ID: 961738286

View in Genome Browser
Species Human (GRCh38)
Location 3:129015783-129015805
Sequence CAGGAAGAACAGCTTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961738286_961738291 23 Left 961738286 3:129015783-129015805 CCTACCCCAAGCTGTTCTTCCTG 0: 1
1: 0
2: 2
3: 39
4: 356
Right 961738291 3:129015829-129015851 GTTGCTCTCTGTTTCCTGTAAGG 0: 1
1: 0
2: 0
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961738286 Original CRISPR CAGGAAGAACAGCTTGGGGT AGG (reversed) Intronic
901202241 1:7473337-7473359 TAGGAGGAACAGCTGGGGCTGGG + Intronic
901377489 1:8849579-8849601 CAAGAAGGACAGCTGGGGGTGGG + Intergenic
901532529 1:9862601-9862623 AAGGCATGACAGCTTGGGGTCGG - Intronic
901794859 1:11674347-11674369 CAGTAAAACCAGCCTGGGGTTGG + Exonic
902370631 1:16004736-16004758 AAGCAAGACCAGCTGGGGGTGGG + Intronic
902482222 1:16718001-16718023 CAGGAAGAGCAGCTGGGAATTGG - Intergenic
903222276 1:21875590-21875612 CAGGAGGACCAGCATGGGCTTGG - Intronic
903437249 1:23359847-23359869 CAGCAGGAACTGGTTGGGGTGGG + Exonic
904277916 1:29396244-29396266 CAGGCAGAACTGCATTGGGTGGG - Intergenic
904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG + Intronic
905653060 1:39669246-39669268 CAGGAAGTCCAGGTGGGGGTGGG - Intronic
906407778 1:45555706-45555728 CAGAAAGAAGAGCATGGGTTAGG + Intronic
906959087 1:50404706-50404728 CAGGAAGTAGAGGTTGTGGTGGG - Intergenic
906968390 1:50483884-50483906 CAGAAAGAGCAGGTTTGGGTGGG + Intronic
907067027 1:51494275-51494297 CTGGAAGAAGAGGTTGTGGTTGG - Intronic
908400617 1:63769825-63769847 CAGGAGGAAGAGCTTGCAGTAGG - Intergenic
909179078 1:72397807-72397829 AAGGAAGAAAAGCTGGGTGTGGG + Intergenic
910665819 1:89725051-89725073 CAGGAGGAACATTTAGGGGTTGG + Intronic
910850895 1:91649120-91649142 GAGGGAGCATAGCTTGGGGTAGG - Intergenic
912694544 1:111831407-111831429 CAGGAGGAAGAGGTTGGGGGAGG - Intronic
912863188 1:113233120-113233142 CAGCAAGTACAGATTGGAGTTGG + Intergenic
913320058 1:117581828-117581850 GAGGAAGAACAGCTAGCAGTGGG - Intergenic
913380969 1:118209762-118209784 GAAGAAGAACACCCTGGGGTGGG + Intergenic
915324448 1:155073706-155073728 GAAGAAGAACAGGTTGGGGGAGG - Intergenic
915330378 1:155108100-155108122 CAGGAAGGACAGCTTGGTGATGG - Intergenic
916798869 1:168195298-168195320 CAGAAAGAACAGCTAGAGATGGG - Intronic
917112929 1:171570080-171570102 CAGAAAGATCAGTTTGGGTTAGG + Intronic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917500298 1:175579359-175579381 CAGGAAGACAAGCTTGCTGTGGG + Intronic
918802635 1:188991433-188991455 CTGGAAGACCAGCTGGTGGTTGG - Intergenic
918877361 1:190065345-190065367 CAGGAATATCAGCTTGTGGAAGG - Intergenic
918958852 1:191244820-191244842 CAGGAAGAATAGCTAACGGTTGG - Intergenic
919853654 1:201691007-201691029 CAGGAAGTGAAGCTTGGGGAGGG + Intronic
920443108 1:205994510-205994532 CAGGAAGAAGAGATGGGGGTGGG + Intronic
920653816 1:207859787-207859809 CAGGAAGAACATATTGGGGAGGG + Intergenic
920938544 1:210458700-210458722 CAGGAAAAATAGATTGGGCTTGG + Intronic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
922782996 1:228268458-228268480 CAGGAAGACCACCCTAGGGTAGG - Intronic
922881368 1:228983532-228983554 AAGGAAACACAGCCTGGGGTTGG - Intergenic
923018341 1:230144126-230144148 GAGGCAGAGCAGGTTGGGGTAGG + Intronic
924071073 1:240279389-240279411 AAGGAGGAAGAGGTTGGGGTTGG + Intronic
1062936603 10:1395196-1395218 CAGAAAGAACAGATTAGGCTTGG - Intronic
1063478583 10:6350283-6350305 CAGGAAGAAGAGGCTGAGGTAGG - Intergenic
