ID: 961764678

View in Genome Browser
Species Human (GRCh38)
Location 3:129200214-129200236
Sequence AGGTGAAAGCAGGCACGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961764678_961764683 -4 Left 961764678 3:129200214-129200236 CCACCCCGTGCCTGCTTTCACCT No data
Right 961764683 3:129200233-129200255 ACCTCCTCATCTGTACTTGCTGG No data
961764678_961764686 27 Left 961764678 3:129200214-129200236 CCACCCCGTGCCTGCTTTCACCT No data
Right 961764686 3:129200264-129200286 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961764678 Original CRISPR AGGTGAAAGCAGGCACGGGG TGG (reversed) Intergenic
No off target data available for this crispr