ID: 961770920

View in Genome Browser
Species Human (GRCh38)
Location 3:129249479-129249501
Sequence CGGGAGTGGGGAAAGCCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961770920_961770932 23 Left 961770920 3:129249479-129249501 CCGTCTGGCTTTCCCCACTCCCG 0: 1
1: 0
2: 1
3: 34
4: 326
Right 961770932 3:129249525-129249547 TTAGACGAGGCTGTGGCTACCGG 0: 1
1: 0
2: 0
3: 6
4: 91
961770920_961770931 16 Left 961770920 3:129249479-129249501 CCGTCTGGCTTTCCCCACTCCCG 0: 1
1: 0
2: 1
3: 34
4: 326
Right 961770931 3:129249518-129249540 GTTAACATTAGACGAGGCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 87
961770920_961770930 10 Left 961770920 3:129249479-129249501 CCGTCTGGCTTTCCCCACTCCCG 0: 1
1: 0
2: 1
3: 34
4: 326
Right 961770930 3:129249512-129249534 GCTAAGGTTAACATTAGACGAGG 0: 1
1: 0
2: 0
3: 2
4: 30
961770920_961770926 -6 Left 961770920 3:129249479-129249501 CCGTCTGGCTTTCCCCACTCCCG 0: 1
1: 0
2: 1
3: 34
4: 326
Right 961770926 3:129249496-129249518 CTCCCGCTCCGGCGGAGCTAAGG 0: 1
1: 0
2: 0
3: 0
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961770920 Original CRISPR CGGGAGTGGGGAAAGCCAGA CGG (reversed) Intergenic
900091226 1:921576-921598 CGGGACTGGTGTAAGCCAGCGGG + Intergenic
900372339 1:2337526-2337548 TGTGCGTGGGGGAAGCCAGAGGG - Intronic
901006400 1:6173714-6173736 CGGCAGTGGTGAAGGGCAGAGGG + Intronic
902025616 1:13381314-13381336 AGGGTGTGGGGAAGGCCAAAAGG + Intergenic
902248919 1:15140540-15140562 CTGGAGTGTGGGAAGCAAGAAGG + Intergenic
903336355 1:22627172-22627194 ATGGAGGGGGCAAAGCCAGAAGG - Intergenic
903646486 1:24899162-24899184 CGGGAGGGGGCAGAGGCAGAGGG - Intergenic
904005604 1:27361640-27361662 GGGGAGTGGGGTCAGTCAGAAGG + Intronic
904591773 1:31619008-31619030 AGGGAGTGGGAAAAGAGAGAAGG - Exonic
906666953 1:47628648-47628670 GGGGGGTGGGGCAAGGCAGAGGG + Intergenic
906724783 1:48036265-48036287 CTGGGCTGGGGAAAGCCAGAGGG - Intergenic
908092985 1:60706385-60706407 AGGGAGTGGGGAGAGCAACATGG + Intergenic
909604913 1:77498272-77498294 TGGGAAGGGGTAAAGCCAGACGG + Intronic
909946197 1:81666335-81666357 CAGGAGTGAGGAAATACAGAGGG - Intronic
910189588 1:84581847-84581869 AGGGAGTGAGGAAAGCCAGGTGG + Intergenic
912037061 1:105331043-105331065 CAGGAGTGGGGGAAGGCACAAGG + Intergenic
912928897 1:113938449-113938471 CGGGAGAAGGGGAAGCAAGATGG + Intronic
913141441 1:115945222-115945244 TTTGAGTGGGAAAAGCCAGAGGG + Intergenic
915285669 1:154850477-154850499 GGAGAGTGGGGAAAGGCAGCAGG - Intronic
916541213 1:165756255-165756277 TGGGAGTGGGGAAGGACACAGGG + Intronic
917721556 1:177791153-177791175 AGGGAGAAGGGAGAGCCAGAGGG + Intergenic
919851912 1:201678788-201678810 TGGGAGGGGGGACAGACAGAGGG - Intronic
919878205 1:201885830-201885852 CTGAAGTGGGGAAAGGCAGGAGG - Intergenic
920330228 1:205202070-205202092 GGGGAGAGGGGAAAGGGAGAAGG + Intronic
920395899 1:205645725-205645747 CGGGACTGGAGAAAGGAAGAGGG + Intergenic
920599927 1:207313879-207313901 CGGGAGTGGGGAGTGCAAGAGGG - Intergenic
920689137 1:208132313-208132335 CGGGTGTGGGGAGAGCAGGAGGG + Intronic
920804212 1:209217980-209218002 AGGGAATGGGGACAGGCAGAAGG + Intergenic
922348269 1:224715264-224715286 CAGGACAGGGGAAAACCAGAGGG - Intronic
922455134 1:225768285-225768307 AGGGAGTGGGGAAAACCAGGCGG + Intergenic
922544634 1:226446864-226446886 CAGGAGTGGGGAATGCAAAATGG + Intergenic
