ID: 961754169

View in Genome Browser
Species Human (GRCh38)
Location 3:129117705-129117727
Sequence CGTGAGATTCTGAAAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961754169_961754173 14 Left 961754169 3:129117705-129117727 CCATTCACTTTCAGAATCTCACG 0: 1
1: 0
2: 0
3: 19
4: 172
Right 961754173 3:129117742-129117764 CTCAGAGCAAATCAGAAGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 189
961754169_961754171 10 Left 961754169 3:129117705-129117727 CCATTCACTTTCAGAATCTCACG 0: 1
1: 0
2: 0
3: 19
4: 172
Right 961754171 3:129117738-129117760 TGAACTCAGAGCAAATCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 292
961754169_961754172 11 Left 961754169 3:129117705-129117727 CCATTCACTTTCAGAATCTCACG 0: 1
1: 0
2: 0
3: 19
4: 172
Right 961754172 3:129117739-129117761 GAACTCAGAGCAAATCAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961754169 Original CRISPR CGTGAGATTCTGAAAGTGAA TGG (reversed) Intronic
901411581 1:9088024-9088046 CCTGAGAATTTGAAAGTCAAAGG - Intronic
904068642 1:27774955-27774977 ATTGAGACTCTGGAAGTGAAAGG + Intronic
907748342 1:57237477-57237499 AGTGACATTCTGAGAGAGAAAGG - Intronic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908884346 1:68770564-68770586 AGTGTGAGTCTGAAAGTGGATGG - Intergenic
908972044 1:69847951-69847973 CGTGAGATTGTGAAAGTGTTGGG - Intronic
909666818 1:78143319-78143341 GGTAAGATATTGAAAGTGAAAGG - Intergenic
910671841 1:89781686-89781708 TGTCAGATGCTAAAAGTGAAAGG + Intronic
912971511 1:114288231-114288253 GGAGAGACTCTGAAAGGGAAAGG + Intergenic
917997769 1:180459106-180459128 CGTAAGATGCTGAAAATGATAGG + Intronic
919650675 1:200146183-200146205 GGTGAACTTCTGCAAGTGAATGG - Intronic
921400796 1:214721550-214721572 AGTGATATTCCCAAAGTGAAGGG - Intergenic
924557679 1:245131601-245131623 ATTGAGAATCCGAAAGTGAATGG + Intergenic
1065012924 10:21435824-21435846 CCTCAGATTCTGAAAGTGCTGGG - Intergenic
1065740103 10:28789907-28789929 CAGGAGAGTCTGAGAGTGAAAGG + Intergenic
1066978761 10:42392179-42392201 CCTGAGAATTTGAAAGTCAAAGG + Intergenic
1067279519 10:44860805-44860827 ACTGAGATTCAGAAAGAGAAAGG - Intergenic
1069099881 10:64306998-64307020 TGAGGGAATCTGAAAGTGAAAGG - Intergenic
1069266575 10:66465828-66465850 TGTGAGATTTTAAAACTGAAAGG + Intronic
1072484638 10:95843579-95843601 AGTGGGATTCTGAAAAGGAAGGG + Intronic
1075558692 10:123451932-123451954 CGTCAGATTCTGAAAGTTGATGG + Intergenic
1077028944 11:454919-454941 CCTGGGATTCTGCATGTGAATGG + Intronic
1078924023 11:15858056-15858078 CTAGATATCCTGAAAGTGAATGG - Intergenic
1079405581 11:20142426-20142448 CATGAGATTATGAAAATCAAGGG + Intergenic
1081280464 11:41203308-41203330 GATGAGATTGTGAAAATGAAAGG - Intronic
1083572473 11:63768136-63768158 CCTGGGAGTCTGAAAGAGAAAGG + Intronic
