ID: 961769838

View in Genome Browser
Species Human (GRCh38)
Location 3:129241004-129241026
Sequence GTGATCTGGAGTGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961769835_961769838 -2 Left 961769835 3:129240983-129241005 CCCTTAAGTGATCAATGTAAAGT No data
Right 961769838 3:129241004-129241026 GTGATCTGGAGTGCAGCAGCAGG No data
961769836_961769838 -3 Left 961769836 3:129240984-129241006 CCTTAAGTGATCAATGTAAAGTG No data
Right 961769838 3:129241004-129241026 GTGATCTGGAGTGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961769838 Original CRISPR GTGATCTGGAGTGCAGCAGC AGG Intergenic
No off target data available for this crispr