922774514 1:228208552-228208574 CAGCAGAGGGGACAGCCAGAGGG + Intronic
923425574 1:233865631-233865653 CTGGAGTGGGGATGGGCAGAGGG - Intergenic
924262904 1:242250400-242250422 GGGGAATGGGGAAGGGCAGACGG + Intronic
924803294 1:247343563-247343585 GCTGAGTGGGGAAAGCCAGCAGG + Intergenic
1063200978 10:3785271-3785293 GGGGAGTGGGGGGAGCCAGGCGG - Exonic
1063663988 10:8051101-8051123 TGGAAGTGGGGAAACCCAGTCGG - Intergenic
1064020442 10:11804854-11804876 CGCGTGTGGGGAGAGCCAGGAGG - Intergenic
1064602579 10:17008556-17008578 AGGGAGTGGGGAGAGCCCGAGGG - Intronic
1066494344 10:35927692-35927714 TGGGATAGGGAAAAGCCAGAGGG - Intergenic
1066721882 10:38348054-38348076 GGGGAATGGGGAAGGGCAGACGG - Intergenic
1068648798 10:59499050-59499072 AGGAAGATGGGAAAGCCAGAGGG - Intergenic
1069896972 10:71685975-71685997 TGGGGGTGGGGAGAGGCAGATGG + Intronic
1070626300 10:78053701-78053723 TATGAGAGGGGAAAGCCAGAGGG - Intronic
1070814483 10:79314158-79314180 CTGGAGAGTGGTAAGCCAGATGG - Exonic
1072674343 10:97454326-97454348 CTGGAGTGGGGAAAACCACTAGG - Intronic
1072737936 10:97891713-97891735 CGCCAGTGGAGAAGGCCAGATGG - Intronic
1073208753 10:101782190-101782212 GCGGAGTGGGGGAAGCCTGATGG + Intronic
1073482760 10:103797424-103797446 CGGAAATGGGGAAAGTCAGAGGG - Intronic
1073580789 10:104663885-104663907 CCGGGGTGGGGAAGGCGAGAAGG - Intronic
1074533197 10:114310925-114310947 GGCGAGTCGGGAGAGCCAGAGGG - Intronic
1075057428 10:119230019-119230041 TGGCACTGGGGAAAGCCAAATGG + Intronic
1075339710 10:121636797-121636819 AGGGAGTGGGGAAAAGGAGAAGG - Intergenic
1075636939 10:124035815-124035837 CCAGAGTGGGGAGATCCAGAAGG - Intronic
1077327776 11:1971133-1971155 CAGCATTGGGGAAAGACAGATGG - Intronic
1079486960 11:20945197-20945219 AGGGTGTGGGGGATGCCAGATGG + Intronic
1080116350 11:28625340-28625362 CGAGAGTTGGGGAAGTCAGAAGG + Intergenic
1080844688 11:36016135-36016157 GGGGAGTGGGGCTGGCCAGAAGG + Intronic
1081463883 11:43298612-43298634 CGGGAGTGGAGAGAACCTGAAGG - Intergenic
1081566596 11:44264597-44264619 AGGCAGTGGAGAAAGCCAGGTGG - Exonic
1081625340 11:44652071-44652093 CGGGAGAGGGGAAAGGGGGATGG - Intergenic
1083236344 11:61353259-61353281 CGGTAGTGGGCAATGCCAGGTGG - Intronic
1083395567 11:62389295-62389317 AGAGAGTGAGGAAAGCCTGAGGG - Intronic
1083621788 11:64052946-64052968 CAGGGGTGGGGAAAGAGAGATGG - Intronic
1083647186 11:64178948-64178970 AGGGAGTGAGGAAGCCCAGAGGG + Intergenic
1083831213 11:65234967-65234989 AGGGAGGGAGGAAAGGCAGAAGG - Intergenic
1084118584 11:67056143-67056165 CGGGAGTAGGGACAGGCAGCGGG - Intergenic
1084688289 11:70710188-70710210 CAGGTGTGGGGAGAGCCAGTAGG - Intronic
1085729264 11:78982551-78982573 GGGGTGTGAGGAGAGCCAGAGGG - Intronic
1088911195 11:114193699-114193721 TTGGAGTGGGAAAAGCCAGGTGG + Intronic
1089308999 11:117545563-117545585 GGGGAGGGGAGAAAGGCAGAGGG + Intronic
1089611101 11:119669706-119669728 CAGGAGTGGGGCAAGCCTGCAGG - Intronic
1089785529 11:120904411-120904433 TTGGATTGGAGAAAGCCAGAAGG - Intronic
1090839259 11:130474537-130474559 AGGTAGCGGGGAAAGCCAGTAGG + Exonic
1202810757 11_KI270721v1_random:26313-26335 CAGCATTGGGGAAAGACAGATGG - Intergenic
1091913498 12:4250784-4250806 CGGGAGAGGAGAAAGCCCGAGGG - Intergenic
1092242355 12:6843116-6843138 CGGGAGTGAGGAAGGCGGGAAGG + Intronic
1093698799 12:22194556-22194578 TGGGAGTGGGGAGTGGCAGAGGG - Exonic