1086211575 11:84327036-84327058 GCTGAAAGTCTGAAAGTGAAAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1089828257 11:121299305-121299327 CTTGAGAATCTTAAAGAGAAGGG - Intronic
1093828875 12:23730719-23730741 CATAAGAATCTGCAAGTGAACGG - Intronic
1095280195 12:40342254-40342276 AGTCAGATACTGAAAATGAAAGG - Intronic
1099553104 12:84072942-84072964 ACTGGGATTCTGAAAGTGAAAGG - Intergenic
1099989504 12:89708386-89708408 CGGGAGATTGTGAAGGTGAGCGG - Intronic
1101786398 12:107887471-107887493 GTTGAGATTGTGAAAGGGAATGG - Intergenic
1103133451 12:118488044-118488066 CCTGAGAATTTGAAAGTCAAAGG + Intergenic
1103758471 12:123230514-123230536 CAAGAGAGTCTGAAAATGAATGG + Exonic
1103985508 12:124764732-124764754 CATGAGAATCTGAAATTGATGGG + Intergenic
1107677186 13:42809557-42809579 CGTCAGCTTCTGAAAGTGCTGGG - Intergenic
1108757551 13:53522249-53522271 CCTGTGGTTGTGAAAGTGAAAGG + Intergenic
1109497533 13:63192598-63192620 TGTGAGATTTTGGAAATGAAGGG - Intergenic
1115374618 14:32660716-32660738 CGTGAGATTCTGAGAGTATATGG + Intronic
1116050391 14:39795736-39795758 CCAGAAATTTTGAAAGTGAATGG - Intergenic
1116496066 14:45562157-45562179 TGTGAGATGTTGATAGTGAAGGG - Intergenic
1116521294 14:45850513-45850535 AGTAAGATTCAGAAAGGGAAAGG - Intergenic
1118961514 14:70537835-70537857 CCTGAGAATTTGAAAGTTAAAGG - Intergenic
1119193716 14:72701986-72702008 TGTGAGATTCTGCATGGGAATGG - Intronic
1121189222 14:92010142-92010164 AATAAGATTCTGAAAGGGAAAGG - Intronic
1121783354 14:96636800-96636822 AGTGAGTCGCTGAAAGTGAAGGG + Intergenic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1127341375 15:58048407-58048429 GGTCTGCTTCTGAAAGTGAAAGG + Intronic
1128536791 15:68497674-68497696 GGTGTGATCCTGAAAGTGCAAGG - Intergenic
1130608520 15:85339269-85339291 CTTGAGAATAGGAAAGTGAAAGG - Intergenic
1131865267 15:96702093-96702115 CGTAAGTTTATGAAAATGAATGG + Intergenic
1132116413 15:99139258-99139280 CTTGAGATTCTGAATGGAAAGGG + Intronic
1135400837 16:22165401-22165423 CTTGAGATTCTGAAAGGGGCAGG + Intergenic
1135652025 16:24214531-24214553 TCTGAGTTTCTGAAAGGGAAGGG + Intronic
1136937069 16:34480510-34480532 CTTGTGATTCAGAAAATGAATGG - Intergenic
1136962750 16:34868060-34868082 CTTGTGATTCAGAAAATGAATGG + Intergenic
1141284162 16:82655556-82655578 CGTGTGATGCTGAGAGTGATGGG + Intronic
1141923701 16:87153376-87153398 CCTGAGACCCTGAAAATGAAAGG + Intronic
1143666592 17:8365675-8365697 AGCGAGATTCTGCATGTGAAGGG - Intergenic
1144043852 17:11437263-11437285 CCTGGAAGTCTGAAAGTGAATGG - Intronic
1146742500 17:35298904-35298926 CCTGAGAATTTGAAAGTCAAAGG - Intergenic
1148633295 17:49128647-49128669 CCTGAGAATTTGAAAGTAAAAGG + Intergenic
1149311864 17:55402234-55402256 AGTGAAATTCTGAAGATGAATGG + Intronic
1149483357 17:57021639-57021661 CCTGGAATTCTTAAAGTGAAAGG - Intergenic
1150824122 17:68459554-68459576 TGTGAAATTCTGGAAGTAAAGGG + Intergenic