1063555765 10:7078115-7078137 CATGATGAACAACTTGGGTTTGG + Intergenic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1063947024 10:11187576-11187598 AGGGAAGAACAGGTTGGGGGGGG - Intronic
1067098084 10:43315414-43315436 CAGCAAGAACGGCATGGTGTCGG + Intergenic
1067323951 10:45248744-45248766 CAGGGAGAACAGTTTTGGGAGGG - Intergenic
1067822443 10:49541731-49541753 CAGGAAGAACCCCTTGGGTGGGG - Intergenic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1069733384 10:70634139-70634161 CAGGATGAACAGTTTAGGATTGG + Intergenic
1069743488 10:70700264-70700286 CAGGAAGGACAGTGTGGGGAGGG - Intronic
1070130869 10:73654518-73654540 TGGGAAGAACTGCATGGGGTAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070708301 10:78657580-78657602 CAGGAGGAACTCGTTGGGGTGGG + Intergenic
1070744750 10:78927030-78927052 CATGAACAAAGGCTTGGGGTGGG - Intergenic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1071152423 10:82651220-82651242 CAGGAAGACCACTTTAGGGTGGG + Intronic
1071349314 10:84723643-84723665 CAGGTAAAACAACTTGGGGCGGG + Intergenic
1072698015 10:97618500-97618522 CAGGAAGAAATGCCTGGGATTGG - Intronic
1073150059 10:101305392-101305414 CAAGAAGAACGGCTTGGGCAAGG + Intergenic
1073475344 10:103748929-103748951 CAGGAAGAAGGGCTTCGGGCAGG - Intronic
1073641919 10:105261671-105261693 AAGGCAGACTAGCTTGGGGTTGG - Intronic
1073878937 10:107957695-107957717 CCCAAAGAACAGCTTGAGGTTGG - Intergenic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1076495684 10:130896089-130896111 CTGGAAGAACTGCATGGGTTGGG + Intergenic
1076560364 10:131359125-131359147 CAGGAAGAGCAGTGTGGGGAGGG - Intergenic
1077044256 11:537512-537534 CCGGAAGAACAGCCTGGAGTAGG + Exonic
1078001374 11:7499361-7499383 CAGGAAGAAAAGGTTGAGGAAGG - Intronic
1078454640 11:11465538-11465560 CAGGAAGCACAGCTTAGGAAGGG + Intronic
1080102181 11:28472385-28472407 CAGGAAGGCCACCTTGGTGTTGG + Intergenic
1081536777 11:44002313-44002335 CAGGTAGGCCAGCTCGGGGTGGG - Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1084090917 11:66878971-66878993 CAGGATGACCTGCTTAGGGTGGG - Intronic
1084153770 11:67303109-67303131 CAGGGAGAAATGTTTGGGGTGGG + Intergenic
1084524816 11:69689913-69689935 CAGCAAGAAAAGGTGGGGGTGGG - Intergenic
1084557677 11:69884540-69884562 CAGGAAGAAATGTTTAGGGTGGG + Intergenic
1086415146 11:86581701-86581723 CAGGAAGATGAGCTTGGTTTGGG - Intronic
1086857310 11:91880385-91880407 CTGGAAGGACAGCTTTGGGATGG - Intergenic
1087357820 11:97117106-97117128 TAGGTAGAACAGATGGGGGTGGG + Intergenic
1087996482 11:104815815-104815837 AAAGAAAAAAAGCTTGGGGTGGG + Intergenic
1088685873 11:112284293-112284315 CAGGTGGATCACCTTGGGGTCGG - Intergenic
1088813179 11:113405123-113405145 CAGGAAGAAGGGCCTGGGGTTGG - Intergenic
1088913779 11:114211756-114211778 CAGGAAGGCCAGCTTGCAGTGGG + Intronic
1090976655 11:131685234-131685256 CAGGAAGGACTGACTGGGGTTGG - Intronic
1091829200 12:3537603-3537625 CAGGCAGAGCAGGTTGGGGTGGG - Intronic
1091857908 12:3753755-3753777 CATGAAGAACAGCTGGTGTTTGG - Intronic
1092063211 12:5567350-5567372 GAATAAGAACATCTTGGGGTGGG + Intronic
1093088982 12:14900516-14900538 CAGGGAAATCAGCTAGGGGTCGG + Intronic
1093778016 12:23099897-23099919 CAGGAAGAACAGTGTGGTATGGG + Intergenic
1094541826 12:31369207-31369229 CCGGAACAACGGCTGGGGGTGGG - Intergenic
1097864159 12:64545145-64545167 CAGGAAAAAAAGCTTGGATTGGG + Intergenic
1099093275 12:78340134-78340156 CAGAAAGAACACCTGGGGGCCGG + Intergenic
