ID: 961760436

View in Genome Browser
Species Human (GRCh38)
Location 3:129163264-129163286
Sequence CAGTGTGAGCAGAGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 755
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 681}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961760436 Original CRISPR CAGTGTGAGCAGAGAAAGGA AGG (reversed) Intergenic
900118313 1:1037998-1038020 CAGTGTGAGCGGAGAATGGGGGG + Intronic
900775077 1:4576964-4576986 CAGAGTGGGGAGCGAAAGGAGGG - Intergenic
901840349 1:11950283-11950305 CAGTGAGGGCACAGACAGGAGGG - Intronic
901946356 1:12707118-12707140 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902472365 1:16657621-16657643 CAGTGTGAGCTCAGAAAGCCTGG + Intergenic
902486439 1:16749825-16749847 CAGTGTGAGCTCAGAAAGCCTGG - Intronic
902689627 1:18102173-18102195 GAGTGAGAGCAGGGGAAGGAGGG + Intergenic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
904499755 1:30907311-30907333 CAGGGATGGCAGAGAAAGGAAGG - Intronic
904595103 1:31639245-31639267 CAGTGTGAACCCAGAAAGGCAGG + Intronic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
905014236 1:34766227-34766249 GAGTCTAAGCTGAGAAAGGAGGG - Intronic
905262345 1:36728826-36728848 CACAGTGAGATGAGAAAGGAAGG - Intergenic
905422924 1:37860290-37860312 CAATGTGAACGGTGAAAGGAAGG - Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
905610322 1:39344865-39344887 CAGCGACAGCAGAGAAAGGCAGG - Intronic
905703181 1:40034645-40034667 AAGTGTAAGTAGAGAAAGAAGGG + Intergenic
906091729 1:43185335-43185357 CCGTGAGAGCAGAGAAATCAGGG + Exonic
906258738 1:44369954-44369976 CATTTTGAGTAGAGAAAGCAAGG - Intergenic
906566003 1:46801540-46801562 CAGGTTGAGCAGACAAAGGCTGG + Intronic
907372903 1:54014471-54014493 GAGGGTGAGCAGAGCAGGGATGG + Intronic
907520204 1:55018819-55018841 AAGTGTCAGCAAAGAAAGAAAGG + Intergenic
907843982 1:58186999-58187021 AAGTGTGAACACAGAAAGGAAGG + Intronic
907877102 1:58501707-58501729 ATGTGTGAGCAGAGATGGGAGGG - Intronic
908959956 1:69684901-69684923 CAGGGAGAGCAGAGCAGGGATGG - Intronic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
910150960 1:84144508-84144530 CAGTATGTTCAGAGAAATGAAGG - Exonic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
914756922 1:150567921-150567943 CGTTGTGAGCTGAGAAAGGCAGG + Intergenic
914876470 1:151516158-151516180 CAGGGTGAGATGAGAAGGGAGGG - Intronic
914916436 1:151822217-151822239 AACTGAGAGCTGAGAAAGGAGGG - Intronic
914949369 1:152098882-152098904 AAGAGTGAGAAGGGAAAGGAAGG - Intergenic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916142592 1:161712308-161712330 CAGTGTGAGCAGGTTAAGAAGGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
916640277 1:166720741-166720763 CATTGTGAAAAGAGAAAGCATGG - Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
918324429 1:183395987-183396009 CAGTGAGAGGAGCAAAAGGAAGG - Intronic
920247586 1:204600034-204600056 CGGTGGGCGCAGAGGAAGGATGG + Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920560658 1:206936070-206936092 TATTCTGAGCAGAGAATGGAAGG + Intronic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
921430987 1:215065801-215065823 AAGTGGGAGGAAAGAAAGGAAGG + Intronic
921650394 1:217671586-217671608 CAGAAGGAGAAGAGAAAGGAAGG - Intronic
921961125 1:221035369-221035391 AAGTGTGAGCAGAGCACTGAGGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922700747 1:227758807-227758829 CAGTGTGAGAAGAGAAAGCTGGG - Intronic
922865837 1:228860887-228860909 AAATGTGTGCAGAGAAAAGAGGG + Intergenic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
922973306 1:229761244-229761266 CAGACTGAGCAGAGGAAGCAGGG - Intergenic
923261013 1:232268099-232268121 CAATGTGATCAAAGAAAGGAAGG - Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923863635 1:237916985-237917007 AAGAGTGAGGAGAGACAGGAGGG - Intergenic
923891283 1:238217695-238217717 CAGTGTGTGCAGAGATCGTATGG + Intergenic
924735247 1:246749803-246749825 CAGTCTGAGGAGAGCTAGGAAGG + Intronic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1064120008 10:12610383-12610405 GAATGTGCCCAGAGAAAGGAGGG - Intronic
1064602796 10:17010208-17010230 CAGTGTGAAAAGAGACAGAAAGG - Intronic
1064939414 10:20715898-20715920 CAGTGAGAGAAGGGAAGGGAAGG + Intergenic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065599952 10:27358159-27358181 CACTGGGAGCGGAGAAAGGCAGG + Intergenic
1065600450 10:27362680-27362702 CACTGGGAGCAGAGAAAGGCAGG + Intergenic
1065685924 10:28284498-28284520 TAGGGTGAGAGGAGAAAGGAAGG - Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066025550 10:31355742-31355764 CAGTGTGAGCGTTGAAAAGAAGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1069050336 10:63785881-63785903 CAGGCAGAGCAGAGAATGGATGG - Intergenic
1069172803 10:65254554-65254576 GAGTGGGAGCAGTGAAGGGAGGG - Intergenic
1070333252 10:75432591-75432613 CAGGGTGTGCAGGGAAAGGTGGG - Intronic
1070987878 10:80703650-80703672 CAGTGTGGTGAGAGACAGGATGG + Intergenic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073886951 10:108050318-108050340 CAGTGTGAGCTCATCAAGGAAGG + Intergenic
1074775834 10:116767502-116767524 TAGTGGGAGCAGAGAAGGGAGGG - Intergenic
1074869327 10:117564686-117564708 CAATGGGTGGAGAGAAAGGAGGG + Intergenic
1075013121 10:118891776-118891798 CAGAGTGAGAAAAGAAAGGAAGG + Intergenic
