ID: 961760991

View in Genome Browser
Species Human (GRCh38)
Location 3:129167708-129167730
Sequence GTTAAATGAGGTTTGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961760991 Original CRISPR GTTAAATGAGGTTTGGGGGC TGG (reversed) Intergenic
902548151 1:17203255-17203277 GTAAATTGAGGTTTGGGGTTTGG + Intergenic
902626384 1:17679023-17679045 GTTAAAGGAAATTTGGGGTCTGG + Intronic
902651750 1:17841919-17841941 GTTAAAAGAGGTTGGAGGACAGG - Intergenic
903288209 1:22290267-22290289 GTTAAAATAGGTGTGGGGGTAGG - Intergenic
903713060 1:25340230-25340252 GTAAAAAATGGTTTGGGGGCCGG - Intronic
904159071 1:28509097-28509119 TTTAAAAGAGGTATGAGGGCTGG - Intronic
905854311 1:41297554-41297576 ATTAAATGAAGTTGGGGGCCAGG - Intergenic
906498128 1:46320092-46320114 TTGAAATGAGATTTGGGGCCAGG - Intergenic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906992837 1:50756864-50756886 GGTAATTGAGTTATGGGGGCAGG - Intronic
907575927 1:55525678-55525700 GCTAAATGAGGGTAGGGGTCAGG - Intergenic
908812349 1:67995926-67995948 GTTAACAGGGGTTTGGGGGTGGG + Intergenic
909392658 1:75134869-75134891 GTTAAGTGAGCTTTTGGGGAGGG - Intronic
913168750 1:116212925-116212947 GTTAAATGAGGTTATGAGGATGG + Intergenic
913237000 1:116793882-116793904 GTTACCTGAGGTTAGGGGGAAGG - Intergenic
914719348 1:150276637-150276659 GTTGATTGGGGATTGGGGGCTGG + Intronic
919169432 1:193935159-193935181 GTTAATTGAGGTGTGAGTGCTGG + Intergenic
922689310 1:227675151-227675173 TTTAGATGAGGTTTGAGGGTAGG + Intronic
924456556 1:244223342-244223364 GTTCCATGAGGGATGGGGGCTGG + Intergenic
1063481628 10:6381599-6381621 GGTAACTGAGTTATGGGGGCGGG - Intergenic
1064298985 10:14104874-14104896 GTTGAGTGTGGTATGGGGGCAGG + Intronic
1065810716 10:29440647-29440669 GTTAGATGGGGGCTGGGGGCAGG - Intergenic
1069327690 10:67251313-67251335 GTTATCTGGGGGTTGGGGGCAGG + Intronic
1070289837 10:75107037-75107059 GTTAAAAGTACTTTGGGGGCCGG + Intronic
1071115956 10:82220520-82220542 TTTTCTTGAGGTTTGGGGGCAGG + Intronic
1071595083 10:86916165-86916187 GTCAAACGAGGTTTGTGGGTGGG + Intronic
1073049836 10:100660347-100660369 GGTATATGAGGTATGGGAGCGGG + Intergenic
1074253487 10:111777228-111777250 GTTACATGGGGTTTGGGGAGAGG + Intergenic
1075547281 10:123364386-123364408 GTTAAATGGGGTTGGGGGGAGGG + Intergenic
1076382546 10:130035342-130035364 GTTAAATGAGGTCTTTGGGGTGG - Intergenic
1076417881 10:130304529-130304551 TTCAAATGAAATTTGGGGGCGGG - Intergenic
1078060509 11:8039822-8039844 GTGAAATGGGGTTTAGGGGAGGG + Intronic
1083482907 11:62961136-62961158 GTTAAATGAGGTCATGGGGTGGG + Intronic
1085196031 11:74672298-74672320 GTAAAATGAGGTATTGGGGTGGG + Intergenic
1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG + Intergenic
1086764442 11:90676684-90676706 GATAATTGAATTTTGGGGGCAGG + Intergenic
