ID: 961761247

View in Genome Browser
Species Human (GRCh38)
Location 3:129169969-129169991
Sequence ACATAGAACATACAGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961761247_961761251 24 Left 961761247 3:129169969-129169991 CCACTCAACTGTATGTTCTATGT 0: 1
1: 0
2: 2
3: 23
4: 205
Right 961761251 3:129170016-129170038 ATGTTATTTAATAGCTACTGAGG 0: 1
1: 0
2: 0
3: 25
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961761247 Original CRISPR ACATAGAACATACAGTTGAG TGG (reversed) Intronic
901003190 1:6159255-6159277 ACACAGAACATACAGGCAAGAGG + Intronic
902857546 1:19219938-19219960 AGAAAGAACATACAGATGACTGG + Intronic
903644290 1:24884284-24884306 ACACTGAACATACAATTCAGTGG + Intergenic
905959475 1:42031856-42031878 ACAGAGAAAATATAGTTGTGAGG - Intronic
906973226 1:50540972-50540994 AGCTAGAACATACATTTCAGAGG - Intronic
907203880 1:52752063-52752085 ACATAGACCTCACAGGTGAGGGG + Intronic
907838934 1:58137817-58137839 ATAGAGAACATACAGGTGAGAGG + Intronic
909253639 1:73390378-73390400 AAATAGAACATACAGATAAATGG - Intergenic
909480090 1:76121385-76121407 ACAGAGAACAGACAGTGGGGAGG - Intronic
909541166 1:76793038-76793060 ACATAGAACTTACAGTTTAGTGG - Intergenic
910186429 1:84546112-84546134 ACATAGATCTTACAGTCCAGTGG + Intergenic
910457744 1:87415481-87415503 ACATAGAAAATATAGCAGAGAGG - Intergenic
911848654 1:102786159-102786181 AAATAGCACATAGAGTTGAGAGG - Intergenic
914315014 1:146501953-146501975 ACATAGAAAATATAGCAGAGAGG - Intergenic
916598764 1:166272150-166272172 TCATAGAACTTACAGTCTAGTGG + Intergenic
923858931 1:237873544-237873566 ACACAGAACATCAAGTTGACTGG + Intergenic
924151794 1:241137145-241137167 ACATAGATCCCAGAGTTGAGGGG - Intronic
1063294596 10:4791772-4791794 ACAAAAAAATTACAGTTGAGTGG + Intronic
1065677676 10:28195899-28195921 ACTTAAAACATACAATTCAGTGG - Intronic
1066366479 10:34781772-34781794 ACCTAGAACACACAGTTCTGTGG + Intronic
1066466054 10:35651294-35651316 ACAGAGAACATAGAATTCAGGGG + Intergenic
1067379046 10:45755590-45755612 ACATAGGACTTACATTTAAGAGG - Intronic
1067886749 10:50096253-50096275 ACATAGGACTTACATTTAAGAGG - Intronic
1067982318 10:51100398-51100420 TCATGGAACATACTTTTGAGTGG - Intronic
1070140729 10:73735132-73735154 AAATAGAACAAACAGCAGAGAGG - Intergenic
1070495627 10:77019121-77019143 ACAGAGAAGATACATTTGTGAGG + Intronic
1072188905 10:93065073-93065095 ACATCGCACATACAGTGGAGGGG + Intronic
1073796561 10:106994979-106995001 AAATAAAACATACAGGAGAGTGG + Intronic
1077910020 11:6565341-6565363 GCATAGAAAATACAGAAGAGAGG + Intronic
1078890594 11:15553604-15553626 ACATAGAAGTTACATTGGAGAGG + Intergenic
1078937084 11:15961452-15961474 ACACAGAACTCACAGTGGAGGGG + Intergenic
1079068538 11:17321069-17321091 ACAAAGGATAAACAGTTGAGGGG - Intronic
1079851904 11:25545457-25545479 ATTTAAAACATACAATTGAGTGG - Intergenic