1099775457 12:87122183-87122205 CAGGAAGGCCAGTTTGGGGAAGG + Intergenic
1101327712 12:103731128-103731150 CAGCCAGAACAGCCTGGTGTTGG - Intronic
1102639971 12:114358443-114358465 CAGGTAGAGTAGCTTGGGTTTGG + Intronic
1104662329 12:130620306-130620328 CAGGATGACCCGCCTGGGGTGGG - Intronic
1105024448 12:132838956-132838978 CAGTCGGAACAGCTTGGGTTTGG - Intronic
1105723134 13:23135612-23135634 CAAGAAGAGCATCTTGGGGGAGG - Intergenic
1106632045 13:31484696-31484718 CACAAAGAACAGAGTGGGGTGGG - Intergenic
1107002302 13:35562541-35562563 CAGGAGAAAAAGGTTGGGGTTGG - Intronic
1108236507 13:48413157-48413179 CAGGAAGAAGAGGCTGGGTTTGG + Intronic
1108459445 13:50650552-50650574 AATGAAAAACAGATTGGGGTTGG + Intronic
1108474086 13:50796429-50796451 GAGGATGAACGTCTTGGGGTGGG + Intronic
1108957293 13:56175717-56175739 CAGGATAAACAGCTTAGGATTGG + Intergenic
1109595861 13:64552646-64552668 CAGGGAAAACAGCTTAGGATTGG + Intergenic
1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG + Intergenic
1113346414 13:109482635-109482657 CAGGAAGAGAATCTTGGGTTTGG - Intergenic
1113652115 13:112041137-112041159 CAGGCAGCACAGCTTGGTGAGGG - Intergenic
1113901260 13:113799468-113799490 CAGGGAAAACCGCGTGGGGTCGG - Intronic
1114733866 14:25022917-25022939 GAGGAAGGCCAGCTTTGGGTAGG - Intronic
1114811097 14:25900583-25900605 CAGGAAGTAGAGGTAGGGGTAGG + Intergenic
1115745295 14:36430340-36430362 CAGGAAGAATAGCATGGAGATGG + Intergenic
1119400413 14:74358741-74358763 CTGCAAGAACAGCTTGGCCTGGG - Exonic
1119448715 14:74689273-74689295 CAAGGAGAATAGCGTGGGGTAGG - Intronic
1119482066 14:74964100-74964122 CAGGAAGAACAGCTTAACATTGG + Intergenic
1119823310 14:77637311-77637333 CAGGAAGAAGAGGTTGCAGTGGG - Intergenic
1119833857 14:77729202-77729224 CAGGAGGAACAGGTTTGGGAGGG - Intronic
1121326553 14:93023547-93023569 GAAAAAGAAAAGCTTGGGGTAGG - Intronic
1123050538 14:105539438-105539460 CATGAAGAACTGCTTTGTGTTGG - Intergenic
1124306040 15:28579955-28579977 CAGGAGGCACAGCTTGCAGTGGG - Intergenic
1124687341 15:31793401-31793423 CAGGGAGACCAGGTTGGGGCAGG - Intronic
1125667944 15:41447096-41447118 CAAGAATAACAGCTGGGGCTGGG - Intronic
1127211344 15:56777816-56777838 CAGGCTGAAGAGCATGGGGTGGG - Intronic
1127585821 15:60376865-60376887 CAGGAAGAAGAGCTGGGAGCAGG - Intronic
1127948169 15:63776314-63776336 CAGGAGGGACAGGTTTGGGTGGG - Intronic
1128634448 15:69294155-69294177 CAGGCAGAACCCCTTGGGGCAGG - Intergenic
1129121422 15:73399147-73399169 CAGCAAGCACTGCTTGGAGTAGG + Intergenic
1131304688 15:91231582-91231604 CAGGCAGAAAAGGATGGGGTTGG - Intronic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1134604498 16:15559709-15559731 CCTGATGGACAGCTTGGGGTCGG + Intronic
1136383470 16:29908160-29908182 CAGAAAGAGCAGCCTGGGGAGGG + Intronic
1136397972 16:30003359-30003381 CAAGAAGAACCGGGTGGGGTGGG + Intronic
1137263863 16:46852814-46852836 GAGTAAGAACAGCTTAGGCTGGG - Intergenic
1138079917 16:54080897-54080919 CTGGAAGAACAGCTCGTGCTTGG + Intronic
1139429179 16:66901970-66901992 CAGCAAGATCAGCTGGGGTTGGG - Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139646980 16:68338568-68338590 GAGGAAGCACAGCCTGGGGAAGG + Intronic
1140430455 16:74898535-74898557 AAGGAAGAACGGAGTGGGGTGGG + Intronic
1141041491 16:80676358-80676380 CAGGAAGAACAGCTGGGCTCAGG + Intronic
1141330480 16:83106465-83106487 CAGGAAGCAGAGGTTGCGGTGGG + Intronic
1141429815 16:83965766-83965788 CAGGAAGGAGAGGTCGGGGTGGG - Exonic
1143172504 17:4938346-4938368 CAGTAAGAACTGCTTGGATTGGG + Exonic