1155813236 18:30266967-30266989 TGTGAAATTCAGGAAGTGAAGGG + Intergenic
1156778000 18:40817229-40817251 AGTGAGCCTCTGAAATTGAAAGG - Intergenic
1158864049 18:61620075-61620097 CCTGAGAATATGAAAGTCAAAGG - Intergenic
1159753617 18:72335249-72335271 TTGGAGTTTCTGAAAGTGAATGG - Intergenic
1160176804 18:76601566-76601588 CGGGGGAGTCTGAAAGTGCAGGG + Intergenic
1161524004 19:4742432-4742454 CGTGACCATCTGAAAGTGCACGG + Intergenic
1163299686 19:16436267-16436289 TGTGACAGTCTGAAAGTGAAGGG + Intronic
1163398454 19:17077359-17077381 CAGGATATTCTGGAAGTGAAGGG - Intronic
1163726756 19:18927570-18927592 CGTGAGACTCTGAAAGACAGCGG + Intronic
1163979532 19:20885987-20886009 AGTGAGTGGCTGAAAGTGAACGG - Intergenic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
928021382 2:27707794-27707816 GGTGAGAATCAGAAAGTGTATGG + Exonic
928651716 2:33410953-33410975 AGTGAGACTCTGAAAAAGAAAGG - Intergenic
931972534 2:67604867-67604889 CATGGGCTTCAGAAAGTGAAGGG + Intergenic
933754504 2:85627343-85627365 CCTGAGCTTCTGAAAGTGCTGGG + Intronic
939815571 2:146892552-146892574 CATGAGATTCTGAATGAGAGAGG + Intergenic
941483379 2:166046530-166046552 CTTAAGATTCTCAAAGTAAAGGG - Intronic
942046371 2:172101607-172101629 CCTGAAATTCGGATAGTGAACGG - Exonic
945192113 2:207199435-207199457 GATGAGATGCTGAAAGTGAAAGG - Intergenic
946035593 2:216739893-216739915 TGTGATATTATGAAAGTAAATGG + Intergenic
948405940 2:237719181-237719203 AGTGAGGTTCTGAAAGTAAGGGG + Intronic
1169027687 20:2384244-2384266 CAGGAAATTCTGAGAGTGAAAGG - Intronic
1169950159 20:11034730-11034752 CCTAAGAATCTGAAAATGAAAGG + Intergenic
1170954133 20:20962848-20962870 GGTGAGATTCTGAAATAGAAGGG - Intergenic
1171164945 20:22961425-22961447 GTTGAGATTCTAGAAGTGAAAGG - Intergenic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
1179935205 21:44599569-44599591 GCTGAGAATGTGAAAGTGAAGGG - Intronic
1180219782 21:46351198-46351220 CCTGAGATTCTGAAAGTGCCTGG + Intronic
1182583628 22:31330014-31330036 TGTGTAATTTTGAAAGTGAATGG - Intronic
1184040619 22:41941059-41941081 CATGAGATTCTGAGAGGGCAGGG + Intronic
1184836708 22:47028295-47028317 ACTGAGATTCTGAGAGTGAGTGG + Intronic
949494225 3:4616666-4616688 GTTCAGATTCTGAAAGAGAAGGG + Intronic
949627461 3:5883183-5883205 CTTAAGCTTTTGAAAGTGAAAGG + Intergenic
949767348 3:7541894-7541916 CGTGAGTTTCTGATAGAGTATGG - Intronic
949835528 3:8265495-8265517 CCTGAGTTTTTAAAAGTGAAAGG + Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
951248122 3:20364431-20364453 AGTGAGAGTCTCAAAGTGAGGGG - Intergenic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
960462922 3:117959082-117959104 AGTGAGAGTTTGAAAGAGAAGGG + Intergenic
961072608 3:123948777-123948799 CCTGAGATTCTGTAAGTAAGAGG + Exonic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
962048270 3:131784548-131784570 CATGAGATTCAAAAACTGAAGGG + Intronic