1080434918 11:32230954-32230976 ACACAAAACATATAGTTGATAGG - Intergenic
1080704997 11:34682293-34682315 ACATAAAATATATACTTGAGAGG - Intergenic
1080807312 11:35665215-35665237 ACATTTAACATACATTTAAGTGG + Intronic
1081345610 11:41982005-41982027 ACAAAGAACACAAAGTTGAGGGG + Intergenic
1082926867 11:58557900-58557922 ACATTGAATTTACAGTTTAGGGG - Intronic
1085626373 11:78076844-78076866 ACAAAGGAGATACAGTTGGGAGG - Intronic
1086053566 11:82621991-82622013 AAATAAAACAAACAGGTGAGAGG + Intergenic
1087463906 11:98480091-98480113 ACAAAGAACATGCACTTCAGAGG + Intergenic
1089036000 11:115392225-115392247 GCATAGAACATATATTTGAGTGG - Intronic
1090866627 11:130706535-130706557 ACATAGACCAGACAATTGATTGG - Intronic
1092051526 12:5474253-5474275 AAAGAGAGCATACAGTTAAGTGG + Intronic
1092319724 12:7459712-7459734 AAACAGAACAAACAGGTGAGAGG + Intronic
1092501496 12:9051917-9051939 ACAGAGAACATCCTGTTGATTGG - Intergenic
1093084256 12:14849099-14849121 ACAAAGAAGCTACAGCTGAGTGG - Intronic
1093748703 12:22773291-22773313 AAATTCTACATACAGTTGAGGGG - Intergenic
1094306531 12:29026134-29026156 ACTAAGAAGATAAAGTTGAGCGG + Intergenic
1094401288 12:30062531-30062553 ACATATTACATACCATTGAGAGG - Intergenic
1094628164 12:32146006-32146028 TTATAGAACTTAGAGTTGAGTGG + Intronic
1095706683 12:45244465-45244487 ACATTTTCCATACAGTTGAGGGG - Intronic
1099924094 12:88996375-88996397 ACATGGAACATAAAGTAGAGAGG + Intergenic
1100487297 12:95042550-95042572 AGATAGAAGATACCTTTGAGGGG - Intronic
1100839651 12:98599431-98599453 ATGTAGAACATAAACTTGAGAGG + Intronic
1101440257 12:104698662-104698684 ACAGATAACAGACAGTTGAGTGG - Intronic
1106577897 13:30992891-30992913 ACATAGAATATATTGTTGGGAGG + Intergenic
1110479594 13:75958993-75959015 ACTTAGAAAATAAAGTTGAGGGG - Intergenic
1111253435 13:85636136-85636158 AAATAGAACATTCAGTAAAGTGG - Intergenic
1111749633 13:92312309-92312331 ATATAGTCCATACTGTTGAGTGG + Intronic
1113053993 13:106247878-106247900 ACATAAAAGAAACAATTGAGAGG + Intergenic
1115170393 14:30498387-30498409 TCATGAAACTTACAGTTGAGTGG - Intergenic
1115196001 14:30800003-30800025 ACGTAGAACAGACTGGTGAGGGG - Intergenic
1116214569 14:41995764-41995786 AGATAGAACATACATTTTAAAGG + Intergenic
1118434587 14:65757978-65758000 ACTTAGAACACAGAGTTGTGAGG + Intergenic
1119388230 14:74272313-74272335 ACATAGACCATACAGTTGGTAGG + Intergenic
1119591731 14:75895095-75895117 AAATAGAAAATACATTTTAGGGG + Intronic
1119597466 14:75948710-75948732 AAAATAAACATACAGTTGAGAGG + Intronic
1119997366 14:79268145-79268167 CCATGGAACATACATTTTAGTGG + Intronic
1120814810 14:88844850-88844872 ACATAGAAAACACAATTAAGGGG - Intronic
1123767411 15:23495319-23495341 ACAAAGAATAAACACTTGAGGGG + Intergenic
1124245179 15:28063698-28063720 CAATAGAACAAACAGGTGAGAGG - Intronic