1075613847 10:123876405-123876427 CACTGTGATATGAGAAAGGAGGG + Intronic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1076923991 10:133472136-133472158 CTGTGTGAGCTGACAAAGGAGGG + Intergenic
1077095482 11:797329-797351 GAGTGAGGGCAGAGAAAGGCGGG - Intronic
1077246334 11:1541026-1541048 CAGTGTGAAGAGACACAGGAAGG + Intergenic
1077379194 11:2220761-2220783 CAGTGTGTGCAGAGACCGTATGG + Intergenic
1078369644 11:10734344-10734366 CAGTGAGATGAAAGAAAGGAAGG + Intergenic
1078717282 11:13852239-13852261 CAGTGTGAGCCTAGAGAGAACGG - Intergenic
1079893045 11:26082131-26082153 TAGTGTGAGCAGTGTAAGGATGG - Intergenic
1080046351 11:27812471-27812493 CAGACTGAGCAGATAAAGAAGGG + Intergenic
1080334460 11:31180528-31180550 CAGTGGGAGCAGACCATGGAGGG + Intronic
1080470346 11:32539394-32539416 CAGTGAGAAGAAAGAAAGGAAGG - Intergenic
1080922327 11:36721463-36721485 CAGTGAGAGCAGTGAGAGAAGGG - Intergenic
1081111509 11:39139562-39139584 AAGGGTGAGCAGAGATAGTAGGG - Intergenic
1081674402 11:44960204-44960226 CAGTGTGGGAAGAGAAAAGGTGG + Intergenic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083738996 11:64697825-64697847 CAGAGAGAGAAGAAAAAGGAGGG + Intronic
1083740633 11:64709493-64709515 CAGAGTGGGGAGAGAAAAGAAGG + Intronic
1083745066 11:64730906-64730928 CAGTGTCTGCACAGATAGGAGGG + Intronic
1084051475 11:66602986-66603008 CAGGGTGAGGAGAGAACAGAAGG - Intronic
1084214516 11:67640130-67640152 CAGTGTGAGCAGGAAACGCAAGG + Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084852723 11:71955892-71955914 CAGTGTGGGTAGGAAAAGGAAGG + Intronic
1084938990 11:72602318-72602340 CAGTGTGGGGAGAGACAGGGTGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085239770 11:75043624-75043646 TAGTCTGAGCAGAGTCAGGAGGG - Intergenic
1085480287 11:76816538-76816560 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1085878859 11:80441709-80441731 TAGAGAGAGTAGAGAAAGGATGG - Intergenic
1085891862 11:80589133-80589155 CCCTGTTAACAGAGAAAGGAAGG - Intergenic
1086192787 11:84099183-84099205 CACAGTTAGCAGACAAAGGAAGG + Intronic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1086987553 11:93266827-93266849 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1087684501 11:101248109-101248131 CAGTCTGAGTAGAGTCAGGAGGG - Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1088018206 11:105085837-105085859 CAGAGTGATCAGACAATGGAAGG + Intronic
1089096431 11:115923521-115923543 CACTTTGAACAGAGTAAGGAGGG + Intergenic
1089119809 11:116125548-116125570 CAGACAGAGCAGATAAAGGAAGG - Intergenic
1089529525 11:119117266-119117288 AGGGGTGTGCAGAGAAAGGATGG + Exonic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1089541972 11:119194748-119194770 CAGTGAGAGTTGATAAAGGAAGG - Intronic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1090450059 11:126798239-126798261 CAGTGTGTTCTGAGAGAGGAAGG - Intronic
1090455555 11:126845615-126845637 CATTCTGAAAAGAGAAAGGACGG - Intronic
1090589009 11:128245373-128245395 GCGTGTGAGCAGAGGAAGTATGG - Intergenic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1090876846 11:130797875-130797897 AAGTATGAGGAGAGACAGGAGGG + Intergenic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1092817212 12:12322885-12322907 CAGAGTGATGAAAGAAAGGAAGG + Intergenic
1092900146 12:13051606-13051628 CAGTCTGACCAGAGAAAGGGAGG - Intronic
1093409525 12:18847655-18847677 CAGTGGGAGAAGAGATAGAAAGG + Intergenic
1093594130 12:20941218-20941240 CAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1093645260 12:21579038-21579060 CAGTTTCAGAGGAGAAAGGAAGG - Intronic
1093735474 12:22615284-22615306 CATTGTGAAAAGAGAAAGCATGG - Intergenic
1093750811 12:22797775-22797797 AAGTGTGAGGAGAGAAAAAAAGG + Intergenic
1093757162 12:22865713-22865735 CAGCGTGAGCAGGGTTAGGAGGG - Intergenic
1094100251 12:26753914-26753936 CATTGTGACAAGAGAAAGCATGG - Intronic
1095162369 12:38933279-38933301 CAGTCTGAGTAGAGCCAGGAAGG + Intergenic
1095272607 12:40237514-40237536 GAGAATGAGAAGAGAAAGGAGGG + Intronic
1095508911 12:42928081-42928103 AGGTGGGAGAAGAGAAAGGAGGG - Intergenic
1095602554 12:44029927-44029949 CATTGTGAAAAGAGAAAGCATGG - Intronic
1096137529 12:49214929-49214951 AAGTGTTAGCTGAGGAAGGAAGG - Intronic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097090383 12:56499982-56500004 AAGAGTGAGGAGAGACAGGAGGG + Intergenic
1097797660 12:63880919-63880941 AAGAGTGTGCAGATAAAGGAAGG - Intronic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1098438959 12:70498331-70498353 CACTGTGAAAAGAGAAAGTACGG + Intergenic
1098596219 12:72274670-72274692 AAGAGTGAGCAGACAAAGCACGG + Intronic
1100490962 12:95077462-95077484 CTGTGTGAACAAAGAAAGGTTGG + Exonic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101420823 12:104549557-104549579 CAGTGTGGGAAAACAAAGGAAGG + Intronic
1102606369 12:114070837-114070859 CAGTCTGAGGAGAGCAAGGAGGG - Intergenic
1102657207 12:114492075-114492097 AAGAGTGAGGAGAGAATGGATGG + Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104483701 12:129130695-129130717 CAGTGAGAGGAGAGACAGGGTGG + Intronic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1104655302 12:130569958-130569980 GAGTGTGTGCAGAGTAAGGTAGG - Intronic