1093813238 12:23512374-23512396 TGGGGGTGGGGGAAGCAAGATGG + Intergenic
1094127989 12:27043886-27043908 CGGAAGTGGGGAAAGCCAAGTGG - Intronic
1096647202 12:53045407-53045429 TGGGGGTGGGGGAAGCCAGGCGG - Intergenic
1097225283 12:57473541-57473563 GTGGAGTGGGGAATGCCACAGGG - Intronic
1097465472 12:59919381-59919403 TGGGAGTGGGGTAAGGGAGAAGG - Intergenic
1097682076 12:62658350-62658372 AGGGAGTGGGCAAAGCCAAGAGG - Intronic
1099425511 12:82518507-82518529 GGGGTGTGGGGAAGGCCATAAGG + Intergenic
1100329570 12:93571221-93571243 CGGTAGTGGGGGAAGCCCGAAGG + Intronic
1100899688 12:99223756-99223778 GTGGAGTGTGGAAAGCCTGAAGG - Intronic
1101849935 12:108393867-108393889 CCGGGGTGGGGGATGCCAGAGGG - Intergenic
1102006681 12:109593456-109593478 CGGAAGTGAGGAATGCCAGGGGG + Intronic
1103209257 12:119154635-119154657 GGGGAGTGGCCAAAGCCTGAGGG + Intronic
1103316995 12:120064247-120064269 CAGGAGCGGGGAAAGGAAGACGG + Intronic
1104318168 12:127723433-127723455 AGGGAGTGGGGAAAGGGAGCTGG + Intergenic
1104938000 12:132376799-132376821 GGGGAGTGAGGAAAGAGAGATGG + Intergenic
1108696154 13:52904327-52904349 CAGGATTGGAGAAAGGCAGAGGG + Intergenic
1109199688 13:59416422-59416444 CAGGAGTGGCTAAAGGCAGAAGG + Intergenic
1110356786 13:74575974-74575996 TGGGAGTGGGGACAGCGAGGGGG + Intergenic
1111451781 13:88428590-88428612 AGGGGGTGGGGTGAGCCAGAAGG - Intergenic
1111987279 13:95077978-95078000 CTGGGTTGGGGAAAGGCAGATGG + Intronic
1112529059 13:100182837-100182859 CGGGAGTGGCAAAAGGCAGCTGG - Intronic
1113558733 13:111259185-111259207 CGGCAGGTGGCAAAGCCAGATGG - Intronic
1113571458 13:111361186-111361208 AGGGAGTGGGCAAGGCCATATGG + Intergenic
1113899350 13:113788043-113788065 AGGGAGTGGGGATGGGCAGAGGG + Intronic
1113909938 13:113836884-113836906 GGGGAGTGGGGAAAGGAGGAGGG + Intronic
1114061992 14:19026647-19026669 CAGGAGTGGGGATGGCCACAGGG - Intergenic
1114160825 14:20165205-20165227 CTGGGGAGGGGAATGCCAGATGG + Intergenic
1114180958 14:20367543-20367565 CAGAAGTTGGGAAAACCAGAAGG + Exonic
1115378679 14:32708307-32708329 AGGGAGTGAGGAAAACAAGAAGG + Intronic
1118507575 14:66430340-66430362 CAGGAGAGAGAAAAGCCAGATGG - Intergenic
1118635621 14:67746427-67746449 AGGGAGTGGGGAAGATCAGATGG - Intronic
1119794158 14:77380694-77380716 TGGGAATGAAGAAAGCCAGACGG - Intronic
1120855110 14:89205445-89205467 TGGGAGTGTGGCAGGCCAGAAGG - Intronic
1120930220 14:89841012-89841034 CGGGAGACTGGAAGGCCAGAGGG - Intronic
1121693774 14:95896131-95896153 CAGGAGTGGGGCCAGCGAGAAGG - Intergenic
1122163273 14:99802130-99802152 TGGGAGTGGGGAGAGCCATTCGG + Intronic
1126459926 15:48904139-48904161 GGGAAGTGCTGAAAGCCAGAAGG - Intronic
1127288175 15:57548499-57548521 TGGCACAGGGGAAAGCCAGAAGG + Exonic
1127727527 15:61764630-61764652 CGGGAGTGGGAAAGGGCAGAGGG - Intergenic
1129235290 15:74220088-74220110 AGGCAGTGGGGAACACCAGAGGG + Intergenic
1129823075 15:78617724-78617746 CAGGAGGTTGGAAAGCCAGATGG - Intronic
1129890223 15:79066888-79066910 AGGGAGTGGGGAAAGCCTCTGGG - Intronic
1129985693 15:79918361-79918383 TGGGAGTGGTGAGGGCCAGAAGG - Intronic
1130028031 15:80286551-80286573 CAGGAATAGTGAAAGCCAGATGG - Intergenic
1130862116 15:87900351-87900373 CTGGAATGGGGACAGGCAGAGGG + Intronic
1131066209 15:89436421-89436443 AGGGAGCAGGGAATGCCAGAGGG + Intergenic
1131451173 15:92541526-92541548 AGGGAGTGAGGGAAGCCGGATGG - Intergenic