1125106026 15:35972266-35972288 ACCTAGAAAATACATTTGACAGG - Intergenic
1125452587 15:39824561-39824583 TCATAAAACTTACAGTTTAGTGG - Intronic
1131794972 15:96007005-96007027 ACAGAGAACAGAGAGATGAGGGG - Intergenic
1134307304 16:13044497-13044519 ACATAGATCTTACAGATTAGTGG + Intronic
1135714237 16:24747397-24747419 TCATAGAACTTACAGATGTGAGG + Intronic
1135832375 16:25787386-25787408 TAAAAGAACATACAGTTGAGTGG + Intronic
1136361651 16:29784379-29784401 ACATAGAAAGTACACCTGAGTGG - Intergenic
1137475336 16:48803349-48803371 AGACAGAACTCACAGTTGAGTGG - Intergenic
1138053757 16:53811141-53811163 ACATAGTGCATACAGTTTGGTGG - Intronic
1138724985 16:59126209-59126231 ATATAGAAGATACAGTTAAAGGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141964916 16:87435432-87435454 ACAGAGGACATGCAGATGAGGGG - Intronic
1144066563 17:11629633-11629655 ACCTAGACCCTACAGATGAGAGG - Intronic
1144223350 17:13120302-13120324 ACATAGAAGATGCAGGGGAGAGG + Intergenic
1150503766 17:65677503-65677525 ACATGGAACATACATTTAAATGG + Intronic
1151157879 17:72139465-72139487 ACATAGAACACACAGCTTAATGG - Intergenic
1153284368 18:3444781-3444803 ATAATGAACATACATTTGAGTGG + Intronic
1153946801 18:10025591-10025613 TCATAGAACAGAAAGTTGAAGGG + Intergenic
1155790601 18:29964592-29964614 AAAGAGAAAATACAGTTTAGAGG + Intergenic
1156332661 18:36139035-36139057 GTATAGAACATAAAGTTAAGGGG + Intronic
1158108174 18:53908693-53908715 ACAAAGAACAAGCAGCTGAGAGG + Intergenic
1159091153 18:63850936-63850958 AAACAGAAAATACAGTTCAGAGG - Intergenic
1159346847 18:67216695-67216717 ACATGGATCATACAGATCAGAGG - Intergenic
1160206513 18:76838128-76838150 GCAGAGAACATTCAGTGGAGGGG + Intronic
1164784640 19:30920369-30920391 ACACAAAACATACATTTGAAAGG + Intergenic
1165147831 19:33743143-33743165 ATATAGAACACACTGGTGAGAGG - Intronic
1166175655 19:41067407-41067429 ACGCAGAACATGCAGGTGAGGGG + Intergenic
1166438077 19:42786351-42786373 ACAGAGAACATCCAGGTGACTGG + Intronic
1166466979 19:43041014-43041036 ACAGAGAACATCCAGGTGACTGG + Intronic
1166473110 19:43097090-43097112 ACAGAGAACATCCAGGTGACTGG + Intronic
1166486782 19:43220629-43220651 ACAGAGAACATCCAGGTGACTGG + Intronic
1166493893 19:43284076-43284098 ACAGAGAACATCCAGGTGACTGG + Intergenic
1167021635 19:46880930-46880952 AAAAAGAACATTCATTTGAGAGG - Intergenic
1167986467 19:53322291-53322313 AAATAAAAAATACACTTGAGAGG - Intergenic
1168286508 19:55337381-55337403 ACATAGACCATACACTTGTTTGG - Intergenic
925677721 2:6383252-6383274 ACATTGGACATACACTTGAGAGG - Intergenic
926189435 2:10717172-10717194 AAAAAGAAAATACAGATGAGAGG + Intergenic
926893060 2:17654950-17654972 CCATAGAACATACTCTTTAGTGG + Intronic
928702038 2:33908806-33908828 ATGTAGAACATACAGTTTAGTGG - Intergenic
928974903 2:37076187-37076209 TCAAAGAACTTACAGTTTAGTGG - Intronic