1106050270 13:26183422-26183444 CAGAGTGGGGAAAGAAAGGAAGG - Intronic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106899183 13:34336880-34336902 CAGTGTCTGGAGAGAAAAGAAGG + Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108231529 13:48348497-48348519 CACTGTGAGCAGAAAAATGAAGG - Intronic
1108251766 13:48574610-48574632 CAGTGGGAGCTGTGACAGGAAGG + Intergenic
1108507994 13:51129941-51129963 CATTGTGAAAAGAGAAAGCAAGG - Intergenic
1108574873 13:51782286-51782308 GAGTGTGGGAGGAGAAAGGAGGG + Intronic
1108581787 13:51834122-51834144 CAGTTTGTGCAGAGAAGAGAGGG + Intergenic
1109633941 13:65088587-65088609 CTGTGTGAGTAAAGAAGGGAAGG + Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1110604411 13:77415068-77415090 AAGTGTCAGGAGAGAAAGGAAGG + Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1113318043 13:109204941-109204963 CAGAGTGAGCCAAGAAAGCAGGG - Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1114482441 14:23044188-23044210 GAGTGGGAGCAGGGACAGGAGGG - Exonic
1114540721 14:23456209-23456231 CAATGTTAGTAGAGAAGGGAGGG + Intergenic
1115032347 14:28812051-28812073 CAGGATGAGCAAAGAAAGAAGGG + Intronic
1116946572 14:50840835-50840857 CTATGGGAGCACAGAAAGGAGGG + Intergenic
1117531859 14:56667439-56667461 GAGTGAGAGCAGAGAAAGGCAGG - Intronic
1118107253 14:62673910-62673932 CAGTGGGGTCAGAGAAGGGATGG - Intergenic
1118200905 14:63672170-63672192 CAGAGTCAGCAGAGAAGGTAAGG + Intergenic
1118469355 14:66060894-66060916 CAGAGGAAGCTGAGAAAGGAAGG + Intergenic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1120338759 14:83192026-83192048 GAGTGTGGGCAGAGAAAGAGAGG - Intergenic
1120716487 14:87846407-87846429 CAGTGTGACAAGAGACAGAAAGG + Intronic
1121105286 14:91275298-91275320 CAGTCTGAGCTGAGCAGGGAGGG + Intronic
1121901082 14:97694027-97694049 CCCTGTGAGCAGAGCAGGGATGG - Intergenic
1121940739 14:98068221-98068243 CTCTGTGAGCAGAGATAAGAGGG + Intergenic
1122382802 14:101321679-101321701 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1122914593 14:104852426-104852448 CAGGGTGAGCCTAGGAAGGAAGG - Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124934453 15:34157041-34157063 CAGTCTGAGAAGAGCTAGGAAGG + Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125690305 15:41590905-41590927 CAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1125890166 15:43260005-43260027 CACTGACAGAAGAGAAAGGAGGG + Intronic
1126033655 15:44526230-44526252 CTGTTTGAGCATAAAAAGGAAGG - Exonic
1126389971 15:48137386-48137408 CAGTATGTGCATAGGAAGGAAGG + Exonic
1126785056 15:52171525-52171547 CAGTGAATGCAGAGAAAGGAAGG + Intronic
1128935634 15:71744110-71744132 AGGTGGCAGCAGAGAAAGGAAGG + Intronic
1129824502 15:78625721-78625743 CAGTGAGAGCAGAGAAACCGGGG + Intronic
1130219534 15:82007601-82007623 CAAAGAGATCAGAGAAAGGAAGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131830350 15:96351007-96351029 AAGTGTGTGCAGGGACAGGAGGG + Intergenic
1132465046 16:73530-73552 CAGTGTCAGGAGAGAAATGCTGG - Intronic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1134513490 16:14867925-14867947 CAGTGGGAGGAGATAAAGAAGGG - Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1134701127 16:16266420-16266442 CAGTGGGAGGAGATAAAGAAGGG - Intronic
1134970701 16:18528226-18528248 CAGTGGGAGGAGATAAAGAAGGG + Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136060386 16:27722415-27722437 TAGTGTGAGGTTAGAAAGGAGGG - Intronic
1136125825 16:28179685-28179707 TAGTTTGGTCAGAGAAAGGAAGG - Intronic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138487423 16:57355573-57355595 CAGTGTGGGTAGAGACAGAATGG - Intergenic
1138660030 16:58511401-58511423 CACTGTGGACAGAGACAGGATGG - Exonic
1138828114 16:60345780-60345802 GAGTGAGAGGAGAAAAAGGAGGG - Intergenic
1139085576 16:63581264-63581286 TAGTGTGAGCAAAGATATGAAGG - Intergenic
1139656311 16:68389174-68389196 CAGTAGGAGCAGAGCAGGGAGGG + Intronic
1139959329 16:70708765-70708787 CAGTGTGAGGAGGGCAAGGCCGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141137242 16:81474374-81474396 AAGAGAGAGCGGAGAAAGGAAGG - Intronic
1142921651 17:3192984-3193006 TACTGTAGGCAGAGAAAGGATGG - Intergenic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143514227 17:7411395-7411417 CAGTGTGGGCAAAGCAGGGAAGG - Intronic
1144005383 17:11094892-11094914 CAGTGGGAGCAGAGCAGGGGAGG - Intergenic
1145240470 17:21238091-21238113 CTCTGTGATCAGAGAAGGGAAGG - Intergenic
1146043993 17:29486858-29486880 GAATTTGAACAGAGAAAGGAGGG + Intronic
1146311984 17:31776396-31776418 TAGTGTGATCAGAGGATGGAAGG - Intergenic
1146624964 17:34428135-34428157 GAGTGTGAGCAGAATAGGGATGG - Intergenic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1146970573 17:37068426-37068448 CCGTGTGAGGACAGATAGGAGGG + Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1148562008 17:48611682-48611704 GAGGGTGGGGAGAGAAAGGAAGG + Intronic
1148709898 17:49671530-49671552 CAGTGTGAGCATCAAAAAGAAGG + Intronic
1148721670 17:49757842-49757864 GAGTGGAAGCAAAGAAAGGATGG - Intronic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1149040460 17:52182205-52182227 CGGGGTGAGGTGAGAAAGGATGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151787700 17:76283307-76283329 GAGTGTGTTCAGAGAAAGGCAGG + Intronic
1152104282 17:78319562-78319584 CAGCTGGAGCAGAGAAGGGAAGG - Intergenic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1153776936 18:8462747-8462769 CATTGTGAAAAGAGAAAGGCAGG - Intergenic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1153957837 18:10113291-10113313 CAGTGAGAGAAGGGAAAGGAGGG - Intergenic