1132810234 16:1793720-1793742 CCGCAGTGGGGAAATCCAGAGGG - Exonic
1135923525 16:26672403-26672425 CGGGGGTGGGGGAAGCCACAGGG - Intergenic
1139366113 16:66434460-66434482 CTGGAGTGGGGGAAGGGAGAAGG + Intronic
1140406449 16:74714382-74714404 CGGGAGTTGGGAAGGCCAAGGGG - Intronic
1140477153 16:75244677-75244699 CTGGAGTGTGGAGAGCCAGGAGG + Intronic
1141746384 16:85929324-85929346 CAGGCGTGGTGAAAGCCAGCTGG + Intergenic
1141996778 16:87641014-87641036 CGGGTGTGGAGCAAGCCACAGGG + Intronic
1142259945 16:89037997-89038019 CTGCTTTGGGGAAAGCCAGATGG - Intergenic
1142264442 16:89057352-89057374 AGAGAGTGGGCAAAGCCAGCTGG + Intergenic
1143245866 17:5485696-5485718 CAGGAATGGGGAAAGCAAGCTGG - Intronic
1143476036 17:7204530-7204552 CGGGAAGGGAGACAGCCAGACGG + Intronic
1143565823 17:7719936-7719958 GGAGGGTGGGGAAAGTCAGAGGG + Intronic
1143595572 17:7911748-7911770 TGGGAGTGGAGAAAGACAAAGGG - Exonic
1143634166 17:8154827-8154849 CGGGCGGGGGGAAAGGGAGAGGG + Intronic
1143697369 17:8630504-8630526 CGGGAGCTGGGGAAGACAGAGGG - Intronic
1144623521 17:16832908-16832930 TGGGAGTGATGAAATCCAGAGGG - Intergenic
1144829969 17:18125856-18125878 CCAGAGTGGGGATGGCCAGAGGG + Intronic
1144882910 17:18439808-18439830 TGGGAGTGATGAAATCCAGAGGG + Intergenic
1145149321 17:20504578-20504600 TGGGAGTGATGAAATCCAGAGGG - Intergenic
1145744360 17:27303344-27303366 CTGGAGTGGGGGAAGTCAGATGG - Intronic
1147056899 17:37841760-37841782 CGGGAGTAGAGAAAGGCAGGGGG - Intergenic
1147577846 17:41612843-41612865 CGGGAGTGATGAAATCCAGAGGG - Intronic
1147623349 17:41883071-41883093 TGGGAGTGGGGATTGCAAGAGGG - Intronic
1147866346 17:43555211-43555233 CGGGAGTCAGAGAAGCCAGAGGG - Intronic
1148028144 17:44602295-44602317 AGGGGGTGGGGAAAGAGAGAAGG + Intergenic
1148223535 17:45882113-45882135 CGAGAGTGGGGGATGCCAGTTGG - Intergenic
1150425190 17:65072008-65072030 AAGGAGTAGGGAAAGGCAGATGG + Intergenic
1153448031 18:5196142-5196164 AGGGAGTGGGGAAGGCTGGAGGG - Intronic
1153711736 18:7806964-7806986 AGGGAGGTGGGAAAGGCAGAGGG - Intronic
1155484689 18:26328981-26329003 AGGAAGTGGGGAAGGCAAGAAGG - Intronic
1156471805 18:37381780-37381802 AGGTAGTGGGCCAAGCCAGAGGG - Intronic
1156729832 18:40179069-40179091 AGGGAGTGGAGCAGGCCAGAAGG - Intergenic
1156783225 18:40877593-40877615 CGTGGGTGGGGAAAGGAAGAGGG - Intergenic
1160619478 18:80160610-80160632 CGGGAGAGGGGACAGTTAGAGGG + Intronic
1161264545 19:3358400-3358422 TGGAACTGGGGAAAGACAGAAGG + Intergenic
1161519268 19:4714444-4714466 AGGGAGTGGGGAAAGCGGCAGGG - Intronic
1162461640 19:10817272-10817294 AGGCACTGGGGAAAGGCAGAGGG - Intronic
1162799549 19:13103140-13103162 AGGGAGTGTGCAAAGCCAAAGGG - Intronic
1163653033 19:18529924-18529946 CCAGAGTTGGGAGAGCCAGATGG + Intergenic
1163730774 19:18948057-18948079 TGGGAGTGGGGGTAGTCAGATGG + Intergenic
1164531900 19:29055223-29055245 CAGAAGTGGGGAAAGCAAGGAGG + Intergenic
1165137030 19:33675954-33675976 CTGGATTGGGGAAAGGCAGATGG - Intronic
1165561968 19:36687717-36687739 CTGGGCTGGGGAAAGCAAGAAGG + Intronic
1166121895 19:40691365-40691387 GGGGGGTGGGGAAGGCGAGAAGG + Intergenic
1166219774 19:41356965-41356987 CGGCAGAGGGGAAAGGCAGAAGG - Intronic
1167322640 19:48806069-48806091 CGGGAGAGGGGACAGCCATTGGG - Intronic
1167485921 19:49762967-49762989 GGGGAGGGGGAAAAGCCAGCAGG - Intronic