930261005 2:49145968-49145990 ACATAGAGCATAGGGTTGAGAGG + Intronic
930358923 2:50353845-50353867 GCATAGAACATACACTAGAGGGG + Intronic
933800562 2:85957090-85957112 AAATAGAACATATAGTGGACTGG + Intergenic
935176709 2:100655266-100655288 ACCTAGAAGATTCATTTGAGAGG + Intergenic
938750411 2:134323214-134323236 ACATATAACAAACAGCTGTGGGG - Intronic
941123343 2:161557481-161557503 ACATACAACAGAGAGATGAGTGG + Intronic
941654304 2:168126754-168126776 TCAAAGAACCTACAGGTGAGGGG + Intronic
941729511 2:168900616-168900638 AACTAGAGAATACAGTTGAGAGG - Intronic
942876817 2:180810261-180810283 TCATAGAACGTAGAGTTGAATGG + Intergenic
1172027386 20:31958084-31958106 ACATATCAAATACAGTAGAGAGG - Intergenic
1172667527 20:36610983-36611005 AAATAAAGCGTACAGTTGAGAGG - Intronic
1174580971 20:51571363-51571385 ATATAGACAACACAGTTGAGTGG + Intergenic
1174713525 20:52732152-52732174 ACATAGAATTTAGAGTTGGGTGG + Intergenic
1175232920 20:57485941-57485963 ACATAGAACTTAAGGTAGAGGGG - Intergenic
1175649166 20:60702336-60702358 ATATAGACCATACAGTTAAATGG + Intergenic
1175853653 20:62107320-62107342 TCATGGAGCATCCAGTTGAGAGG - Intergenic
1177107829 21:16982117-16982139 AAAAAGAACATACTGATGAGGGG + Intergenic
1177337962 21:19758424-19758446 ACATAGCATATTCAGTTGTGTGG + Intergenic
1177486678 21:21767187-21767209 TCATAAAACTTACAGTTGAAGGG - Intergenic
1178290058 21:31359492-31359514 ACATAGAAAATACAGTGAAAGGG + Intronic
1179065350 21:38019669-38019691 TCACAGAACTTTCAGTTGAGTGG + Intronic
1179361920 21:40717758-40717780 ACTTAAAGCATACAGTTTAGTGG - Intronic
1183019520 22:35015984-35016006 ACATAGACCATGAAGTTGAGTGG - Intergenic
1183477118 22:38041837-38041859 AGTTAGAGCATACAGTTCAGTGG - Intronic
1185281093 22:49970222-49970244 ACACGGAACAGACTGTTGAGGGG - Intergenic
949194849 3:1292617-1292639 ACATAAAACATCCATTTGAACGG + Intronic
949745429 3:7286247-7286269 ACATTTAACATACAGTTTTGAGG + Intronic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
951413486 3:22394806-22394828 ACAAGGAACATACATTTTAGAGG - Intergenic
951735339 3:25857359-25857381 AGAAATAACATACAGGTGAGGGG - Intergenic
952362496 3:32645054-32645076 ACATAGAAAATACTATTGATGGG + Intergenic
952516688 3:34111857-34111879 ACACAGAACAGACATTTGATGGG - Intergenic
953564898 3:44022933-44022955 ATATAGAAAATACAGTTGAAGGG - Intergenic
961761247 3:129169969-129169991 ACATAGAACATACAGTTGAGTGG - Intronic
964461443 3:156934680-156934702 ACATAGAAAATACAGAAAAGGGG + Intronic
966567554 3:181399976-181399998 ACATCCAACATACAGGTGGGAGG + Intergenic
966756158 3:183373555-183373577 AGACAGAACAGACATTTGAGGGG - Intronic
967998865 3:195187385-195187407 ACACAGAAGAGACAGTTGGGAGG - Intronic
970689436 4:18605572-18605594 ACAGAGAACACACAGAAGAGCGG + Intergenic
972078162 4:35113086-35113108 ACATGGAACTTACATTTTAGTGG + Intergenic