1143432626 17:6898366-6898388 GAGGAAGGAGAGCTTGGGGGAGG - Intronic
1144512106 17:15886294-15886316 CAGGCAGGACAGCCTGAGGTTGG - Intergenic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1144668210 17:17116421-17116443 CAGGGAGCAGAGCTTGGGCTGGG + Intronic
1144788842 17:17846466-17846488 CAGGCAGAGCAGCTAGGGGCTGG - Intronic
1144789020 17:17847334-17847356 CAGGAAGCACTGCCTGGGGCTGG + Exonic
1144812387 17:18008790-18008812 CAGACAGACCATCTTGGGGTGGG + Intronic
1144862813 17:18316121-18316143 CACGAAGTTCAGCTTGGGGTAGG - Exonic
1145901980 17:28495458-28495480 CTTGAAGAACAGCTGGGTGTGGG - Intronic
1146643898 17:34563634-34563656 GAGGAAGACCAGGTTGGGGAGGG - Intergenic
1147219357 17:38919460-38919482 GAGGAAGCACAGCTTGGGTCAGG + Exonic
1149353742 17:55818046-55818068 GATGCAGCACAGCTTGGGGTGGG + Intronic
1151159870 17:72156403-72156425 CAGGAATGACAGCATGGTGTCGG + Intergenic
1151580079 17:74972624-74972646 CCGGAAGTTCAGCTTGGAGTCGG + Exonic
1151685512 17:75643889-75643911 CAGAGGGCACAGCTTGGGGTGGG - Intronic
1151815771 17:76470645-76470667 AAGGCAGAACAGGTAGGGGTGGG + Intergenic
1152380417 17:79939449-79939471 CAGGGAGAAAAGCTTTGAGTGGG + Exonic
1153663000 18:7342074-7342096 AAGGAAGAACAACTTTGGGAGGG + Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1156159822 18:34346217-34346239 CAGGTACAACAACTTGGAGTTGG - Intergenic
1157814564 18:50721448-50721470 CAGGAATAACAAATTGGGTTTGG - Intronic
1158848880 18:61474079-61474101 CAGGAAGACCTGCCAGGGGTGGG - Intronic
1158934076 18:62348727-62348749 CTGGCAGAACAACTTGGGGCAGG - Intronic
1160685483 19:434627-434649 CAGAAAGAAGAGCTGGAGGTAGG + Intronic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1162350805 19:10148040-10148062 CAGGAAGTAGAGGTTGCGGTGGG + Intronic
1162740564 19:12771332-12771354 CAGAAAGATGAGCTTGGGCTTGG + Intronic
1164748206 19:30631308-30631330 CGGGGAGAACAGTTTGGGGATGG + Intronic
1164934812 19:32202189-32202211 CTGGTAGAATAGCTGGGGGTTGG - Intergenic
1165067547 19:33237818-33237840 CAGGAGGAACATCTGGGTGTGGG - Intergenic
1167948697 19:53009724-53009746 CAGGAAGAGGAGGTTGAGGTGGG - Intergenic
1168570673 19:57466357-57466379 CAGGAAGAAAGGCCTGGGATCGG + Intronic
925216031 2:2096719-2096741 CAGGAAGGTGAGCTGGGGGTAGG - Intronic
925232986 2:2252412-2252434 TAGGAAGAACAGCTTGTGGTGGG - Intronic
925993145 2:9269654-9269676 GAGGAAGAGAAGCATGGGGTTGG + Intronic
926075767 2:9941774-9941796 GAGGAAGAACAGGTTTGGGGTGG - Intergenic
928317998 2:30260584-30260606 CAGGGAGAACAGCTTGGCAAGGG + Intronic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
929523217 2:42674446-42674468 CAGAGAGAACAGCTTGTGCTGGG + Intronic
929964626 2:46524965-46524987 CAGGAAGATCAGCCTGGGGGTGG + Intronic
930547768 2:52791709-52791731 CAAGAAGTACATTTTGGGGTGGG - Intergenic
931144485 2:59502263-59502285 GAGGAAAACCACCTTGGGGTTGG - Intergenic
931291751 2:60880378-60880400 TGGAAAGAACAGTTTGGGGTTGG + Intergenic
931684962 2:64784983-64785005 CAGGGAGACCAGCTTTGGGGAGG + Intergenic
932524895 2:72454761-72454783 CAGAAAGAACAGCTCTGGCTTGG + Intronic
935654902 2:105413774-105413796 GAAGAAAAACAGCTTGGGGTTGG - Intronic
936657405 2:114504531-114504553 GAGGAAGAAGAGGGTGGGGTGGG - Intronic
936666931 2:114607854-114607876 CAGAAACAATAGTTTGGGGTTGG - Intronic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
939024460 2:136995414-136995436 CAGGAAGAAGAGCTTGATCTTGG - Intronic
940007036 2:149017255-149017277 GAGGAAGCACAGCTGTGGGTGGG + Intronic