1168193904 19:54759118-54759140 CGGGAGTTAGAAAAGACAGAAGG + Intronic
1168216304 19:54928439-54928461 CAGTAGTGAGGAAAGGCAGAGGG + Intronic
925134489 2:1516670-1516692 CGTGTGTGGGGAGAGCCAGCAGG - Intronic
925583370 2:5437502-5437524 AGAGAATGGGGAAAGCAAGATGG - Intergenic
927879623 2:26681451-26681473 CCAGAGTGGGGAAGGGCAGAGGG - Intergenic
927904342 2:26846741-26846763 CGGGAGTTGGGAAGGGGAGAAGG + Intergenic
928823036 2:35386162-35386184 AGGGACTGGGGACAGCGAGATGG - Intergenic
929137269 2:38637160-38637182 CTGGATTGGGGTAAGCCAGGTGG - Intergenic
929549364 2:42879756-42879778 GGGAAGTGGTGAATGCCAGAGGG + Intergenic
929682982 2:44010221-44010243 AGGGACTCAGGAAAGCCAGAGGG + Intergenic
931705958 2:64946419-64946441 TGTGAGTGGGGAAACCCAGCAGG - Intergenic
932209562 2:69915529-69915551 CGCGCGTGGGGAGAGCCAGAGGG - Intronic
933315223 2:80706822-80706844 CAGGAGTCGGGGGAGCCAGAAGG - Intergenic
933332424 2:80910710-80910732 CAGGAGAGGAGGAAGCCAGAAGG - Intergenic
933781818 2:85807838-85807860 TGGGAGTGGGGAAACACAGTGGG - Intergenic
935282427 2:101529607-101529629 GGGGATTGGGGATACCCAGATGG + Intergenic
935397889 2:102627285-102627307 TGGGAGTGGGCAAAGACAGATGG + Intronic
935987516 2:108689046-108689068 CGGGAGGTCGGAGAGCCAGAGGG + Intergenic
936126342 2:109791743-109791765 CGGGAGGTCGGAGAGCCAGAGGG + Intergenic
936218351 2:110579725-110579747 CGGGAGGTCGGAGAGCCAGAGGG - Intergenic
937265928 2:120614707-120614729 TGGCAGTGGGGAGAGCCAGGAGG - Intergenic
937284644 2:120742185-120742207 CGGGAGTGGACAAGGGCAGAAGG - Intronic
937359460 2:121218823-121218845 GGGGAGGGAGGAAAGCCAGGAGG + Exonic
937430190 2:121831812-121831834 AGGGAGTAAGGGAAGCCAGACGG - Intergenic
938114663 2:128595011-128595033 GGTGAGTGGGGAAGGCCAGAGGG - Intergenic
938272008 2:129980534-129980556 AGGGAGAGAGGAAAGCCAAAGGG + Exonic
938443999 2:131363280-131363302 AGGGAGAGAGGAAAGCCAAAGGG - Intergenic
938556541 2:132429888-132429910 CTGGAGTAGGGAAATCTAGAAGG + Intronic
938724209 2:134092388-134092410 GGGCAGTGGGGCAGGCCAGACGG - Intergenic
939057227 2:137380409-137380431 AGGGAGTGGGAACAGCTAGAAGG - Intronic
939107345 2:137964403-137964425 TGGGGGTGGGGAAAGAAAGAGGG + Exonic
941686875 2:168456430-168456452 CAGGAGTGGACAAAGCAAGATGG + Exonic
942734879 2:179097881-179097903 GTGGAGTGGGTAAAGCAAGACGG - Intergenic
942942311 2:181632777-181632799 GGGTAGTGGGGACAGACAGATGG + Intronic
943046712 2:182868580-182868602 CGGGGGCGGGGAACACCAGATGG + Intergenic
946029078 2:216690946-216690968 CGGGAGTTGGGAAAACGAGATGG - Intronic
946444589 2:219727378-219727400 AGGGAGTGGAGAAAGCTGGAGGG + Intergenic
947010772 2:225563901-225563923 TGGGGGTGGGAAAAGCCACACGG + Intronic
947736995 2:232460261-232460283 GCAGAGTGGGGAAAGCCTGAGGG + Intergenic
948494638 2:238339506-238339528 AGGCAGTGGCGAAAGCCTGAGGG + Intronic
948763145 2:240204849-240204871 CGGGAGAGGAAGAAGCCAGAGGG - Intergenic
1169275800 20:4232958-4232980 AGGGAGGGCGGGAAGCCAGAGGG - Intronic
1169503119 20:6180564-6180586 GGGGAGTGGGAAAAGCAGGATGG - Intergenic
1171201444 20:23245204-23245226 AGGGAGAGGTGAACGCCAGAGGG - Intergenic
1172018029 20:31890931-31890953 CAGGAGTGGTGAATGCCAAAGGG + Intronic
1172034366 20:32001005-32001027 TGAGAGTCGGGAAAGACAGAGGG + Exonic
1173202298 20:40962923-40962945 CGGGACTGGGGAAGCCCAGATGG - Intergenic
1175342062 20:58238831-58238853 GGGGAGGGGGGGAAGCCAGAAGG + Intergenic