1153998216 18:10460735-10460757 CAGTGAGAGAAGAAAAAGGGTGG - Intronic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1155421080 18:25657011-25657033 AAGTGTGGGCAGAGACAGGCTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156263207 18:35463539-35463561 CAGCTTGAGCAGGAAAAGGAGGG - Intronic
1157480837 18:48052601-48052623 TAGTTGGAGCAGAGAAAGGCCGG + Intronic
1157618719 18:49003180-49003202 CTGTGTGAGGAGGGAAAGGCAGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158433523 18:57415610-57415632 CAGTGTGAGCAGGGACAGAATGG - Intergenic
1158993976 18:62898414-62898436 CACAGTGAGAAGAAAAAGGAAGG - Intronic
1159308969 18:66683207-66683229 CAGTGTGAGCACAGAAACTAAGG + Intergenic
1160665364 19:325625-325647 CACTGTGAGAAGAGTAAGTAGGG - Exonic
1160829782 19:1098379-1098401 CCCTGTGAGCAGTGAAAAGAGGG + Intergenic
1161347488 19:3775531-3775553 GGGTGTGAGCAGTGAAGGGAGGG - Intergenic
1161520021 19:4718658-4718680 AAGTGTGTGCAGATAAGGGAAGG + Intronic
1161947943 19:7450062-7450084 CCTGGTGAGCTGAGAAAGGAAGG + Intronic
1161999525 19:7734575-7734597 TATTGTGGACAGAGAAAGGAAGG + Intergenic
1162267829 19:9590272-9590294 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1162979630 19:14230317-14230339 CTCTGTCAGAAGAGAAAGGAAGG + Intergenic
1163233471 19:16018601-16018623 CAGTGTGAGCAGGTACAGGTCGG + Intergenic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163606667 19:18279659-18279681 CAGAGGGAGGAGAGAAAGGCGGG + Intergenic
1163799393 19:19355614-19355636 CTGTGTGAGCAGCCCAAGGAAGG + Intronic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164084479 19:21888796-21888818 AAGAGTGAGGAGAGACAGGAGGG + Intergenic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164972184 19:32542014-32542036 CAGTGGGAGGAGGGTAAGGATGG + Intergenic
1165067780 19:33239141-33239163 CAGTGTGTGCTGGGAAGGGAAGG - Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165259162 19:34597970-34597992 CAGAGGGGGCAGAGAATGGAGGG + Intronic
1165269381 19:34691926-34691948 CAGAGAAAGCAGGGAAAGGAGGG + Intergenic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166688626 19:44810101-44810123 CAGATTGAGCAGAGAAGGGAAGG + Intronic
1167422737 19:49413640-49413662 CTGCGTCACCAGAGAAAGGAGGG + Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
927274891 2:21254397-21254419 CAGTGTGCTCACAGAAAGAATGG + Intergenic
927436857 2:23073955-23073977 CAGGTTGAACAGAGCAAGGATGG - Intergenic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
928100326 2:28433432-28433454 CAGTGTGAGTATACAATGGAGGG + Intergenic
928121144 2:28584339-28584361 TGCTGTGAGCAGAGACAGGATGG + Intronic
928907572 2:36383601-36383623 CAGAGTGAGTATAGAAATGAGGG + Intronic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929651512 2:43684356-43684378 CAGTTAAAGGAGAGAAAGGAAGG - Intronic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
930319272 2:49833614-49833636 TATTGTGAGCAGAGCAAGGGGGG + Intergenic
931146714 2:59527253-59527275 CAGAGTGAGCAGGGACAGGGTGG - Intergenic
931864964 2:66399600-66399622 CACTGTGACCATAGAAAGGCAGG + Intergenic
932029769 2:68171810-68171832 GATTGTGAGCAGAGGAAGGGAGG + Intronic
932461099 2:71882578-71882600 CAGGGTGAGGGCAGAAAGGATGG + Intergenic
932474701 2:71995592-71995614 AAGTGTGTGTGGAGAAAGGAAGG + Intergenic
932505850 2:72231168-72231190 GAGTGAGAGCAGAGAAAGAGAGG - Intronic
933389486 2:81652178-81652200 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
933691018 2:85179624-85179646 AGGTGTGAGCAGAGCAAGGGAGG - Intronic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
935745406 2:106186018-106186040 CAGTGAGAGAAGAAAAAGGGAGG + Intronic
935958721 2:108403000-108403022 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
936284967 2:111174772-111174794 TGGTGGGACCAGAGAAAGGAAGG + Intergenic
937146963 2:119655764-119655786 CAGTGGGAGTAGACAAAGGGCGG - Intronic
937318302 2:120946002-120946024 CAGTGTGTGCAAAGAAAGGCTGG - Intronic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939535379 2:143421414-143421436 CAGGGTGGGAAGAGAAAAGAAGG + Intronic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
941260667 2:163292733-163292755 CAGTTTGAGCTGAGTCAGGAGGG + Intergenic
941639551 2:167972471-167972493 CATTGTGAAAAGAGAAAGCAAGG - Intronic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
945720272 2:213410380-213410402 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
946170371 2:217891796-217891818 CACTGAGAGAAGAGGAAGGATGG - Intronic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
947859347 2:233347879-233347901 CGGTGTGATCAGAGAACTGAAGG + Intergenic
948015919 2:234690430-234690452 CAGTGTCTGCAGGGAAAGGGGGG + Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948899712 2:240950156-240950178 CAGGGTCAGCAGAGCAGGGAGGG - Intronic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168822725 20:786544-786566 CAGTCTGAGGAGAGCCAGGAAGG + Intergenic
1169820909 20:9708925-9708947 GGATGTGAGCAGAGGAAGGAAGG - Intronic
1170662755 20:18358890-18358912 ACGGATGAGCAGAGAAAGGATGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1171305216 20:24099489-24099511 CAGTGAGGGAAGAGTAAGGAGGG - Intergenic