940149707 2:150585976-150585998 CAGGAAGAAGGGAGTGGGGTGGG - Intergenic
940342350 2:152594719-152594741 TGGGCAGAACAGTTTGGGGTAGG - Intronic
940491743 2:154370622-154370644 AAGGAAGAACATTTTGGGGTTGG + Intronic
940910632 2:159206539-159206561 CAGCAAGAACAGCTTGATGAAGG - Intronic
941962788 2:171270023-171270045 CAGGATGAAGTGCTGGGGGTGGG + Intergenic
942849372 2:180465711-180465733 CAAGAAGAAGAGGTTGTGGTAGG + Intergenic
944320767 2:198339362-198339384 CAGGCAGAGCAGCCTGGGTTGGG + Intronic
946328496 2:218997036-218997058 CAGGAACAGCTGCTAGGGGTGGG - Intergenic
946412156 2:219520785-219520807 CAGGCAGGTCAGGTTGGGGTGGG + Intronic
946428949 2:219614432-219614454 CAGGAAGATCAGCTAGCGGGTGG - Intronic
947021546 2:225683012-225683034 TAGGAAGAACAGAATGGGGGGGG - Intergenic
947884637 2:233557620-233557642 GAGGAAGAGCAGCTGGGGGGAGG + Intronic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
948501632 2:238398315-238398337 CAGCAGGAACAGGTTGGGGTGGG + Intronic
948883818 2:240873275-240873297 CAGGAGGGACAGCTTCTGGTGGG + Intronic
1168766904 20:388052-388074 CAGGAAGAAGCGGTTGGAGTTGG + Exonic
1169266892 20:4172431-4172453 CAGGAAGGAGAACCTGGGGTAGG + Intronic
1169424633 20:5486199-5486221 CAGGAAGAACATGGTGGGGACGG + Intergenic
1169630551 20:7626054-7626076 GAGGAGGAACGGCTAGGGGTTGG - Intergenic
1170614826 20:17940057-17940079 CAGGAGGAACAGCATCAGGTGGG - Intergenic
1171152002 20:22835486-22835508 GAGGAAGAGCAGCTTGAGCTAGG + Intergenic
1171562348 20:26136777-26136799 ACGGAAAAACAGTTTGGGGTAGG + Intergenic
1172180486 20:33000550-33000572 CAGGAAGAACAGCATGTGCTGGG + Intronic
1172436663 20:34933597-34933619 AAGGAAGGACAGCATTGGGTGGG - Intronic
1172636093 20:36410925-36410947 CAGGAAGTACAGTGTGGGGATGG - Intronic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1174048024 20:47747733-47747755 CAGGAGGAACAGATTGGGAGAGG - Intronic
1174118226 20:48242601-48242623 GAGGAAGAACAGATTGGGAGAGG - Intergenic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1175051056 20:56156012-56156034 CAGGAAGATCAGCCAGGGGATGG - Intergenic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175270017 20:57727210-57727232 CCGGAAGAACCACCTGGGGTGGG + Intergenic
1176512180 21:7757095-7757117 AAGGTAGCACAGCTTGGGCTTGG - Intronic
1178646292 21:34387619-34387641 AAGGTAGCACAGCTTGGGCTTGG - Intronic
1178836389 21:36100994-36101016 GGGCAAGAACAGCTTGGGGCTGG + Intergenic
1179783682 21:43718388-43718410 CAGGAAGACCTGGTTGGGGTGGG + Intergenic
1179835601 21:44030123-44030145 CAGGGAGAAGAGCTTGGAGCAGG + Intronic
1180593871 22:16961516-16961538 CAGGGAGGACGGCCTGGGGTGGG - Intergenic
1182426197 22:30274223-30274245 CAAAAACAACAGCTTGGGGAAGG + Intergenic
1182516725 22:30863189-30863211 CAGAGAGAAAGGCTTGGGGTGGG - Intronic
1182725106 22:32439028-32439050 CAGAAAGCACAGATTGGGCTGGG + Intronic
1183675466 22:39296882-39296904 CTGGCAGAACAGGCTGGGGTGGG - Intergenic
1183707569 22:39483846-39483868 CAGGTAGAACAATCTGGGGTAGG - Intronic
1183732798 22:39628025-39628047 CAGGGAGAAGTGCTTGGGGGTGG + Intronic
1184813694 22:46854533-46854555 CAACAAGAACAGGTGGGGGTGGG - Intronic
1185116348 22:48940421-48940443 CAGGAAGCACAGCCTGAGGCAGG + Intergenic
949136392 3:571863-571885 CAGAAAGAACTGTTTGGAGTTGG + Intergenic
949266379 3:2161402-2161424 CAGAGAGAACTGCTTGGGGTCGG + Intronic
949690056 3:6626208-6626230 CAGGAAGCAGAGGTTGTGGTGGG + Intergenic
950444824 3:13030784-13030806 CATGAAAAACAGCATGGAGTGGG + Intronic