1179126535 21:38595799-38595821 CAGGTGTGTGGGAAGCCAGATGG - Intronic
1179303049 21:40129578-40129600 AGGGAGTGTGGAAAGCCACATGG + Intronic
1180241022 21:46505724-46505746 AGTGTATGGGGAAAGCCAGAAGG - Intronic
1180480479 22:15749261-15749283 CAGGAGTGGGGATGGCCACAGGG - Intergenic
1180989780 22:19928561-19928583 CAGAAGTGGGGGAAGCCGGAAGG + Intronic
1182227202 22:28808163-28808185 CGTCAGAGGGGAAAGACAGAAGG + Intergenic
1183089746 22:35513757-35513779 CTGGAGCAGGGAGAGCCAGAGGG + Intergenic
1183423783 22:37726511-37726533 CGGGGGTGGGGTCAGCCAGGTGG + Intronic
1184724480 22:46335618-46335640 CGGGACAGGGGAAGGCCGGACGG + Exonic
1184834689 22:47014258-47014280 AAGGAGGGGAGAAAGCCAGATGG - Intronic
1185078608 22:48696611-48696633 CCGGAGAGGGGAAACCCTGAAGG + Intronic
949504539 3:4714577-4714599 AGGGATTTGGGAAACCCAGACGG - Intronic
950094931 3:10323594-10323616 GGGGAGAGGGGTAAGGCAGAGGG - Intergenic
950107666 3:10398570-10398592 GGGGACTGGGGACAGACAGAAGG - Intronic
952836396 3:37605967-37605989 CGAGTGTGAGGAATGCCAGAGGG + Intronic
953060973 3:39428687-39428709 CGGGAATGGGAAAAGACAAAAGG + Intergenic
955236255 3:57142526-57142548 CCGGAGTGGGGGAGGTCAGACGG - Intronic
956054103 3:65280145-65280167 GGGGAGTGAGGAAAGCTGGATGG - Intergenic
956530719 3:70215400-70215422 CTGGAGAGGGGTAAGTCAGAAGG - Intergenic
959888804 3:111531472-111531494 AGGGAGTGAGGGAAGCAAGAGGG + Intronic
961450345 3:126999693-126999715 TGGGAGTGGGTACAGCCAGCAGG + Intronic
961519317 3:127457416-127457438 GGGGAGTGGGGAAGGGCAGGCGG + Intergenic
961770920 3:129249479-129249501 CGGGAGTGGGGAAAGCCAGACGG - Intergenic
962572586 3:136726072-136726094 GGGGTGTGGGGAATGCAAGAGGG - Intronic
965380393 3:167981065-167981087 TGGGAGAGGGGAGAACCAGATGG + Intergenic
965695802 3:171407003-171407025 TGGGAGTGAGGAGAGGCAGAGGG + Intronic
966404643 3:179583993-179584015 CGTAAGTGGGGAAAGCAATATGG + Intronic
967023110 3:185540125-185540147 AGGGAGTGGGAATAGGCAGAGGG - Intronic
967849536 3:194071400-194071422 CGGGCGTGGGGAAGGCGGGAAGG - Intergenic
968064973 3:195753511-195753533 AGGGCGTGAGGAAAGCCAGCTGG - Intronic
968815754 4:2820857-2820879 AGGGAATGGGAAAATCCAGAGGG - Intronic
968818172 4:2832442-2832464 TGGGTGTGTGGAGAGCCAGAGGG - Intronic
969486432 4:7474882-7474904 CAGGAGGTGGGACAGCCAGAAGG - Intronic
969597297 4:8156712-8156734 CGGGTGTGGGGAGGGCCACAGGG + Intronic
969615589 4:8250918-8250940 CGGGAGTGTAGAGAGCCAGGTGG - Intergenic
971243044 4:24905929-24905951 TGGGAATGGGGAAAGAGAGAAGG - Intronic
971492076 4:27223791-27223813 CAGGAGTGGTGTAGGCCAGAAGG - Intergenic
972581032 4:40395899-40395921 CTGGAGAGGGCAAAGCAAGAGGG - Intergenic
973820529 4:54658316-54658338 CGGGAATGGGGACAGCAAGAGGG + Intronic
973954382 4:56048945-56048967 CGGGAGTGGCGCACACCAGATGG - Intergenic
974973015 4:68854143-68854165 CAGGACCGGGGAAAGCCTGAAGG - Intergenic
976289847 4:83406172-83406194 TGGGAGTGGGGCAAGCATGATGG + Intergenic
978403975 4:108360744-108360766 TGGGAGTGGGGAAAAAGAGATGG - Intergenic
981076239 4:140595294-140595316 TGGGAGTGGGGAAACACAGCTGG + Intergenic
981923927 4:150117219-150117241 GGGGAGTGGGGAATAGCAGACGG + Intronic
984592964 4:181636936-181636958 CTGGAGTGGTGTAAACCAGAGGG - Intergenic
985087172 4:186324980-186325002 CGGGACTGGGTGAAGCCAGCTGG + Intergenic
