ID: 961762828

View in Genome Browser
Species Human (GRCh38)
Location 3:129184064-129184086
Sequence CGCGCGCGGCCTTTCACGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961762828 Original CRISPR CGCGCGCGGCCTTTCACGCC GGG Intergenic
900110189 1:1001983-1002005 CGCTCGCGGGCTTTCCCGCCCGG - Intergenic
901483086 1:9539543-9539565 CGCGCGCGGGCTCCAACGCCCGG - Exonic
902916713 1:19644172-19644194 CGCGCGCGGCCTCTCCCTCCGGG - Intronic
920184503 1:204151802-204151824 CGCGCGCGTCCTTTCACCTGAGG - Exonic
1077495248 11:2884148-2884170 CGCGCGCGGCCGGTCAGGGCGGG + Intronic
1080779537 11:35418479-35418501 CGCGCGCGGCCTTGAACGCCAGG - Intronic
1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG + Intergenic
1092861783 12:12725022-12725044 CGCGCCCGGCCTGTCACGCGTGG + Intergenic
1102173491 12:110859824-110859846 CACGCAGGGCCTTTCAAGCCAGG - Intronic
1103085752 12:118061002-118061024 CGGGCGCGCCCGTTCCCGCCCGG - Intronic
1113981754 13:114281990-114282012 AGCGCGCGGCCGTTCCCACCGGG - Intronic
1121168704 14:91835902-91835924 GGCGCGCGGCCGTCCCCGCCTGG + Intronic
1126823666 15:52528925-52528947 CCCGCGCGGCCCTCCCCGCCCGG - Exonic
1126852579 15:52806062-52806084 CCCGCGCGGCCTCTTACGCCGGG + Intergenic
1127481698 15:59383786-59383808 CGCGCCCGGCCTTTCCAGGCTGG - Intronic
1130348119 15:83067293-83067315 CGCGCGCGCCCCCGCACGCCCGG + Exonic
1134134130 16:11668546-11668568 AGCGCGCGGCCTGCCCCGCCCGG - Intronic
1134149814 16:11797015-11797037 CGCGCGCGGCCGTTAACGGACGG - Intronic
1141132306 16:81444797-81444819 CGCCCGCGGCCACTCTCGCCCGG + Intergenic
1141830682 16:86508602-86508624 CGGGCGCGGCCTCTCCCTCCAGG - Intergenic
1144613506 17:16746769-16746791 AGCGCGCGGCCGTTCCCACCGGG + Intronic
1160972943 19:1777716-1777738 CGGGCGCGGTGGTTCACGCCTGG + Exonic
1163308398 19:16496849-16496871 CGGGCGCGGTGATTCACGCCTGG + Intronic
1165157347 19:33796504-33796526 CGCGCGCGCCCGTTCGCGCTGGG + Intronic
1167220302 19:48194911-48194933 CGCACGCGGCCCTTGACGTCTGG - Exonic
936556748 2:113503345-113503367 CACTCGCCGCCTTTCCCGCCTGG + Intergenic
936976179 2:118224506-118224528 GGGGCGCGGCCTTTGCCGCCTGG + Intergenic
1174708846 20:52684416-52684438 CGCCCCCGGCCTTCCAGGCCCGG + Intergenic
1176409226 21:6438754-6438776 CGGGCGCGGCTGCTCACGCCTGG - Intergenic
1179684721 21:43047076-43047098 CGGGCGCGGCTGCTCACGCCTGG - Intergenic
1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG + Intronic
1180236044 21:46459566-46459588 CCCGCGCGGCCCCTCACCCCGGG + Intronic
961762828 3:129184064-129184086 CGCGCGCGGCCTTTCACGCCGGG + Intergenic
968082210 3:195854350-195854372 CGGGCGCGGCGGCTCACGCCTGG + Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
998467517 5:142357372-142357394 CGCGCGCCGCCCTTCTCTCCGGG + Intergenic
1015525927 6:134175401-134175423 CGCGCGCGACCTCGCCCGCCAGG + Intronic
1019585480 7:1799891-1799913 CGGGCGCGGTCTCTCATGCCTGG + Intergenic
1020192404 7:6010011-6010033 CGGGCGCGGTGGTTCACGCCTGG + Intronic
1023991730 7:45132701-45132723 CCAGCATGGCCTTTCACGCCTGG + Intergenic
1024255593 7:47537895-47537917 CGCCCGGGGCCTTGCACACCTGG + Intronic
1024963990 7:55005428-55005450 TGCGCGCGGCCTTCTGCGCCTGG - Intergenic
1026091426 7:67303482-67303504 CGGGCGCGGTGGTTCACGCCTGG - Intergenic
1026745002 7:73004947-73004969 CGAGCGCGGTGGTTCACGCCTGG - Intergenic
1027031114 7:74889641-74889663 CGAGCGCGGTGGTTCACGCCTGG - Intergenic
1027098738 7:75360133-75360155 CGAGCGCGGTGGTTCACGCCTGG + Intergenic
1029399835 7:100336937-100336959 CGAGCGCGGTGGTTCACGCCTGG + Intronic
1034340359 7:150349647-150349669 CGGGCGCGGTGTCTCACGCCTGG + Intergenic
1035302863 7:157908337-157908359 TGCGTGAGGCCTTTCATGCCTGG + Intronic
1039541231 8:38372839-38372861 CGGGCGCGGCGGTTCACGCCTGG + Intronic
1042271699 8:66962196-66962218 CGCCCTCGGCCTTTCACGCCAGG + Intronic
1049896269 9:113993-114015 CACTCGCCGCCTTTCCCGCCTGG - Intergenic
1056164558 9:83928528-83928550 TGGGCGCGGTGTTTCACGCCTGG - Intergenic
1062538394 9:137030818-137030840 CACGCGGAGCCTGTCACGCCAGG + Exonic
1062639162 9:137508289-137508311 CGGGCGCGGCAGCTCACGCCTGG + Intronic
1189324606 X:40105137-40105159 GGCGCGCGGCCGTTCCCGCGGGG + Intronic
1192529483 X:71872691-71872713 CCCGCGGGGCCTTTCACGGAGGG + Intergenic