1086878385 11:92125396-92125418 TCTGACTGAGGTTTGGGGGCAGG + Intergenic
1087034939 11:93745683-93745705 ATTATATAAGATTTGGGGGCCGG + Intronic
1087464664 11:98489540-98489562 GGAAAATGAGGTCTGGAGGCAGG - Intergenic
1087810796 11:102607512-102607534 GTCAGATGAGGTTTGAGGTCAGG + Intronic
1088908272 11:114171038-114171060 ATTAATTGAGATTTGGGGTCTGG + Intronic
1089736556 11:120553714-120553736 GTTAAAAGGGGTTAGGGAGCAGG + Intronic
1090154977 11:124427769-124427791 GTCAAAAGAGGTTTGGGGAGAGG - Intergenic
1090633905 11:128676307-128676329 GATAATTGAATTTTGGGGGCAGG + Intergenic
1092485856 12:8901563-8901585 AAGAATTGAGGTTTGGGGGCCGG - Intergenic
1093264387 12:16984579-16984601 GTTGAATGAGGTTAGAGGGTGGG + Intergenic
1097956860 12:65495285-65495307 GGGAACTGAGGGTTGGGGGCAGG + Intergenic
1099271713 12:80519196-80519218 TTAAAATAAGGTTTGGTGGCAGG - Intronic
1100782132 12:98038354-98038376 GTTAAATGAGGTTATTGGGGTGG - Intergenic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1102243130 12:111338080-111338102 TGTAAAAGAGATTTGGGGGCAGG - Intronic
1102651493 12:114445612-114445634 GTGAAATGAGATTCGGAGGCGGG - Intergenic
1103857653 12:123984596-123984618 GTTGAAAGGGGTGTGGGGGCCGG + Intronic
1104284856 12:127415767-127415789 GTAAAATGAGGTTTAGAGGGAGG - Intergenic
1105423338 13:20272445-20272467 CTTAAAGGAAGTTTGGGGGAAGG - Intergenic
1107589684 13:41889673-41889695 GTCAAAAGAGGTTTAGTGGCTGG - Intronic
1108155752 13:47583495-47583517 GGTAATTGAGTTATGGGGGCTGG - Intergenic
1109107812 13:58277409-58277431 GTTAATTGAATTGTGGGGGCAGG - Intergenic
1110831668 13:80038722-80038744 GCTAAATGAGTTTTGGTGGTGGG - Intergenic
1112736554 13:102427051-102427073 GTTAAATGAGGTTATGAGGAGGG - Intergenic
1113393685 13:109922187-109922209 GTTAGATAAGATTTGGAGGCTGG - Intergenic
1113395171 13:109940734-109940756 GTTAAATGTGGCCTAGGGGCAGG - Intergenic
1114432036 14:22670036-22670058 GTTAAATGAGGTCATGGGGGTGG + Intergenic
1114509779 14:23248734-23248756 ATAAAAAGAGGCTTGGGGGCCGG - Intronic
1116183678 14:41568870-41568892 CTCAAATAAGGTTTGAGGGCAGG + Intergenic
1118758810 14:68865018-68865040 CCTATATGAGTTTTGGGGGCAGG + Intergenic
1119414662 14:74461548-74461570 ATTGAATGAGGTTTTCGGGCAGG - Intergenic
1121224878 14:92314238-92314260 GTTAAAAAAGGGTTGGGGGTGGG + Intergenic
1121751858 14:96363728-96363750 GTTAAGAGGGGTCTGGGGGCCGG + Exonic
1124434110 15:29633662-29633684 GTGAAATGGGGTGAGGGGGCCGG + Intergenic
1125720692 15:41843802-41843824 GGAGGATGAGGTTTGGGGGCTGG + Exonic
1125743321 15:41982655-41982677 GGTAAATGAGGTTGGGGGCCAGG - Exonic
1127043489 15:55002289-55002311 GGTAATTGAGTTATGGGGGCAGG - Intergenic
1128639896 15:69328563-69328585 GGTATTTGAGGCTTGGGGGCAGG + Intronic
1129475012 15:75779248-75779270 GTGAAAGGAGGTTGGAGGGCTGG - Intergenic