985175397 4:187194906-187194928 CGTGAGAGGGGAGACCCAGATGG + Intergenic
985859941 5:2462719-2462741 CAGGACTGGGGAAAGCTAGCAGG + Intergenic
986693239 5:10331196-10331218 AGGGAGAGGGGAGAGCCAGCCGG - Intergenic
988686907 5:33534323-33534345 AGGGAGTGGAGAAAGCTGGATGG - Intronic
989334928 5:40304862-40304884 ACGGAGTGGGGAATGCAAGAAGG - Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
991400252 5:66244344-66244366 CTGGAGGTGGGAAAGTCAGATGG - Intergenic
993422728 5:87721607-87721629 GGTGAGTGGGGGAAGCCAGTGGG + Intergenic
996691554 5:126345826-126345848 AGGGAGTGAGAAGAGCCAGAAGG + Intergenic
998456533 5:142278149-142278171 AGGGAGTGGGGAAAAACAGGTGG + Intergenic
1000261486 5:159592710-159592732 AGGGGGTGGGGAAATCCAGCAGG - Intergenic
1001093615 5:168759877-168759899 AGGGGGTGGGGTAAGGCAGAGGG + Intronic
1001274208 5:170338682-170338704 TGGGAGTGGGGAGAGGCAGAGGG - Intergenic
1001749323 5:174116859-174116881 CGGCGGGGGGGAAAGCCAGCCGG - Intronic
1003486190 6:6581665-6581687 AGGGAGAGGGGAAAGGCTGAGGG - Intergenic
1004909612 6:20270329-20270351 CGGCAGTGGGGAGATCCAGTGGG - Intergenic
1004913423 6:20308428-20308450 CTGGAGTGGAGTGAGCCAGAGGG - Intergenic
1005267448 6:24126755-24126777 CAGGAGTGGGGAGGGCCAGTGGG - Intronic
1006595629 6:35191063-35191085 GTAGGGTGGGGAAAGCCAGAAGG + Intergenic
1007257344 6:40538286-40538308 CGGGAGTAGGGGAAGCCTGTTGG - Intronic
1007704014 6:43780374-43780396 CGGCAGGGGGCAAAGCCTGAGGG - Intronic
1007720253 6:43880893-43880915 AGGGATTGGGGGAAGCAAGATGG + Intergenic
1008331861 6:50255018-50255040 AGGGAGTGGTGAAATCCTGATGG + Intergenic
1008636612 6:53417276-53417298 CTGGAGTGGTGGAAGCCAGGCGG + Intergenic
1009952555 6:70413720-70413742 CGGGAGCCGGGGGAGCCAGAGGG - Intronic
1015835050 6:137411244-137411266 GGGGATTGGGGAAAGCAAGCGGG + Intergenic
1015943947 6:138480460-138480482 CTGCAGTGTGAAAAGCCAGAAGG + Intronic
1016624707 6:146153004-146153026 TGGGATTGGGGAAAGGCAGAGGG + Intronic
1016882148 6:148921825-148921847 CGGCAGTGGGGACAGCCAACTGG - Intronic
1017209850 6:151843099-151843121 CCTGACTGGGGAATGCCAGATGG + Intronic
1017252279 6:152293599-152293621 CAGGAGTCCAGAAAGCCAGATGG - Exonic
1018007734 6:159638963-159638985 CTGGAGTTGGGAGAGGCAGAAGG + Intergenic
1018279240 6:162166924-162166946 GAGGAGTTGGGAAAGTCAGATGG - Intronic
1019519475 7:1454262-1454284 AGGGAGTGGGGAGAGGCAGGTGG + Intronic
1019687673 7:2390712-2390734 CGGGGGAGGAGAGAGCCAGAGGG + Intergenic
1020094243 7:5359449-5359471 TCGGAATGGGGAAAGCCAGGGGG - Exonic
1021000038 7:15317457-15317479 CAGGAGTGGGGATAGGCAAAGGG + Intronic
1021420883 7:20443523-20443545 GGAGAGTGAGGAAAACCAGAGGG + Intergenic
1022104026 7:27185649-27185671 CTGGACTGGGGATAGCCAGGTGG + Intergenic
1023480066 7:40624701-40624723 CGGGAGTGAGGAAATCAAGTAGG + Intronic
1028608487 7:92681819-92681841 CGGGGGTGGGGACAGGCACATGG - Intronic
1029604629 7:101591024-101591046 AGGCAGTGGGGAAAGACTGACGG - Intergenic
1030732255 7:113004110-113004132 TGGGAGTGGAGTGAGCCAGATGG + Intergenic
1032491374 7:132326900-132326922 AGGGAATGGGGAAAGGAAGAGGG + Intronic
1033024660 7:137760646-137760668 AGGGAGAGAGGAGAGCCAGAAGG + Intronic
1033263658 7:139865826-139865848 AGGGAGGGGGGAAAGGAAGAAGG + Intronic
1034354923 7:150444311-150444333 CGGGACTGGGGAATGACAGCCGG - Intergenic
1035733824 8:1873238-1873260 CGGGAGACGGGAAAGCCTGGTGG + Intronic