972713964 4:41627134-41627156 ACAAAGTACATATAATTGAGAGG - Intronic
973155697 4:46949089-46949111 TCAGAGAACATAAAATTGAGGGG - Intronic
973720550 4:53719555-53719577 TCATAGAACTTACAGTTGAGAGG - Intronic
973934502 4:55829370-55829392 ACTTAGACCACACTGTTGAGAGG + Intergenic
974438772 4:61890506-61890528 CAAGAGAGCATACAGTTGAGGGG + Intronic
975425785 4:74225762-74225784 ACATAGAATGTTCAGGTGAGGGG + Intronic
976430667 4:84960414-84960436 TGATAGAGCTTACAGTTGAGTGG - Intronic
976544195 4:86315080-86315102 ACACATAAAATACATTTGAGAGG + Intronic
976559513 4:86485419-86485441 ACATAGGAGATACAGTGGTGAGG - Intronic
977397704 4:96491196-96491218 TCCTACAACATACAGTTGACTGG + Intergenic
977485746 4:97643597-97643619 ACATTAAATATACAGTTGTGAGG + Intronic
978162337 4:105563847-105563869 ACATAGAACATTTTGTTGAGAGG - Intronic
978800751 4:112753263-112753285 CCATAGATATTACAGTTGAGCGG + Intergenic
979062696 4:116083623-116083645 ACATAGAAAATACCTTTGAATGG - Intergenic
980771731 4:137381885-137381907 ACATAGAACATTTTGGTGAGAGG - Intergenic
982639570 4:157941432-157941454 ACATAGAACACAGAGATGAAAGG - Intergenic
982668616 4:158294656-158294678 ATAAAGAATATACAGTTAAGAGG + Intergenic
983696979 4:170544559-170544581 ACCTAGAATATACAGCAGAGGGG + Intergenic
984496728 4:180507320-180507342 ACAAAGAAAATAAAGTTGAGGGG + Intergenic
986935927 5:12886609-12886631 ACATAGAGCAGACAGTTTAATGG - Intergenic
993858855 5:93109364-93109386 ACAGAGAACATATATTTGAATGG - Intergenic
998451099 5:142235428-142235450 ACACTGAAGATACTGTTGAGGGG + Intergenic
998915911 5:147011117-147011139 ACATATAAAATACAGTAAAGAGG - Intronic
999079699 5:148831435-148831457 ACCTACATCATACAGTTGTGAGG - Intergenic
999402758 5:151279339-151279361 TCACAGGACCTACAGTTGAGTGG - Intronic
999903515 5:156113436-156113458 TCAGAGATCTTACAGTTGAGTGG + Intronic
1000804592 5:165774097-165774119 TCATAGGACATACAATTGAAAGG - Intergenic
1000948771 5:167454658-167454680 AAATAGAACCAACGGTTGAGTGG - Intronic
1003308382 6:4948205-4948227 ACATAGATCATACAGTGGGAGGG - Intronic
1004515579 6:16319819-16319841 ATATAGCACATACAGTTTAAAGG + Intronic
1005208790 6:23435885-23435907 ACATAAAAATTAAAGTTGAGAGG + Intergenic
1005332966 6:24766493-24766515 ACATTTAGCATATAGTTGAGAGG - Intergenic
1007912433 6:45529390-45529412 CCATAGAAGATACAGTTCAAAGG + Intronic
1008532855 6:52480665-52480687 ACAATGAACAAACACTTGAGGGG + Intronic
1009302046 6:62036302-62036324 ACATAGAAGATTGAGTTGACTGG - Intronic
1011097491 6:83682540-83682562 ACTTAGAAGATACAGTGGACAGG - Intronic
1012230688 6:96757888-96757910 ACAAAGAACATAGATTTGGGAGG + Intergenic
1012600786 6:101094142-101094164 ACAAAGGATATACATTTGAGGGG + Intergenic
1015426959 6:133082331-133082353 ACACAGATCAAATAGTTGAGAGG - Intergenic
1015886127 6:137920570-137920592 AAATAGAACACACGGTTGGGTGG - Intergenic