1129838790 15:78730842-78730864 GTGAAAGGAGGTTGGAGGGCTGG - Intergenic
1130379069 15:83356516-83356538 TTTAAATTGAGTTTGGGGGCGGG - Intergenic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1132736700 16:1389612-1389634 ATGAAATGAGGTGTGGGGGCAGG + Intronic
1134083743 16:11342316-11342338 GATACATGAAGTTTGGGGTCAGG + Intronic
1136367435 16:29815226-29815248 CTTAGACGAGGCTTGGGGGCAGG + Intronic
1137429819 16:48409574-48409596 GTTAAATAAGGTTTGTAGGCTGG - Intronic
1139115938 16:63953110-63953132 GGTAATTGAATTTTGGGGGCTGG - Intergenic
1140245130 16:73241492-73241514 ATAAAAGGAGGGTTGGGGGCCGG + Intergenic
1140695913 16:77533983-77534005 CTTAAATGAGTTTTGGGGGGGGG + Intergenic
1141183911 16:81773579-81773601 TTTACATGAGGTTTGGGGCCTGG + Intronic
1142137368 16:88457784-88457806 GCTAAATGTGGCTTGAGGGCAGG - Intronic
1142138509 16:88462227-88462249 GTGAAATGGGTGTTGGGGGCTGG + Intronic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1146717047 17:35095185-35095207 GTTAAATTAAATTTGGGGTCGGG + Intronic
1146790150 17:35746330-35746352 GGTAGATGAGGACTGGGGGCTGG + Exonic
1147795747 17:43041510-43041532 GATAAATAAGGTTTGTGGGCTGG - Intergenic
1148722659 17:49764528-49764550 GTGAAATAATTTTTGGGGGCGGG + Intronic
1149081525 17:52664245-52664267 GTGAAATGAGGGATGGGAGCAGG - Intergenic
1150452083 17:65277660-65277682 GTTAGAGGAGGTTGGGGGGAGGG - Intergenic
1150927597 17:69549883-69549905 GTGAAGTCATGTTTGGGGGCTGG + Intergenic
1151182345 17:72338414-72338436 GATAAATGAGGTCTGGGGAGGGG + Intergenic
1155123536 18:22847389-22847411 GTGACATTAGGTTTGGGGCCAGG - Intronic
1156480040 18:37430590-37430612 GATAACTGAGGTTTAGGGCCTGG + Intronic
1158965973 18:62622571-62622593 TTTAAAAAAGGTTTGGAGGCCGG + Intergenic
1159089766 18:63834470-63834492 TTTAAGTGAGTTGTGGGGGCAGG + Intergenic
1161664283 19:5565561-5565583 CTTCTATGAGGTCTGGGGGCTGG - Intergenic
1162257025 19:9498800-9498822 GTTAAATCAGGGCTGTGGGCGGG + Intergenic
1163511024 19:17735070-17735092 GTTGAATGTGTTTTGGGGGCTGG - Intergenic
1163985773 19:20949234-20949256 GTTTAATAAGGTTTGAGGACTGG - Exonic
1163996872 19:21057961-21057983 GTTCAATAAGGTTTGAGGACTGG - Exonic
1164009233 19:21183953-21183975 GTTTAATAAGGTTTGAGGACTGG - Exonic
1164020009 19:21293318-21293340 GTTTAGTAAGGTTTGGGGACTGG + Exonic
1164649683 19:29882852-29882874 CTGAAATGAGGGCTGGGGGCAGG - Intergenic
1164887390 19:31793432-31793454 GCAAAATGAGTTTTTGGGGCTGG - Intergenic
1166422922 19:42652598-42652620 GAAAAATGGGGTGTGGGGGCAGG - Intronic
1167506829 19:49875447-49875469 GTTCAGTGGGGTTTTGGGGCTGG - Intronic
1168183259 19:54678375-54678397 GTGAAAAGTGGTTTGGAGGCCGG + Intronic
1168460722 19:56554834-56554856 GTTGAATGAGGTGTGTGGTCTGG - Exonic
925743738 2:7027968-7027990 GTGAGATGAGGGTGGGGGGCGGG + Intronic
926224256 2:10956027-10956049 ATTAACTGAGCTTTGGGGACTGG + Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927910032 2:26890928-26890950 GTTAAATGAGGTCATAGGGCAGG - Intronic
928032518 2:27794001-27794023 ATTAAAGAAGTTTTGGGGGCTGG + Intronic
928578458 2:32680568-32680590 GTGAAATGAGGGATGGGGGAAGG + Intronic
929561673 2:42960215-42960237 GTGAAGTGAGCTCTGGGGGCTGG + Intergenic
929910849 2:46088340-46088362 GCTACATGGGGTTTTGGGGCTGG - Intronic
930337571 2:50069309-50069331 GCAAAATGAGATTTGGGGACTGG + Intronic
930702213 2:54469682-54469704 GTTAGAGGAGGGTAGGGGGCTGG + Intronic
930807073 2:55501734-55501756 GTTCACTGAGGTTTTGTGGCCGG - Intergenic
930809976 2:55530116-55530138 GGTAATTGAATTTTGGGGGCAGG + Intronic
931022939 2:58070478-58070500 GTTGCCTGAGGTTTAGGGGCAGG - Intronic
931973424 2:67615811-67615833 TCTAAAAGAGGTTTGGTGGCAGG + Intergenic
934897227 2:98129444-98129466 GTTAAATGAGGTCATAGGGCAGG - Intronic
935109158 2:100075998-100076020 GTTAAATCTGGTTTGTGGACAGG + Intronic
935427868 2:102940119-102940141 GTTAAATGAGGTGATGGGGTGGG + Intergenic
935802776 2:106715152-106715174 GTTAAATGAGGTATAAGGGTGGG - Intergenic
936781771 2:116041577-116041599 TTCAAATGAGATTGGGGGGCTGG + Intergenic
939064969 2:137471727-137471749 GTGAAATGGGGTTTAGGTGCAGG + Intronic
939256566 2:139751199-139751221 GTTAAATGAGGTTGTGAGGGTGG - Intergenic
939726566 2:145727766-145727788 GTTAAGTGCTGTTTGGGGGTGGG - Intergenic
939869458 2:147510719-147510741 GGTAAATGAGGTTTTAGGCCTGG - Intergenic
940866850 2:158825924-158825946 TTTAAACTAGTTTTGGGGGCTGG + Intronic
941718630 2:168789489-168789511 GTTAATTGAGTTATTGGGGCAGG - Intronic
941836149 2:170022899-170022921 TTTAAATGAGGTCTGGGAACAGG - Intronic
942190482 2:173464388-173464410 TTTAAATGCAATTTGGGGGCTGG - Intergenic
942253972 2:174073294-174073316 GTTAAAAGAGATTTGAGGCCAGG - Exonic
942338186 2:174914185-174914207 ATTAAATGAGGTTAGAGGCCTGG + Intronic
946139683 2:217679117-217679139 GTTATATGAAGTTTGAGAGCAGG - Intronic
946417160 2:219545754-219545776 GGCAAATGAGTCTTGGGGGCTGG + Intronic
946563297 2:220936997-220937019 GCAAAAGGAGGTTTGGGGGAAGG + Intergenic
948104562 2:235402927-235402949 GTTAAACGAGGTTGGGGAGGTGG + Intergenic
949031245 2:241798537-241798559 GTTGGATGAGGTTTGAGGGCGGG - Intronic
1169070766 20:2728508-2728530 GGGAAAAGAGGTTCGGGGGCGGG + Intronic
1169926800 20:10792508-10792530 GATACATGTGGTTTGGGGGTGGG - Intergenic
1171382405 20:24743515-24743537 ATTAAATTAGAATTGGGGGCAGG + Intergenic
1172714584 20:36953269-36953291 GTTAAAGGGGGTTTGGGGCTGGG + Intergenic
1172906401 20:38373320-38373342 CTCTAATGAGGGTTGGGGGCTGG + Intronic
1173060229 20:39653484-39653506 GTTTTATAAGATTTGGGGGCTGG + Intergenic
1173733025 20:45341629-45341651 GTTAAACCAGGTCTGGGGGTGGG + Intronic
1174028416 20:47599368-47599390 GTTATATGAGGTTGAGGGGGTGG + Intronic
1175578904 20:60083858-60083880 GTGAAATGAAGTTTGGGAGATGG + Intergenic
1177114332 21:17067118-17067140 GTTAAATGAGATTTTGAAGCTGG - Intergenic
1178147671 21:29758479-29758501 GGTAATTGAATTTTGGGGGCAGG - Intronic
1179286226 21:39979466-39979488 GCTACATGAGTTGTGGGGGCAGG + Intergenic
1181471591 22:23143793-23143815 GCTAAAGGAGGATTGGGGCCAGG + Intronic
1182493300 22:30688667-30688689 GTTAAATGAGGTTATGGAGTAGG - Intergenic
1184823575 22:46931685-46931707 TTTAAGTGAGGTGTGGGGCCAGG - Intronic
951191874 3:19781347-19781369 GTTTACTGAGTTTTGGGGGAAGG - Intergenic
955296012 3:57735665-57735687 GTTAACTGAGGGTTGGTTGCAGG - Intergenic
956538825 3:70310677-70310699 TTTAAATTAGGGTTGGGGGTAGG + Intergenic
959131003 3:102355979-102356001 GTTAAATGAGGTTAGAGGAGTGG - Intronic
961713151 3:128842455-128842477 GGTAATTGAGTTATGGGGGCGGG - Intergenic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
962509625 3:136085197-136085219 GTTAATTGAGTCATGGGGGCGGG + Intronic
964116862 3:153145427-153145449 GTAGAATGAGGATTGGGGGCAGG - Intergenic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
965141092 3:164835472-164835494 GTTAAATGAAGATTCTGGGCTGG - Intergenic
966673611 3:182560131-182560153 GTTAAATGAGGTATTTGGGGTGG - Intergenic
966898045 3:184460417-184460439 GTAAGACGGGGTTTGGGGGCTGG + Intronic
967044088 3:185720457-185720479 TTTAAATAGGCTTTGGGGGCCGG - Intronic
967397830 3:189026348-189026370 GTTAAATGAGATCTGAAGGCTGG - Intronic
968406536 4:344498-344520 TTAAAATGTGGTTTGGGGCCGGG + Intronic
969189146 4:5502893-5502915 TTCAAATGAGATTTGGGGCCCGG + Intergenic
969371534 4:6734365-6734387 GTGAAATGAGGTTGGGGAGGGGG - Intergenic
971496892 4:27276040-27276062 GTTTCATGAGTTTTGGGGCCAGG + Intergenic
971823073 4:31585017-31585039 GTTAAATGAGGTTATAGGGTGGG - Intergenic
975966262 4:79976206-79976228 TTTAAATGCGATTTGAGGGCCGG - Intronic
976066927 4:81198363-81198385 GTTAAATAAGCTTTGGCAGCCGG - Intronic
976096942 4:81518266-81518288 GAGAGATGAGGTTTGGAGGCAGG - Intronic
976766845 4:88606762-88606784 GGTAAATGAATTATGGGGGCAGG - Intronic
980274073 4:130625441-130625463 GATAAATGAATTATGGGGGCAGG - Intergenic
980692534 4:136313777-136313799 GATGAATGAGGTATGGGGGAAGG - Intergenic
985658354 5:1143505-1143527 GTTAAATGAGGTTGTGAGGAAGG - Intergenic
985765552 5:1777598-1777620 GTTAAATGAGGTTGTGAGGAGGG + Intergenic
987806497 5:22775862-22775884 GGTAATTGAATTTTGGGGGCCGG + Intronic
987969542 5:24924742-24924764 GTTAAATGAGGTTATGTGGGTGG + Intergenic
990251991 5:53925505-53925527 ATTAAGTGAGGTTTGGGGCAGGG + Intronic
990496128 5:56349884-56349906 GTTGAGTGAGGATTTGGGGCTGG - Intergenic
993680823 5:90875368-90875390 GTCAAATAAGCTTTGGTGGCTGG - Intronic
994466483 5:100139803-100139825 GTTAAATGAGGTCTGAAGGTGGG - Intergenic
997947789 5:138217724-138217746 ATTAAAAGATATTTGGGGGCTGG - Intergenic
998877677 5:146617210-146617232 GTTACCAGAGGTTGGGGGGCAGG + Intronic
1000662742 5:163956297-163956319 GTTAAATGAGGTCATGGGGTGGG + Intergenic
1000741337 5:164973692-164973714 GGTAAATGAATTATGGGGGCAGG + Intergenic
1001654145 5:173336514-173336536 GTTAACTGAGGCTTGGAGGGTGG - Intergenic
1001698038 5:173686974-173686996 GGGAAATGAGTTTTGGGGACTGG - Intergenic
1003256527 6:4479998-4480020 GTTAAATGAGGTTGTGAGGGTGG - Intergenic
1003973012 6:11317135-11317157 GTTAAATGAGATAGGGGGCCAGG + Intronic
1004471947 6:15937500-15937522 GTTAAATGAGGTTATGTGGGTGG - Intergenic
1004651572 6:17614607-17614629 GTGGATTGTGGTTTGGGGGCGGG + Intergenic
1007102538 6:39259630-39259652 GTTAAATCAGGATTGGGAGAGGG - Intergenic
1007518837 6:42435677-42435699 GTTAAATAAGTTATGGAGGCCGG + Intronic
1008508475 6:52254021-52254043 AATAAATGAGGTTGGGGGGCAGG - Intergenic
1008524015 6:52389503-52389525 GATAGATAAGGGTTGGGGGCGGG + Intronic
1010203548 6:73303243-73303265 GTTACAAGAGATTTGGGGGTGGG + Intronic
1011080801 6:83488781-83488803 GTTAAATGAGGTCTTGGGGTGGG - Intergenic
1011945550 6:92897638-92897660 GTTAAATGTGGGGTGGGGGTAGG + Intergenic
1014701563 6:124695343-124695365 CTTAAATGAGTTTTGATGGCTGG - Intronic
1014995340 6:128136023-128136045 GTTAAATGAGGTTTTTAGGGTGG + Intronic
1015746332 6:136513822-136513844 GTTAAATGAGGTTTGCCAGGTGG + Intronic
1016526066 6:145002823-145002845 GTAGAATTAGGTTTGGAGGCAGG + Intergenic
1017205492 6:151800511-151800533 GTTAAATGATGTTTTAAGGCTGG + Intronic
1019366443 7:635771-635793 GGTGAATGAGCTTTGGAGGCAGG + Intronic
1019852594 7:3574410-3574432 GTCAAATGAGGTATGTGAGCCGG - Intronic
1022211019 7:28209506-28209528 GTTAAATGAGGTTTCTGGAATGG + Intergenic
1023597365 7:41845313-41845335 GTTAAATGAGGTTTCAAGGACGG - Intergenic
1024061312 7:45700565-45700587 GTTCAGTGAGGTTTGGGGAGAGG + Intronic
1026473008 7:70710225-70710247 GTTAGATGAGGGTGGGGGGCAGG + Intronic
1026744579 7:73001131-73001153 TTTAAAAGAGGTATGGAGGCCGG - Intergenic
1027030687 7:74885796-74885818 TTTAAAAGAGGTATGGAGGCCGG - Intergenic
1027057928 7:75063092-75063114 GTTTAATAAGATTTTGGGGCCGG - Intronic
1027099158 7:75363961-75363983 TTTAAAAGAGGTATGGAGGCCGG + Intergenic
1028766523 7:94565735-94565757 GTTAGATGAGGTTAGGAGACTGG - Intergenic
1028878873 7:95856682-95856704 GTTAAATTTGGTTTGCTGGCCGG + Intronic
1029400258 7:100340741-100340763 TTTAAAAGAGGTATGGAGGCCGG + Intronic
1030244555 7:107368046-107368068 GGCAAATGAGGATGGGGGGCGGG + Intronic
1033511982 7:142068291-142068313 GTATAATGAGATTTTGGGGCCGG - Intronic
1034029524 7:147744821-147744843 GTTAAATGAGGTTGGAGGGTGGG - Intronic
1034816721 7:154178322-154178344 TTTAAAAGAGGTGTGGGGCCTGG - Intronic
1036915897 8:12803400-12803422 GTAAAATGAGGTAAAGGGGCAGG + Intergenic
1037127472 8:15368599-15368621 GTTAAATGAGGTCTTCGGGATGG + Intergenic
1037851325 8:22331832-22331854 GTTAAATGAGGTCATGGGGGTGG - Intronic
1038851598 8:31283385-31283407 GTCAAATGAGGTATCAGGGCAGG - Intergenic
1039398232 8:37245735-37245757 GTTTATTGACGGTTGGGGGCAGG + Intergenic
1039801580 8:40961311-40961333 ATTAAATGAGTTTCGAGGGCTGG - Intergenic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1043439108 8:80261111-80261133 GTTAGAGGAGGATTGGGAGCAGG - Intergenic
1044999987 8:97870220-97870242 ATTAAATGAGATATGGCGGCCGG + Intronic
1045126720 8:99099836-99099858 GTTATATGAGGTATGGGGAGAGG + Intronic
1045652811 8:104357223-104357245 GTTAAAAGTGATATGGGGGCTGG - Intronic
1052245641 9:26330606-26330628 ATTTAATGATGCTTGGGGGCAGG - Intergenic
1052467066 9:28841930-28841952 TATAAATGAGGTTTGGGGGTAGG + Intergenic
1052885764 9:33646919-33646941 GTAAAATGCGGTTGGGGGCCGGG + Intergenic
1053071702 9:35105846-35105868 GTTAAATAAGGTCTAGGGACAGG + Exonic
1053182575 9:35986435-35986457 TTTAAAAGACATTTGGGGGCCGG + Intergenic
1053654626 9:40204268-40204290 GTTAAATGAGGTCATGGGGTGGG - Intergenic
1054366741 9:64350485-64350507 GTTAAATGAGGTCATGGGGTGGG - Intergenic
1054529969 9:66172042-66172064 GTTAAATGAGGTCATGGGGTGGG + Intergenic
1054674370 9:67840227-67840249 GTTAAATGAGGTCATGGGGTGGG - Intergenic
1054763328 9:69022494-69022516 GTTAAAAGAGATTTTTGGGCCGG - Intergenic
1056037566 9:82623250-82623272 GTTAAATGAGGTCATTGGGCTGG + Intergenic
1056203035 9:84294931-84294953 GTTAAATGAAGGTTGGGAGGTGG + Intronic
1057466196 9:95317006-95317028 GGCGAATGGGGTTTGGGGGCAGG + Intronic
1057771917 9:97975772-97975794 GTTACCAGAGGTTTGGGGGAAGG - Intergenic
1058115620 9:101081168-101081190 ATTTAATGTGGTTTGGGGGGTGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062192003 9:135252917-135252939 GTGACATGAGGTTTGGGTCCAGG - Intergenic
1185739917 X:2523525-2523547 ATTAGATGGGGTTTGGGGGCCGG - Intergenic
1186760052 X:12713746-12713768 GAAGAATGTGGTTTGGGGGCTGG - Intronic
1186954013 X:14660123-14660145 GTTAAGTGCTGTTGGGGGGCAGG + Intronic
1187961052 X:24566730-24566752 GAAAAATGAGTGTTGGGGGCAGG - Intronic
1190382687 X:49854990-49855012 GTCAGATGGGGTTTGGGGACTGG - Intergenic
1190777442 X:53564384-53564406 ATTAAAAGAGGGGTGGGGGCAGG - Intronic
1192551688 X:72059561-72059583 GTAAAATGAGGTTTGGAGAGAGG - Intergenic
1194571233 X:95556430-95556452 CTTAGAAGAGTTTTGGGGGCTGG - Intergenic
1195313042 X:103652713-103652735 CTTAAAAGATGTTTGGGGCCAGG - Intergenic
1198546253 X:137695715-137695737 GATGAATGAGGTTTTGGGGAGGG - Intergenic
1199322567 X:146457485-146457507 TTTAAATGTGGTTTGGGGTAAGG - Intergenic
1199595610 X:149504094-149504116 GTGCACTGAGGGTTGGGGGCGGG - Intronic
1199598268 X:149525117-149525139 GTGCACTGAGGGTTGGGGGCGGG + Intronic