1036213773 8:6863174-6863196 GGGGAGTGGGGGAGGCTAGAAGG + Intergenic
1037974813 8:23201605-23201627 CAGGGGTGGGGACAGGCAGATGG + Intronic
1040610322 8:48977088-48977110 CGGGGGTGGAGTGAGCCAGAAGG + Intergenic
1041713338 8:60912285-60912307 GGGGAGTGAGGAAAGCAGGAAGG + Intergenic
1041860872 8:62511138-62511160 AGGGTGTGGGGAAAGCTTGAGGG - Intronic
1042033151 8:64499460-64499482 GGGGAGTCTGAAAAGCCAGAGGG - Intergenic
1044636580 8:94331226-94331248 GGGGAGGGAGGAAAGACAGAAGG + Intergenic
1045570380 8:103362867-103362889 CAGGAGTGGAGAAAGCCAGAGGG + Intergenic
1047718564 8:127618140-127618162 AGGGAGTGGCTCAAGCCAGAAGG - Intergenic
1048256495 8:132908863-132908885 CGGGAGTGAGGTAAGGCTGAGGG + Intronic
1049596852 8:143488631-143488653 CATGAGTGGGAAGAGCCAGAGGG + Intronic
1050999650 9:12265386-12265408 CGGGAATGGTGAAAGGGAGAGGG + Intergenic
1051185124 9:14452384-14452406 TGGAAGTAGGGAAAGACAGAGGG + Intergenic
1052286377 9:26790432-26790454 AGAGAGTGGGGAAAGCCAGTGGG - Intergenic
1053161806 9:35818607-35818629 TGGGAGCTGGGAAGGCCAGAGGG + Intronic
1054876815 9:70106201-70106223 CTGGAGTGGGGAAAGGAAAAGGG + Intronic
1056395822 9:86180283-86180305 CGGGAGCAGGGAAAGCAAGATGG - Intergenic
1057816851 9:98302378-98302400 GGAGAGTGGGGAAAACCAGAGGG + Intronic
1057956430 9:99411889-99411911 TGACAGTGAGGAAAGCCAGACGG - Intergenic
1058447868 9:105069734-105069756 GGGGTTTGGAGAAAGCCAGATGG - Intergenic
1059866102 9:118515456-118515478 CAGGAGTGGGAAAAGAGAGATGG - Intergenic
1060224464 9:121782738-121782760 GGGGAGTGGGGACAGCCTGATGG + Intronic
1060252120 9:121995000-121995022 AGGGAATGAGGAAAGGCAGAGGG + Intronic
1060498908 9:124138095-124138117 ATGGAGTGGGGAAAGCCAGCAGG + Intergenic
1060758569 9:126229881-126229903 GGGGCGTGAGTAAAGCCAGAAGG + Intergenic
1060875966 9:127083875-127083897 CTGGAGTGGGGGAAGACAGATGG + Intronic
1062183484 9:135203580-135203602 CGGGGCTGGGGAAAGACAGCAGG - Intergenic
1062315027 9:135962896-135962918 GGAGAGTGGGGGAAGCTAGAGGG + Intergenic
1186397421 X:9223881-9223903 CGGGAAAGAGGAAAGCCTGAAGG - Intergenic
1186576600 X:10772897-10772919 AGGGAGTTTGGAAGGCCAGAAGG + Intronic
1186595112 X:10972740-10972762 TGGGAGTGAGGAAAGGCATATGG - Intergenic
1189515951 X:41713628-41713650 AGAGACTGGGGAAAGGCAGAGGG + Intronic
1189650402 X:43183183-43183205 GGGAAGTGAGGAAAGTCAGAGGG - Intergenic
1190060638 X:47209473-47209495 GGGGAATGGGGAAGGCTAGAGGG + Intronic
1190093714 X:47462274-47462296 GGGAAGCGGGGAAAGCCAGAGGG - Intronic
1190917507 X:54821435-54821457 AGGGAGTGGGGAGGGCAAGAAGG + Intergenic
1190947820 X:55113037-55113059 AGGCAGTGGGGAAAGCCATCTGG + Intronic
1195696734 X:107673098-107673120 AGGGAGGGGGGAAAGGGAGATGG - Intergenic
1195882996 X:109612104-109612126 GGGGAACAGGGAAAGCCAGAGGG - Intergenic
1195905652 X:109841616-109841638 TGGAAGTGGGGAAAGATAGAAGG + Intergenic
1197294101 X:124696060-124696082 TGGGAGTATTGAAAGCCAGATGG - Intronic
1197305492 X:124836244-124836266 TGGGAGTGGGGGAAGATAGATGG - Intronic
1197444790 X:126538736-126538758 CTTGAGAGGGGAAAGCAAGAGGG - Intergenic
1197703419 X:129616701-129616723 AGGGAGTGGGGAAACCCATGTGG + Intergenic
1197844917 X:130791249-130791271 TGGGAGTGGGGTAAGGCAGAAGG - Intronic
1200258986 X:154601953-154601975 GGAGAGTGGGGAAAGACGGAAGG + Intergenic
1200828086 Y:7663651-7663673 CGGGCGAGGGGAAAGATAGAGGG + Intergenic