952042948 3:29281847-29281869 CAGGAAGAAGTGATGGGGGTGGG - Intronic
952329399 3:32350202-32350224 CAGGAAGCAAAGGTTGGGGGTGG - Intronic
953223708 3:40998031-40998053 CAGGAATAAAGGCTTGGGGTTGG - Intergenic
953703009 3:45211138-45211160 CAGGAAAAACCACTTGGGGAGGG + Intergenic
953993567 3:47502480-47502502 CTGGAAGATCAGCTTGGATTGGG + Intronic
954647631 3:52141228-52141250 CAGGCAGAGCAGCATGGAGTGGG - Intronic
954817524 3:53294430-53294452 CAGGAAGAGCACCTAGGGTTAGG + Intronic
955986460 3:64578683-64578705 CAGGAAGAACAGATTTGTGGAGG - Intronic
956806926 3:72823766-72823788 CGGGAAGAAGAACTTGGGGTGGG + Intronic
957882397 3:86236645-86236667 CAGTAAGAACAGCTTACAGTGGG - Intergenic
958027005 3:88059796-88059818 CAGGAAGGTCTGTTTGGGGTAGG - Intronic
959353222 3:105295030-105295052 CAGGAAGCATACCTTCGGGTGGG - Intergenic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
962847197 3:139283039-139283061 CAGGAAGAAAAGGTTGGGGGAGG - Intronic
962962818 3:140326725-140326747 AAGGAATAAAAGCTTAGGGTCGG + Intronic
964541803 3:157787808-157787830 CAGGAGGAGCAGGTTTGGGTTGG - Intergenic
966871180 3:184291405-184291427 CACGAAGAAGAGCTGGTGGTTGG - Exonic
969095674 4:4730531-4730553 CCAGAAGAACACCATGGGGTAGG + Intergenic
969110519 4:4841363-4841385 CAGGAAGATCAGCTGGGGATTGG - Intergenic
969561322 4:7950204-7950226 CAGGAAGAGTAGCCTGGGGTGGG - Intergenic
969586309 4:8096097-8096119 CCGGAAGGATAGCGTGGGGTTGG - Intronic
970151635 4:13096470-13096492 CAGGAAGAGCATCTGGGGCTTGG - Intergenic
971532213 4:27703405-27703427 AAGGAAGAACAGTTTGCAGTGGG - Intergenic
972560014 4:40218573-40218595 CATGAGGAACAGCTTGGGAGGGG + Intronic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973623167 4:52747503-52747525 CAGGGTGAACAGCTTAGGATTGG - Intronic
974065885 4:57076676-57076698 AAGGAAGAGAAGCCTGGGGTGGG + Intronic
976011462 4:80494110-80494132 CAGGAAGAAGAGCATGGAGGTGG - Intronic
976408914 4:84690584-84690606 CGTGATGACCAGCTTGGGGTTGG + Exonic
977163394 4:93664627-93664649 CAGGAAGAATATTTTGGGGTGGG + Intronic
978622699 4:110650043-110650065 CAGGCAGACCAGCTTGAGGCCGG + Intergenic
978882921 4:113729588-113729610 CAGAAAGACCAGCTTTGGATAGG - Intronic
979734801 4:124070164-124070186 CAGGAAGAAGAGATAGAGGTAGG + Intergenic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
980828305 4:138098461-138098483 CAGGAAGGACAGCTTGCTGATGG + Intergenic
981047510 4:140278868-140278890 CAAGAAGAACAGATGGGGTTGGG - Intronic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986203235 5:5598876-5598898 CACGCAAAACAGCTGGGGGTGGG + Intergenic
987052567 5:14160196-14160218 CACGTAGAGCAGGTTGGGGTTGG + Intronic
987386570 5:17335452-17335474 CAGGGAGAACAGATTTAGGTTGG + Intergenic
988709090 5:33755638-33755660 AAGGCACAACAGCATGGGGTGGG - Intronic
988721177 5:33880858-33880880 CAGCAACATCAGTTTGGGGTTGG - Intronic
988999533 5:36745573-36745595 CAGGTGGCCCAGCTTGGGGTGGG + Intergenic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
992614550 5:78535759-78535781 CAGGGGGAACACCTTGGGGAAGG + Intronic
993706518 5:91177825-91177847 TGGGAAGAATAGCTTTGGGTGGG - Intergenic
994205055 5:97025190-97025212 CAGGAAGAACAGGCAGTGGTGGG + Intronic
994869841 5:105333777-105333799 CTAGAAGAACAGTTTGGAGTTGG - Intergenic
996026584 5:118653114-118653136 CTGAAAGAACAGTTTGGGGAAGG + Intergenic
996954179 5:129163896-129163918 GAGGCAGCACAGCTGGGGGTGGG + Intergenic
997661754 5:135594622-135594644 GAGGAAGAACAGTTAGGGTTAGG - Intergenic
