ID: 961739288

View in Genome Browser
Species Human (GRCh38)
Location 3:129022658-129022680
Sequence GGGTGTGAGGGGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4311
Summary {0: 2, 1: 2, 2: 32, 3: 460, 4: 3815}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961739271_961739288 18 Left 961739271 3:129022617-129022639 CCCAACCGCACACAAGGACTCTG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG 0: 2
1: 2
2: 32
3: 460
4: 3815
961739276_961739288 13 Left 961739276 3:129022622-129022644 CCGCACACAAGGACTCTGGGGTC 0: 1
1: 0
2: 2
3: 14
4: 177
Right 961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG 0: 2
1: 2
2: 32
3: 460
4: 3815
961739272_961739288 17 Left 961739272 3:129022618-129022640 CCAACCGCACACAAGGACTCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG 0: 2
1: 2
2: 32
3: 460
4: 3815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961739288 Original CRISPR GGGTGTGAGGGGAGGGTGGG TGG Intronic
Too many off-targets to display for this crispr