1172321529 20:33998819-33998841 GAGTGTGTGCAGAAAAAAGATGG + Intronic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1173164264 20:40675410-40675432 CCATGTCAACAGAGAAAGGAAGG + Intergenic
1173251047 20:41364402-41364424 GATTGTGAGCAGGGAAGGGAAGG + Intronic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1174778365 20:53366057-53366079 CAGTGTCAGAAGAAAAAGAAGGG + Intronic
1174822285 20:53737111-53737133 TATTGTGATCCGAGAAAGGAAGG - Intergenic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1176811299 21:13540850-13540872 CAGTCTGAGAAGAGCCAGGAAGG + Intergenic
1176969110 21:15245608-15245630 CAGTATGTGCAGAGAAAGTATGG - Intergenic
1177498624 21:21920853-21920875 CAGAGTGTGCAGAGAAGAGAGGG + Intergenic
1178201792 21:30415233-30415255 CATTGTGAAAAGAGAAAGCATGG - Intronic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1180997531 22:19972883-19972905 CAAAGTGAGCAGGGAATGGAAGG + Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181696436 22:24595020-24595042 CAGGGGGAGGGGAGAAAGGAGGG + Intronic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182060040 22:27390543-27390565 CAGTGTCAACATAGCAAGGAGGG - Intergenic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183342024 22:37286769-37286791 CAGTGTGAGAGGAGCATGGAGGG + Intronic
1183350700 22:37333135-37333157 CAGTGGGAGCAGAGACTGGCGGG + Intergenic
1184345665 22:43911137-43911159 GAATGTAAGCTGAGAAAGGAGGG - Intergenic
1184574437 22:45350933-45350955 CAGAGTGAGCACAGCATGGATGG - Intronic
1184781732 22:46653031-46653053 CCGTGTGCTCAGAGATAGGAAGG + Intronic
1184958967 22:47914972-47914994 CAGAGAGAGAGGAGAAAGGAAGG + Intergenic
949243958 3:1903423-1903445 TAGTGTGAGGAGAGACAGGGAGG + Intergenic
949397101 3:3626306-3626328 CATTGTGAACAGAGAAAGTAAGG - Intergenic
949609906 3:5693349-5693371 CAGTCTGAGGAGAGCTAGGAAGG + Intergenic
949817367 3:8072628-8072650 GGGTGTCATCAGAGAAAGGAAGG - Intergenic
949819741 3:8103337-8103359 CACTATCAGCAGGGAAAGGAAGG + Intergenic
949898084 3:8785168-8785190 CAGTGTGTCTAGAGAAGGGATGG + Intronic
950227755 3:11249834-11249856 CAGTCTGAGGAGAGCCAGGAAGG + Intronic
950575678 3:13830724-13830746 CAGTGTTAGTAGAGAAAGTGTGG - Intronic
950846158 3:16017853-16017875 CAGTTTGAGGAGAGCCAGGAGGG + Intergenic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
952312624 3:32203874-32203896 CAGTGAAACCAGGGAAAGGAAGG - Intergenic
952389209 3:32865427-32865449 CAGTGTGGCCTGAGAAAGGGTGG - Intronic
952415749 3:33090294-33090316 CAGGGGTAGCTGAGAAAGGATGG + Intronic
952509545 3:34039334-34039356 CATTATTAGCAGGGAAAGGATGG - Intergenic
952717332 3:36493309-36493331 CAGAGCTAGCAGAGAAAGCAAGG - Intronic
953416239 3:42719731-42719753 CATTGTGAAAAGAGAAAGCATGG - Intronic
953953322 3:47210118-47210140 GAGAGTGAGCAGAGACAGTATGG - Intergenic
954069151 3:48130341-48130363 CAGAATGTGCAGAGAAGGGAAGG - Intergenic
954169315 3:48787941-48787963 CAGAATGTGCAGAGACAGGAAGG - Intronic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
954528419 3:51295277-51295299 CAGTGTGTGCAGAGATATCATGG + Intronic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
954959821 3:54554297-54554319 CAGTATGAGGAGAGAAACAATGG - Intronic
955286657 3:57647890-57647912 GAGAGTGAGCAGGGTAAGGAGGG + Intronic
955286809 3:57649757-57649779 GAGAGTGAGCAGGGTAAGGAGGG - Intronic
955444468 3:58994751-58994773 CAGGAAGAGGAGAGAAAGGATGG + Intronic
955957947 3:64309803-64309825 TAGTTAGAGCAGAGAAGGGAAGG - Intronic
956951530 3:74289018-74289040 CACTGAGATGAGAGAAAGGAAGG + Intronic
957295094 3:78325087-78325109 AAGAGAGAGTAGAGAAAGGAGGG - Intergenic
957692412 3:83589046-83589068 GAGTGGGAGAAGAAAAAGGAAGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
958804365 3:98792057-98792079 GAGTGTGAGAAGAGAAAATATGG - Intronic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
961510766 3:127401987-127402009 CATTGTGAAAAGAGAAAGCATGG + Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962245859 3:133791742-133791764 CACTGTGAAAAGAGAAAGCATGG - Intronic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
963649310 3:147957969-147957991 CTGTGTGGGCTAAGAAAGGAAGG + Intergenic
963741555 3:149086605-149086627 CAGTCAGAGCACAGAAGGGAGGG + Intergenic
963785770 3:149533007-149533029 TAGAGGGAGCAGAGGAAGGAAGG - Intronic
964177654 3:153844285-153844307 CAGTAAGAGAAGATAAAGGAAGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
965455342 3:168892826-168892848 CATTGGGAGCAGGTAAAGGAAGG + Intergenic
965721479 3:171667043-171667065 CATTATGATGAGAGAAAGGAAGG - Intronic
966044802 3:175534877-175534899 CAGTGTGAACAAAGAAAGAAAGG - Intronic
966103548 3:176307029-176307051 AAAAGTGATCAGAGAAAGGAAGG - Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967612053 3:191518831-191518853 CACTGTGAGCCAAGAAAGGAAGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968898930 4:3421695-3421717 GACAGTGAGCAGAGTAAGGACGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969456623 4:7303877-7303899 GAGTGTGGGGAGAGAAAGGATGG + Intronic
969634658 4:8360124-8360146 CATTGTGAAAAGAGAAAGCATGG - Intergenic
970288858 4:14549942-14549964 TAACGTGAGCAGAGAAATGAAGG - Intergenic
970747822 4:19320505-19320527 TGGTGTGAGCAGGGAAGGGAGGG + Intergenic
971060940 4:22968848-22968870 TAGTGTGAGCAAAGATAGAAAGG + Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972331833 4:38071160-38071182 CAGTAAGAGCAGGGACAGGAGGG - Intronic
