGG - Intergenic
1052701017 9:31937850-31937872 GAGTCCACCACAGCTCAAGGAGG - Intergenic
1055617111 9:78084092-78084114 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1056909635 9:90686777-90686799 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1057329308 9:94097937-94097959 GAGTCTCCCCTTGCTCCAGGAGG - Exonic
1058455214 9:105132237-105132259 GGATCTTCCCCAGTTCTAGAAGG - Intergenic
1061058364 9:128237043-128237065 GTGTCTTCACCAGTTCTAAGAGG + Intronic
1061290891 9:129649754-129649776 GAGCCTGCCCCAGCTCTGGCTGG + Intergenic
1061512588 9:131070036-131070058 GGCCCTTCCCCTGCTCTAGGTGG + Intronic
1062360055 9:136183354-136183376 GATTCTCCCCCAGCCCTTGGAGG - Intergenic
1062482129 9:136757407-136757429 GACTGTTCCGCAGCTCTAGATGG - Intronic
1188219777 X:27527147-27527169 GAGTCCACCACAGCTCAAGGAGG - Intergenic
1188461243 X:30429719-30429741 GAGCCTGCCGCAGCTCAAGGAGG + Intergenic
1190230394 X:48577381-48577403 GCATCTTCATCAGCTCTAGGAGG + Intronic
1191144537 X:57152392-57152414 GAGCCTGCCACAGCTCAAGGAGG - Intergenic
1191636572 X:63384291-63384313 GTGTGTTCCCCAGTTGTAGGGGG - Intergenic
1191827282 X:65379097-65379119 GAGCCTGCCACAGCTCAAGGAGG + Intronic
1192333689 X:70200245-70200267 GAGTCTTCACCAGCTGTTAGAGG - Exonic
1193622373 X:83771922-83771944 GAGTCTTCCCCAGGTCCATCTGG - Intergenic
1193780154 X:85691501-85691523 GAGACTTCCTCATCTCTATGCGG + Intergenic
1193840291 X:86401001-86401023 GAGTCCACCACAGCTCAAGGAGG - Intronic
1197953251 X:131919799-131919821 CACTCTACCCCAGCTCCAGGAGG + Intergenic
1197963681 X:132033253-132033275 GAAACTTTCCCAGCTCTAGTGGG - Intergenic
1198474489 X:136982746-136982768 GAGCCTACCACAGCTCAAGGAGG - Intergenic
1198485177 X:137080350-137080372 GAGTCCACCACAGCTCAAGGAGG - Intergenic
1198615689 X:138456349-138456371 GAGACCACCCCAGCTCAAGGAGG + Intergenic
1200163477 X:154020521-154020543 GGGTCTTCCCCATCTCAGGGCGG - Intergenic
1200378496 X:155809275-155809297 GAGCCCACCTCAGCTCTAGGAGG + Intergenic
1200740940 Y:6852929-6852951 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1201431757 Y:13909766-13909788 GAGTCCACCACAGCTCAAGGAGG + Intergenic
1201684314 Y:16683709-16683731 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1201915100 Y:19173000-19173022 GAGTCTACTGCAGCTCAAGGAGG + Intergenic
1202170800 Y:22041427-22041449 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1202220563 Y:22544946-22544968 GAGCCCACCCCAGCTCAAGGAGG - Intergenic
1202322550 Y:23650717-23650739 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1202356698 Y:24059130-24059152 GAGCCCACCCCAGCTCAAGGAGG + Intergenic
1202514080 Y:25610980-25611002 GAGCCCACCCCAGCTCAAGGAGG - Intergenic
1202548223 Y:26019339-26019361 GAGCCCACCCCAGCTCAAGGAGG - Intergenic