962391067 3:134973270-134973292 AGTGAGAACCTGATAGTGAAGGG + Intronic
963666991 3:148200488-148200510 CGTGAGATTCTGCAAGAGGCTGG - Intergenic
963723159 3:148887375-148887397 CTTGAGATTGTGAAAATCAAGGG - Intronic
964688290 3:159421998-159422020 TGTTATCTTCTGAAAGTGAATGG + Intronic
965942919 3:174207126-174207148 GGTGAGATTTTGAAACTGAATGG + Intronic
966068640 3:175847375-175847397 GGTGTAATTCTGAAAGGGAAGGG - Intergenic
969571772 4:8013020-8013042 TGTGAGCTTCTGAAAGACAAGGG - Intronic
971291735 4:25348359-25348381 CATGAGATTTTAAAATTGAATGG - Intronic
973381103 4:49321653-49321675 CCTGAGATTCTGAGAGGGGAGGG - Intergenic
974593263 4:63983456-63983478 GGTGAGAATCTGAAAGTGGCTGG - Intergenic
975293343 4:72703316-72703338 CGTAAGATTGTGCAAGTGAGAGG - Intergenic
976194714 4:82521624-82521646 TGTAAGATGCTGAAAGGGAATGG + Intronic
976607801 4:86998855-86998877 CTTGAGATACTGAAAGTAGAGGG - Intronic
980187502 4:129480521-129480543 CTTGAGATTCTAAATGTAAAAGG - Intergenic
980577660 4:134705947-134705969 CATGAAATTCTAAAAGTGACTGG + Intergenic
980673625 4:136044886-136044908 TGTAAGATTTTGAAACTGAATGG + Intergenic
980802110 4:137765363-137765385 CATGGGATGCTGAAAGTGGATGG + Intergenic
981595387 4:146415332-146415354 CTTGAGATTCAGAAAGTTCAAGG - Intronic
982574356 4:157089922-157089944 GATGAGATGATGAAAGTGAAAGG - Intronic
983359305 4:166708576-166708598 AGTGATAGACTGAAAGTGAAGGG - Intergenic
984794977 4:183651659-183651681 CGTGGGATACAGAAAGAGAATGG + Intronic
984985881 4:185329168-185329190 CCTGAGAATTTGAAAGTCAAAGG + Intronic
987630896 5:20470439-20470461 CGGGAGAGTATGAAAGAGAAGGG - Intronic
987701335 5:21403466-21403488 CATGTGATTCTGTAAGTGCAAGG - Intergenic
987788258 5:22529833-22529855 CCTTAGATCCTGAAATTGAATGG - Intronic
991458574 5:66832232-66832254 CGTGAGAGTCTGGAAGTGGATGG - Intronic
991471218 5:66970944-66970966 CTGGAGGTTTTGAAAGTGAAAGG - Intronic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
991534581 5:67653509-67653531 TATGATATTCTGAAATTGAAAGG + Intergenic
992317613 5:75573912-75573934 CTTGAGATTCTGTAGGTGACAGG - Intronic
993071325 5:83167378-83167400 CATGAGATTCTGACAGTACAAGG + Intronic
994816209 5:104591454-104591476 CCTGAGACTTTGAAAGTCAAAGG - Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
996633753 5:125666479-125666501 CTTGAGAATTTGAAAGTCAAAGG + Intergenic
997811837 5:136978331-136978353 CGTGGAATTCTGACAGTGCAGGG - Exonic
1000555408 5:162719082-162719104 CTTGAGAATTTGAAAGTCAAAGG - Intergenic
1004654601 6:17646593-17646615 AGTGAGATTCTTATATTGAATGG + Intronic
1006603670 6:35242074-35242096 AGTGAGATTATGAAAGTCAAGGG - Intronic
1007412785 6:41674606-41674628 CAGGAGACTCTGAAAGTGGAAGG - Intergenic
1013690844 6:112640945-112640967 AGAGAAATTCTGAAAGTGAAAGG + Intergenic
1015936318 6:138408670-138408692 AGTGACACTCTGAAAGTTAAAGG - Intronic