972386802 4:38574849-38574871 CAGCACGAGCAGAGAAAGCAGGG - Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
972922776 4:43964888-43964910 CAGTTGGAGCAGAGTAAGCAAGG + Intergenic
973172858 4:47166806-47166828 GAGTGGGGGCAGAGAAGGGAGGG - Intronic
973580879 4:52342972-52342994 CAGTGTAAGTTGTGAAAGGAAGG - Intergenic
973808064 4:54544640-54544662 CAGTGTGGGAAGAGAAAGAAGGG - Intergenic
975260606 4:72293221-72293243 CAGTGTGAGCTGTGAAAACAAGG + Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
979606648 4:122645540-122645562 CAGTGATAACAGAGAAAGAAAGG + Intergenic
979615272 4:122735132-122735154 CGTTGGGAGCACAGAAAGGAGGG + Intronic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
980778511 4:137466150-137466172 CATTGTGAAAAGAGAAAGCATGG - Intergenic
981601261 4:146491634-146491656 CTGTGTGAAGAAAGAAAGGAAGG + Intronic
982219624 4:153113424-153113446 CAGTCTGAGCTGAGTAAGGAGGG - Intergenic
982268256 4:153560047-153560069 AAGTGTGAGTTGAAAAAGGAAGG - Intronic
983425278 4:167575681-167575703 AAGTCTGACCAGTGAAAGGATGG - Intergenic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
984414296 4:179436669-179436691 AACTGAGGGCAGAGAAAGGAAGG + Intergenic
984943487 4:184953648-184953670 CAGCGTGAGAAGAGGAAGAATGG + Intergenic
985917044 5:2930147-2930169 CAGTGGGAGAGGAGAAAGCAAGG - Intergenic
986532040 5:8747750-8747772 CAGAGAAAGAAGAGAAAGGATGG - Intergenic
986564618 5:9099914-9099936 CTCTGTGTGCAGAGAAAGAAAGG + Intronic
986778775 5:11045328-11045350 CAGTGTGTGCAGAGATCGTACGG + Intronic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
987167823 5:15219547-15219569 TAGTGTGGTCAGAGTAAGGAAGG + Intergenic
987607109 5:20151143-20151165 CAGGGTGGGGAGAGAAAGGGGGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989189587 5:38657389-38657411 CATGGTGAGAAGAGAAAGAATGG - Intergenic
989201743 5:38770626-38770648 CAGGGAGAGCAGAGAAGGGTGGG + Intergenic
989337499 5:40336031-40336053 CAGTGGGTGCAGACAATGGAGGG + Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990298793 5:54430221-54430243 TAGTGTGATCAGAGAAATGGAGG + Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
991306063 5:65177450-65177472 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
991361033 5:65820537-65820559 CATTTTGACCAAAGAAAGGAAGG + Intronic
991975539 5:72180636-72180658 CAGTTTGAGCAGACAAAGAACGG - Intronic
992378784 5:76216746-76216768 GAGTGTGGAGAGAGAAAGGAAGG - Intronic
993285793 5:85994080-85994102 CAGTGCAAGCAGAGAAACAAAGG - Intergenic
993473018 5:88329837-88329859 AATTGTGAGGAGAGAAAGGGAGG + Intergenic
993939502 5:94041375-94041397 CATTGTGAAAAGAGAAAGCACGG - Intronic
994075103 5:95641747-95641769 GAGTGTTAGCAGAGATAGGGAGG - Intergenic
994340719 5:98624727-98624749 CTGTGTGTACAGAGAAGGGATGG - Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995197459 5:109388138-109388160 AAGAGTGAGCAGAGAAATTAAGG - Intronic
995226739 5:109709022-109709044 CACTTTGAGTAGATAAAGGATGG + Intronic
995349968 5:111163901-111163923 CAGTGTGTGCAGAGATAACATGG + Intergenic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
995987663 5:118199290-118199312 CAATGTGAGGAGAGTACGGAGGG + Intergenic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
997676431 5:135716499-135716521 CAGTGAGAGCAGAGAATGTCTGG - Intergenic
998372167 5:141668919-141668941 CATTGTCAGGAGGGAAAGGAAGG + Intronic
998631408 5:143902924-143902946 GGGTGTGAGAAGAGAAAGGTTGG + Intergenic
999099885 5:149014786-149014808 CAGAGTGGGGAGAGAAAGGCAGG - Intronic
999361140 5:150987744-150987766 CAGTGCTGGCAGAGAAGGGAGGG + Intergenic
999635162 5:153614167-153614189 AAGTGTCAGAAGAGAAAGGGTGG - Intronic
999642904 5:153689758-153689780 CAATGTGAGTAGGGAGAGGATGG - Intronic
1000009289 5:157216620-157216642 CACTGTGGGGAGGGAAAGGAAGG + Intronic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1000592456 5:163174824-163174846 CATAGTGAGCAGAGAAGGAAGGG + Intergenic
1000668941 5:164035756-164035778 AAGAAAGAGCAGAGAAAGGAAGG - Intergenic
1001092053 5:168748768-168748790 TTGTGGGAGCAGAGAAAGAAAGG - Intronic
1001579137 5:172786698-172786720 CACAGTGGGCAGAGCAAGGACGG + Intergenic
1001946498 5:175782879-175782901 CAGTAGGAGCTGAGAAGGGAGGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002043153 5:176528726-176528748 CAGTGCCAGCAGGAAAAGGAGGG + Exonic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003558546 6:7162083-7162105 CAGTGTGTTTTGAGAAAGGAGGG - Intronic
1004472848 6:15944428-15944450 GAGTGAGACCAAAGAAAGGAAGG + Intergenic
1004721220 6:18268926-18268948 GAGTCTGAGCTGAGTAAGGAGGG + Intergenic
1004943263 6:20584348-20584370 CAGTGTGTTCTGAGAAAGCAGGG + Intronic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1005615372 6:27567529-27567551 CTGTGAGAGCAGAGAAGGCAGGG - Intergenic
1005976538 6:30804412-30804434 CAGTGTCAGCTGGTAAAGGAAGG + Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006813032 6:36832870-36832892 AACTGTGAGCTGGGAAAGGAGGG + Intronic
1007631745 6:43276697-43276719 CACTGAGAGCTGGGAAAGGAAGG - Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007762035 6:44138897-44138919 CAGTGAGCGCTGAGAAAGGCAGG + Intronic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1008624092 6:53300846-53300868 CAGTGTGAGCAGATAAGGATTGG - Intronic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1009862268 6:69349200-69349222 CAGCATGAGAATAGAAAGGAAGG - Intronic