1016606578 6:145935740-145935762 ACCAAGTACATTCAGTTGAGTGG - Intronic
1016635241 6:146281388-146281410 AGATAGAACTTAGAGTTGAAAGG - Intronic
1018139336 6:160812505-160812527 ACATGGAGCTTACAGTAGAGTGG - Intergenic
1020873013 7:13657210-13657232 CCATAGAACCTACACTGGAGAGG + Intergenic
1022221538 7:28319002-28319024 ACATTTAACATACAGATAAGCGG - Intronic
1022346396 7:29518995-29519017 TCATAGAAGAGACAGTTAAGTGG - Intergenic
1022781081 7:33584099-33584121 ACTTAGAAAATATAGTGGAGGGG - Intronic
1022868176 7:34444893-34444915 TCATAGAACATACATTTTAATGG + Intergenic
1024843241 7:53612299-53612321 ATATAGAATAAACAGTTTAGGGG + Intergenic
1027615647 7:80420406-80420428 ATATATAACATACAGATGAAGGG - Intronic
1030631203 7:111897705-111897727 AATGAGAACATACAGTTCAGTGG - Intronic
1030946312 7:115726015-115726037 AACTATAACATACAGTTGAAAGG - Intergenic
1031241560 7:119249341-119249363 ACATAGAATATAAAGGTGAGAGG + Intergenic
1032235046 7:130113689-130113711 ACATGGATTACACAGTTGAGGGG - Intronic
1032444223 7:131967603-131967625 ACATAGAACAAACATTAGAGAGG + Intergenic
1032946249 7:136856119-136856141 AGATAGAACGTACAGTATAGTGG - Intergenic
1033322490 7:140352490-140352512 AGATATTACATACAGTTGAGGGG + Intronic
1037417777 8:18669975-18669997 ACACAGAACTTAGATTTGAGTGG + Intronic
1038787284 8:30630263-30630285 ACTGAGAACATGCAGTGGAGGGG - Intronic
1042161413 8:65899656-65899678 TCTTAGAACTTACAGTTTAGTGG - Intergenic
1042643611 8:70961192-70961214 ACAAAGAAAATACAGTACAGTGG + Intergenic
1043403173 8:79903613-79903635 TCATAGAACTTACAGTTCAGTGG - Intergenic
1044826548 8:96203728-96203750 ACATTGAAGATAAACTTGAGAGG - Intergenic
1045721092 8:105111756-105111778 ACATATAATATACCTTTGAGTGG - Intronic
1046823384 8:118660109-118660131 ACATACTATAGACAGTTGAGTGG + Intergenic
1048125143 8:131626037-131626059 TCATGGAACATAGAGTTGAGTGG + Intergenic
1051720485 9:20031960-20031982 TCAGAGAACCTAGAGTTGAGAGG + Intergenic
1056697214 9:88869854-88869876 ACAAAGAATAGACACTTGAGGGG + Intergenic
1058596359 9:106620148-106620170 ATATAGAACTTACAGTCTAGTGG + Intergenic
1059795306 9:117688305-117688327 AAATAGAACATTCACTAGAGGGG + Intergenic
1060112164 9:120914113-120914135 ACAAAGGACATCCAGATGAGTGG + Intronic
1187638235 X:21257493-21257515 ACAAAGAACATGGACTTGAGAGG - Intergenic
1188642407 X:32522655-32522677 AAGTAGAATATACAGTTAAGAGG - Intronic
1188749441 X:33886609-33886631 AAATAGAACATAGAATTCAGTGG - Intergenic
1191082712 X:56530649-56530671 ACAGAGAACATCCACATGAGTGG + Intergenic
1193964493 X:87968474-87968496 TCATAGAACTTACAGTCCAGTGG - Intergenic
1194451745 X:94052012-94052034 ACATTTAACATACATTTGAATGG - Intergenic
1195615270 X:106906866-106906888 CAAGAGAACATACAGTGGAGGGG - Intronic
1195869599 X:109472342-109472364 ACATACAAAATACAGTGGAAAGG - Intronic