1015991238 6:138945603-138945625 CTTCAGATTCTGAAAATCAAGGG - Exonic
1016872099 6:148828043-148828065 ATTAAGATTCAGAAAGTGAATGG - Intronic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1017888406 6:158619998-158620020 CCTGAGAATCTGAAAGTTAAAGG + Intronic
1019544425 7:1566668-1566690 CGTGAGACTGTCAGAGTGAAGGG + Intergenic
1021981012 7:26055644-26055666 AGAGAGAAGCTGAAAGTGAATGG + Intergenic
1027889625 7:83954454-83954476 TGTGAGTTTCTCAAAGTCAAAGG + Intergenic
1028249441 7:88523769-88523791 AGTGAGATTTTGAAAGAGAAAGG - Intergenic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1030244706 7:107370235-107370257 TGTGTGTTTCTGAGAGTGAATGG - Intronic
1031972421 7:128074339-128074361 CGTGAGAGGCTGAAATTGAAGGG + Intronic
1040877907 8:52172093-52172115 GGTGTGATTCTGAAACAGAAAGG - Exonic
1042651192 8:71043182-71043204 CCTGACACTCTGCAAGTGAATGG + Intergenic
1044359006 8:91259553-91259575 GGTGAGATTCAGATATTGAAGGG - Intronic
1046497074 8:115027823-115027845 AGTGAAACTCTGAATGTGAAAGG - Intergenic
1047073689 8:121376343-121376365 CTTGAGTTGCAGAAAGTGAAAGG + Intergenic
1048560172 8:135527368-135527390 AGTGAGATAGTGAAATTGAAGGG + Intronic
1050716337 9:8530746-8530768 AGAGAGATTCTGAATGTGAATGG + Intronic
1050923418 9:11234257-11234279 CCTGAGAATTTGAAAGTCAAAGG + Intergenic
1051818186 9:21134041-21134063 GTTGAGATCCTGAAAGTGGAAGG - Intergenic
1052557060 9:30031700-30031722 CATGAGAGTCTGAAATTCAATGG + Intergenic
1055209652 9:73775316-73775338 CATGAGATTTTGAAGCTGAAAGG + Intergenic
1056998309 9:91484394-91484416 CGTGAGATTCTACATGTGCACGG + Intergenic
1057250488 9:93497286-93497308 CTTGAGCTTCAGAACGTGAACGG + Intronic
1057998779 9:99844498-99844520 CATGAGACTGTGAATGTGAAGGG + Intronic
1058572295 9:106359524-106359546 CAGGAAATTCAGAAAGTGAAAGG - Intergenic
1059456416 9:114402872-114402894 CACGTGATTCTGGAAGTGAATGG - Exonic
1061751858 9:132784052-132784074 CCTGAAATACTGTAAGTGAAAGG + Intronic
1187358787 X:18604670-18604692 CGTGAGGTGCAGACAGTGAATGG - Exonic
1189223080 X:39389398-39389420 ACTGAGATTCTGAGAGTGGAAGG - Intergenic
1190072797 X:47292757-47292779 CCTGAGAATTTGAAAGTTAAAGG + Intergenic
1192080912 X:68047031-68047053 AGAGAGAGTCTGAAAGTGCAAGG + Exonic
1193338039 X:80313507-80313529 CCTGAGAATTTGAAAGTTAAAGG - Intergenic
1195388895 X:104340590-104340612 CAAAAGATTCTGAAAGTAAATGG - Intergenic
1195824107 X:108978571-108978593 CGTTAAATACTGAAAGTCAAGGG + Intergenic
1196972378 X:121123831-121123853 CGTGACATTATGAAAGTTAAAGG - Intergenic
1197985040 X:132258018-132258040 GTTGAGATTCTGTAAGTGCATGG + Intergenic
1200393647 X:155969409-155969431 AGTGAGATTCTCAAAGTGGGGGG - Intergenic
1201630260 Y:16063807-16063829 CCTGAGAATCTGAAAGTTAAAGG + Intergenic
1201632204 Y:16081194-16081216 CCTGAGAATTTGAAAGTTAAAGG - Intergenic