1011530497 6:88315745-88315767 CAGGGTGGGAAGAGAAAGAAGGG + Intergenic
1011598081 6:89035407-89035429 AAATGTGAGCTGAGACAGGAAGG + Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1012985612 6:105873208-105873230 AAGTGTGAGCAGAGATAAGTAGG + Intergenic
1013290941 6:108718164-108718186 CAGTGTGAGAAGCCAGAGGAAGG + Intergenic
1013722834 6:113051425-113051447 CAGTTTGAGAAGAGAAATAATGG + Intergenic
1013733576 6:113200158-113200180 CCCTGTGAGGAGAGAAAGCATGG - Intergenic
1014024670 6:116631564-116631586 CACAGAGAGCAGAGAAAGGAGGG + Intronic
1014111627 6:117624111-117624133 CATTGTGAAAAGAGAAAGCACGG - Intergenic
1015017524 6:128432004-128432026 AAGTGAGGGAAGAGAAAGGAAGG + Intronic
1015138209 6:129898417-129898439 CAGTATGAGAAAAGAAAAGATGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1016216965 6:141616477-141616499 CAGTGGTAGCTCAGAAAGGAGGG - Intergenic
1016362867 6:143286873-143286895 TAGTGAGAGTAGAGAAAGTAAGG + Intronic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016687215 6:146895321-146895343 AAGTGTTTGCAAAGAAAGGATGG + Intergenic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017450552 6:154550962-154550984 CAAAGTCAGCAGAGAATGGAAGG - Intergenic
1017587652 6:155945103-155945125 CATTCTGATCAGAGATAGGATGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1018250244 6:161862364-161862386 AAGTGGGAGCAGAGAGAGTAAGG + Intronic
1018357467 6:163033730-163033752 CATTGTGAAAAGAGAAAGCATGG + Intronic
1018518635 6:164617250-164617272 CAGTATGGGAAGGGAAAGGAAGG - Intergenic
1018844497 6:167546506-167546528 CAGTGTGAGCTTAGAAATTAGGG - Intergenic
1019165109 6:170093586-170093608 CAGTTTGAGGAGGGAATGGATGG + Intergenic
1019257652 7:62142-62164 AAGTGGGAACACAGAAAGGAAGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019729574 7:2622736-2622758 CCCTGTGAGCACAGAAAGGCTGG - Intergenic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020223144 7:6256912-6256934 CAGTCTGACCACAAAAAGGAAGG + Intronic
1020231711 7:6324211-6324233 GAGGGTGAGCTGAGAAAAGAGGG - Intergenic
1020372660 7:7451039-7451061 ATGTGTGAGGAGAGAAGGGAGGG + Intronic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1021202831 7:17744392-17744414 CAGTGTGAGAACAGACAGGGGGG + Intergenic
1021576510 7:22110149-22110171 AAGTGAGGGCAGGGAAAGGATGG - Intergenic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022710606 7:32845780-32845802 TAGTGTGAGGAAAGTAAGGATGG + Intergenic
1023320361 7:38990731-38990753 CAGAGTGATCACTGAAAGGAGGG - Intronic
1023799091 7:43817976-43817998 CAGTCTGAGGAGAGTAAGGAGGG - Intergenic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1027853484 7:83479216-83479238 GAGTGAGAACAGAGAAAGCAGGG - Intronic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1028389064 7:90294547-90294569 CATTGTGAAAAGAGAAAGCATGG + Intronic
1028587056 7:92462781-92462803 CATAGTGAGGAGAGAAAGGAAGG - Intergenic
1029571651 7:101373716-101373738 AAGTGTGAGCACATAGAGGAGGG + Intronic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1030787970 7:113685482-113685504 CTCTGGGAGCTGAGAAAGGAGGG - Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1032362701 7:131271166-131271188 CAGTGGGACCAGGAAAAGGAGGG + Intronic
1032464879 7:132137861-132137883 GAGTGAGAGGAGAGAAGGGAGGG + Intronic
1032472506 7:132188750-132188772 CAGGCAGAGCTGAGAAAGGAGGG - Intronic
1032512921 7:132486446-132486468 CAGTCTGAGTTGGGAAAGGAAGG - Intronic
1032590803 7:133190569-133190591 AGCTCTGAGCAGAGAAAGGAGGG + Intergenic
1033161744 7:139002900-139002922 CATTGTGAAAAGAGAAAGCATGG - Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1034015939 7:147586512-147586534 CAGAGAGAGAAGAGGAAGGAAGG + Intronic
1034330351 7:150277382-150277404 AAGGATGAGCAGAGAAAGAAGGG - Intronic
1034433778 7:151053560-151053582 CAGAGTGAGGGGAGCAAGGATGG - Intergenic
1034667693 7:152832466-152832488 AAGGATGAGCAGAGAAAGAAGGG + Intronic
1034818812 7:154198033-154198055 CAGTGGGAGCACTGAATGGATGG - Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035215617 7:157364285-157364307 CAGTGTCACCAGAGAAAGCAAGG - Intronic
1035277168 7:157754528-157754550 CAGTGGGTGCAGAGAATGGAAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036009758 8:4708898-4708920 CAATGTGAGCAAATACAGGAAGG + Intronic
1036751857 8:11448711-11448733 CAATGTGAGCAGAGAGGGAAGGG - Intronic
1037009325 8:13821001-13821023 GGGTGTGTGCAGAGAAAGAAAGG + Intergenic
1037183782 8:16037194-16037216 GAGTATGAACAGAGAAAGGCAGG + Intergenic
1037415538 8:18645931-18645953 GAGTGTGTGCAGAGAGAGGTAGG - Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037838127 8:22226651-22226673 CAGTGAGAGAAGAGAAAGGTTGG + Intronic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1038319799 8:26515263-26515285 CAGCGTGAGAAGAGCCAGGAAGG + Intronic
1038800533 8:30744772-30744794 CAGTGGGGGCAGGGAAGGGATGG + Intronic
1038966858 8:32583297-32583319 CATCTTGAGCAGAAAAAGGAGGG - Intronic
1039248650 8:35636726-35636748 CCTTGTGAGAACAGAAAGGAAGG - Intronic
1039374938 8:37023861-37023883 CAGGGAGAGCAGAGATAGCAAGG - Intergenic
1039560752 8:38510633-38510655 CAGTTTGTGCAGAGCAGGGAGGG + Intergenic
1040724278 8:50362959-50362981 CCCTGTGGGAAGAGAAAGGATGG + Intronic