999631979 5:153580772-153580794 CAGGAAGAGGAGCATGGAGTGGG + Intronic
1000029005 5:157385567-157385589 CAAGAAGAAAAACTTGGGGCTGG + Intronic
1000415056 5:160975759-160975781 CAGGAAGAAGAGCTTGTGGGAGG - Intergenic
1001052581 5:168424863-168424885 CAGAAAGAACATTTTGGTGTTGG + Intronic
1001095135 5:168770188-168770210 CAGCAAGATCAGTTTAGGGTTGG - Intronic
1003572987 6:7268174-7268196 CAGCAAGAACATATTGGGGGTGG - Intergenic
1005406806 6:25498096-25498118 CAGGAAGAAAGGCTTGGGGGAGG - Intronic
1005708626 6:28481941-28481963 CAGAAAGAACAATTAGGGGTAGG - Intergenic
1006405981 6:33845064-33845086 CAGAGAGAACACCTTGGGGCAGG + Intergenic
1006640008 6:35485005-35485027 CAGGAAGCACTGCTGGGGGCTGG - Intronic
1007174378 6:39886103-39886125 CAGGCAGCAAAGCCTGGGGTGGG + Intronic
1007314799 6:40978830-40978852 GTGGCAGCACAGCTTGGGGTGGG + Intergenic
1008166987 6:48150995-48151017 CAGAATGATCAGCCTGGGGTGGG - Intergenic
1010543719 6:77124303-77124325 CCTGAAGATCTGCTTGGGGTTGG - Intergenic
1010869935 6:81024857-81024879 CAGGAAGAGCAGCTAGGAGGGGG + Intergenic
1013270133 6:108537565-108537587 CAGGAAGAACATCTGTGAGTTGG + Intergenic
1013737975 6:113249209-113249231 GAGGAAGCACAACTTGGGGTGGG - Intergenic
1014989244 6:128053445-128053467 CAAGATGAAGAGCTTGGGGGTGG - Intronic
1017143831 6:151216199-151216221 CTGGAAGACCTGCTGGGGGTGGG - Intergenic
1017450441 6:154549871-154549893 CAGGAAGAGGAGCTTGAGGATGG + Intergenic
1019104789 6:169659537-169659559 CAGGAAGAACATGATGGGGAGGG + Intronic
1019702653 7:2481480-2481502 CAGGCAGCAGAGATTGGGGTGGG - Intergenic
1020250711 7:6466210-6466232 CAGGAAGAACAGGTAGTGGGTGG + Exonic
1021698255 7:23294061-23294083 CAGGGAGAGCAGCCTGGGGTGGG - Intergenic
1021993614 7:26159161-26159183 CAGCAAGAGCAGCTGGGGGCTGG - Intronic
1022586409 7:31617165-31617187 CAGGAAGAAAAGCCTGGAGAAGG + Intronic
1023129888 7:36992192-36992214 CAGGAAGAAATGCATGGGTTGGG - Intronic
1024099396 7:46015269-46015291 AAGGATGAACAGCGTGGTGTGGG + Intergenic
1024353751 7:48394003-48394025 TGGGGAGAACAGCTGGGGGTTGG - Intronic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1025923501 7:65937326-65937348 CAGGAAGAGCAGCTTGTAGTGGG + Intronic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1027548951 7:79567109-79567131 CCTGAAGAACAGTTAGGGGTTGG - Intergenic
1028350362 7:89839318-89839340 CAGGAAGAAAGGCTTTAGGTGGG - Intergenic
1029547808 7:101219945-101219967 CAGTAAGTACAGCATGGAGTAGG - Intronic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1030691491 7:112539516-112539538 AAAGAAGAACAGGTTTGGGTGGG - Intergenic
1031083655 7:117281640-117281662 CTGGAAGAGCAGCTTAGGGCAGG + Intronic
1031134684 7:117872869-117872891 CCGGGAGAGCAGCTTGGGGGAGG - Intronic
1031971569 7:128068536-128068558 GAAGAGGAACAGTTTGGGGTGGG + Intronic
1033226023 7:139563106-139563128 CGGGAACATCTGCTTGGGGTGGG + Exonic
1033606650 7:142932638-142932660 CAGGAAGAGCAGCTGGGGCAGGG - Intronic
1035660220 8:1342103-1342125 CAGAAAAATCAGCTGGGGGTAGG - Intergenic
1036160131 8:6380068-6380090 CAGTAAGAATAGATTGGGGTTGG + Intergenic
1037798229 8:22014831-22014853 CAGGAAGAGCAGCTTGGAAGGGG + Intergenic
1038351534 8:26780337-26780359 CAGGAAGAAAGCCTTGGTGTTGG - Intronic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1043023980 8:75044041-75044063 TATGAAGAACAGCTGGGGATAGG + Intergenic
1045709901 8:104970968-104970990 AAGGAAGAAGAGCTTGGGCCAGG + Intronic
1045924784 8:107571334-107571356 TAGGAAGAACATCACGGGGTGGG - Intergenic
1046662415 8:116962486-116962508 CAGTAAGAACAGTTTGGGGACGG - Intronic
1047219680 8:122909607-122909629 CAGGAGGAACAGGTTGTGGGGGG - Intronic
1047407288 8:124596128-124596150 GAGGAAGAGCAGGTTCGGGTTGG - Intronic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1049205621 8:141362170-141362192 GAGCAGGAACAGCTTGGGGTTGG - Intronic
1049601547 8:143510013-143510035 CAGGAGGGGCAGCTTGGGGCAGG + Intronic
1049641911 8:143719652-143719674 CAGGAGGAGCTGCTGGGGGTGGG + Intronic
1049962224 9:747798-747820 AAGTAAGACCAGCATGGGGTTGG + Intergenic
1050016499 9:1239482-1239504 CACCAAGAACTGCTTGAGGTGGG - Intergenic
1050434031 9:5590510-5590532 CAGGAACAACAGTTTGTGGATGG + Intergenic
1052450099 9:28618204-28618226 AAGGAAGACCAGGTTGGGGTTGG - Intronic
1052614755 9:30823456-30823478 AATGAAGAAAAGTTTGGGGTGGG + Intergenic
1052667535 9:31514225-31514247 CAGGAAAAACAGGTTGGGCATGG - Intergenic
1053281936 9:36826136-36826158 CATGTAGCACAGCTGGGGGTGGG - Intergenic
1054898602 9:70342491-70342513 CACAAAAAACAGCTGGGGGTGGG - Intronic
1055606632 9:77977355-77977377 AAGGAAGAAAGTCTTGGGGTAGG - Intronic
1056070310 9:82979374-82979396 CAGGTAGACCAGCTTGGGACAGG - Intergenic
1057324075 9:94044419-94044441 CAGGAAGAACAGCTAATGCTGGG - Intronic
1057916938 9:99064013-99064035 CAGGAAGAACAGCCAGGCCTGGG + Intronic
1059469544 9:114494256-114494278 CAGGAAGAGCAGCATCTGGTAGG + Intronic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1061380390 9:130253138-130253160 TAGGAGGAACGACTTGGGGTGGG + Intergenic
1062293745 9:135812285-135812307 CGAGATGAACAGCATGGGGTCGG + Intronic
1062313380 9:135952196-135952218 CAGGAAGAGCACCCTGGGCTTGG - Intronic
1186113343 X:6278528-6278550 CACGAAGACCTGCTTGTGGTTGG - Intergenic
1186604559 X:11076949-11076971 CAGGAAGAGTAGATGGGGGTGGG - Intergenic
1187728383 X:22227577-22227599 CAGGAAGAAGAGCTGGTTGTTGG - Exonic
1188474358 X:30574318-30574340 CCTGATGAACACCTTGGGGTAGG - Intronic
1190712084 X:53078579-53078601 CAGGAAGAAGAGTTGGGGGCTGG - Exonic
1190822839 X:53990420-53990442 CAAGAAGGACTGCTGGGGGTGGG + Intronic
1192587473 X:72330509-72330531 AAGGAAGAAAAGTTGGGGGTGGG - Intronic
1192948000 X:75986388-75986410 CAGGAAGAAAAGCTCTTGGTAGG + Intergenic
1193342199 X:80362235-80362257 CAGGAAGCGGAGCTTGGAGTGGG - Intronic
1194224219 X:91235407-91235429 CAGGAAAAACAGCTTTCGATAGG - Intergenic
1194417926 X:93636596-93636618 CAGGAAGAAGAGGTTAGGGGAGG - Intergenic
1194800090 X:98262444-98262466 CAGAAACAAGAGGTTGGGGTGGG + Intergenic
1195430703 X:104786108-104786130 AAAGAAAAACAGCTTAGGGTTGG - Intronic
1195565130 X:106331624-106331646 CAGGGTGAACAGTTTAGGGTCGG + Intergenic
1195737143 X:108023850-108023872 CAGGAGAAACAGCTTAGGGTTGG + Intergenic
1195849562 X:109268538-109268560 CAGGCAGAACAACTTTGTGTGGG + Intergenic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1197330525 X:125148674-125148696 AAGGAGGAACAGCTTTGGTTAGG - Intergenic
1198036100 X:132802955-132802977 GAGGAAGGACAGAATGGGGTTGG - Intronic
1198184866 X:134243940-134243962 AAGGATGTACAGCTTTGGGTAGG + Intronic
1198664067 X:139002576-139002598 CAAGCTGTACAGCTTGGGGTTGG - Intronic
1198993520 X:142545172-142545194 CAGGAAGCAAAGCCTGAGGTGGG - Intergenic
1199659402 X:150033113-150033135 AATTAAGAACAGCTAGGGGTAGG + Intergenic
1200000997 X:153059659-153059681 CAGGAACAACGGCTAGCGGTGGG - Intronic
1200560681 Y:4698775-4698797 CAGGAAAAACAGCTTTTGATAGG - Intergenic
1201483607 Y:14468535-14468557 CATGAAGACCTGCTTGTGGTTGG + Intergenic