1041515449 8:58694667-58694689 CAGTCTGAGAAGAGTCAGGAGGG - Intergenic
1042203075 8:66300641-66300663 CAATTGGAGCACAGAAAGGAGGG + Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044252667 8:90022390-90022412 CAATGAGTGCATAGAAAGGATGG - Intronic
1044381951 8:91544635-91544657 GAGAGAGAACAGAGAAAGGAAGG - Intergenic
1044439610 8:92208209-92208231 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1045347354 8:101305036-101305058 CAGGGTGGGCAGGGAAAGGCAGG + Intergenic
1045367055 8:101486070-101486092 CAGTGATAGAAGAGTAAGGAAGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045428246 8:102088196-102088218 CATTGTGAAAAGAGAAAGCATGG - Intronic
1045465412 8:102465003-102465025 CATTCTGAGCTGATAAAGGACGG - Intergenic
1046561978 8:115849188-115849210 CAGATTGAGAAGAGAAAGGTGGG + Intergenic
1046816134 8:118585852-118585874 CACTGTGAGCAGAGAAAACAAGG - Intronic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1047992563 8:130301321-130301343 CAGTGTGTTCTGAGAAACGATGG + Intronic
1048340511 8:133534989-133535011 CAGTGTGGTCAGTGAAAGGAAGG + Intronic
1048692519 8:136983632-136983654 CAGTTTGTGCAGACACAGGAAGG - Intergenic
1049233623 8:141496932-141496954 CAGTGAGAGCAGAGCAAGGGAGG + Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049274974 8:141715748-141715770 CAGGGTGAGGAGAGAAAAAAAGG - Intergenic
1049681332 8:143919820-143919842 CAGTTTGAGCAGCTCAAGGACGG - Exonic
1050401636 9:5262284-5262306 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051225419 9:14893451-14893473 CAATGTGAAAAGAGAAAGCAGGG - Intronic
1051656543 9:19387339-19387361 CAGATGGAGCACAGAAAGGAAGG - Intergenic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1053067773 9:35080155-35080177 GACAGTGAGCAGAGAAAGGATGG - Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053476841 9:38388329-38388351 CAGTGGGAGAAGAGACAGGCAGG + Intergenic
1055084998 9:72304949-72304971 GAGAGTGGGCATAGAAAGGAGGG - Intergenic
1055252642 9:74326780-74326802 AAGAATGAGCAGAGAATGGATGG - Intergenic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1056433533 9:86552628-86552650 CAGTGGGAGCTGGGTAAGGATGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057050838 9:91922889-91922911 CAGTGTGCACCCAGAAAGGAGGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057183183 9:93040667-93040689 CAGTGTGAGGAGAGCAGGGTAGG - Intergenic
1057870897 9:98716430-98716452 CAGTGTTAGCAGAGTCAGCATGG - Intergenic
1058075866 9:100650280-100650302 CAGTGTGAGCATGGGTAGGAAGG + Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058511071 9:105717459-105717481 CTCTGTCAGCAGAGAAATGATGG + Intronic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058759344 9:108115443-108115465 CAGTATGAAAAGAGAAAGGGAGG + Intergenic
1058804526 9:108578032-108578054 GCGTGTGAGCAGAGAGAGAAGGG - Intergenic
1061287390 9:129631830-129631852 CAGTGCCAGCAGAGCACGGAGGG - Intronic
1061879617 9:133562267-133562289 CAGTGTGAGCAGAGCCTGCAGGG - Intronic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1186162244 X:6789530-6789552 CAGTGTGAACAAATAAAGAAGGG + Intergenic
1186259606 X:7762788-7762810 GAGTGTGAGCAGAGAATGAGGGG + Intergenic
1186378964 X:9036664-9036686 CAGTGTGAGTAAAGCATGGAAGG + Intronic
1186544442 X:10434288-10434310 GGGTGTAGGCAGAGAAAGGAGGG - Intergenic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1186992738 X:15086988-15087010 AAGGGTGAGTAGAGAAAGGAAGG + Intergenic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1187226837 X:17381020-17381042 CAATGTGAGGAGAGAAGGGAGGG + Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1188133869 X:26470634-26470656 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189104365 X:38220954-38220976 CAGGGGGGGCGGAGAAAGGAGGG - Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190474238 X:50812159-50812181 CGGTGTGAGGAGAAAAAGAAAGG + Intronic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190947515 X:55110068-55110090 CATTGTGAAAAGAGAAAGCATGG - Intronic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191800817 X:65077359-65077381 CAGTGGAAGCAGAGAAGGGCTGG - Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1192996777 X:76520637-76520659 GCGTGCTAGCAGAGAAAGGAGGG + Intergenic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1193804882 X:85983372-85983394 CAGAGAGAACAGTGAAAGGAAGG + Intronic
1194040829 X:88940465-88940487 CATTGTGAAAAGAGAAAGGATGG + Intergenic
1194276183 X:91885591-91885613 CAGTGTGTGCAGAAAAGGAAAGG - Intronic
1194767233 X:97855872-97855894 AAGTGTGAGATGATAAAGGATGG - Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196340097 X:114585004-114585026 GAGTGGGAGGAGAGAAAGGAGGG + Intronic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1197326915 X:125105691-125105713 CAGTGACAGCACAGAAAGGATGG + Intergenic
1197393329 X:125895533-125895555 CAGGGTGGGTAGAGAAAGGTAGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1198688166 X:139250082-139250104 CAGTGTGTGCAGAGATTGCATGG + Intergenic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200593431 Y:5107045-5107067 CAGTGTGTGCAGAAAAGGAAAGG - Intronic
1200884410 Y:8253687-8253709 CAGAGGGAAGAGAGAAAGGATGG + Intergenic
1200957966 Y:8970556-8970578 CAGAGGGAGGAGGGAAAGGATGG - Intergenic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic