ID: 961772433

View in Genome Browser
Species Human (GRCh38)
Location 3:129259859-129259881
Sequence CTGTAGACACAGTAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961772430_961772433 1 Left 961772430 3:129259835-129259857 CCAAGGGGGAAGTTCTGTTGGAT 0: 1
1: 0
2: 1
3: 9
4: 114
Right 961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG 0: 1
1: 0
2: 2
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961772433 Original CRISPR CTGTAGACACAGTAGGAGAG AGG Intronic
900008237 1:79684-79706 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901380132 1:8867650-8867672 CTGTAGTCCCAGCAGGAGAATGG - Intronic
901633142 1:10657606-10657628 CTGAAGACAGAGTGGGACAGGGG + Intronic
902026089 1:13384723-13384745 CTGTAGACTCAGTAGGAATTTGG + Intergenic
902554386 1:17238492-17238514 GTGTAGACCGAGTGGGAGAGGGG + Intronic
902561809 1:17282287-17282309 ATGTAGACACAGAAACAGAGAGG - Intronic
903425748 1:23252961-23252983 TGTTAGACACAGGAGGAGAGAGG - Intergenic
904432030 1:30470453-30470475 CAGAAGACACATCAGGAGAGGGG - Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
908260723 1:62337790-62337812 CTGATGACACAGGAGGGGAGGGG - Intergenic
909228282 1:73053840-73053862 CTATAGACCCAAAAGGAGAGAGG - Intergenic
910660955 1:89671992-89672014 CTGTAGAGACATAAGGATAGGGG - Intronic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
916125319 1:161565265-161565287 CTGTGGACATAGCAGGGGAGTGG + Intergenic
916135205 1:161646655-161646677 CTGTGGACATAGCAGGAGAGTGG + Intronic
916226300 1:162493147-162493169 TTTTAGATATAGTAGGAGAGGGG + Intergenic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917869786 1:179230646-179230668 AAGTAAACACAGTGGGAGAGGGG - Intergenic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
919179812 1:194066220-194066242 CTGTAGACACAGTAGTGAAATGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
924728234 1:246689759-246689781 CTGCAGTCACTGTAGGAGCGGGG - Intergenic
1063903971 10:10764342-10764364 GTGAAGACACAGTATGAGATCGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064240315 10:13621490-13621512 CTGAAGGCAAAGGAGGAGAGTGG - Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1065087252 10:22191211-22191233 CTCTAAGCACAGTAGGGGAGAGG - Intergenic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1066746167 10:38605190-38605212 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1070870589 10:79748281-79748303 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071637507 10:87270493-87270515 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071657738 10:87467458-87467480 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1073606572 10:104901593-104901615 CTGGAGAGACTGTAGGTGAGGGG - Intronic
1074563285 10:114553556-114553578 CTCTTCACACAGCAGGAGAGTGG + Intronic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1076921284 10:133455953-133455975 CTGCAGACCCAGGAGGACAGGGG + Intergenic
1077629634 11:3802369-3802391 ATTTAGACAGAGTAGGAGTGTGG - Intronic
1077634431 11:3832558-3832580 CTGTACACACAGGAGGTGACAGG + Intronic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1080344648 11:31310982-31311004 AGGTAGACACAGAAGGAGATAGG - Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086351408 11:85945608-85945630 CTGCTGACTCTGTAGGAGAGGGG + Intergenic
1086427777 11:86703863-86703885 TTGTAAACACAGGAGAAGAGGGG - Intergenic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1086864182 11:91959882-91959904 CTGTAGACACTATGGGTGAGGGG - Intergenic
1089528538 11:119112382-119112404 CTGTGGAGACAGTAAGTGAGGGG + Exonic
1089756519 11:120691588-120691610 CTTTAAAGAAAGTAGGAGAGAGG + Intronic
1089900679 11:121980559-121980581 GTCTAGACAGAGTAGGAGAGTGG + Intergenic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1091427659 12:405246-405268 CTGTAGAGACAGTAGGTTAGTGG + Intronic
1091756437 12:3055536-3055558 AAGTTGACACAGTCGGAGAGTGG + Intergenic
1092213867 12:6667005-6667027 TTGTAGGCAGAGAAGGAGAGAGG + Exonic
1093091763 12:14929312-14929334 CTGGAGAGACTGCAGGAGAGTGG - Intronic
1093789948 12:23237444-23237466 AACTAGACACAGTGGGAGAGAGG + Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1103680217 12:122687923-122687945 ATGTACACACGGTTGGAGAGAGG - Intergenic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1105358057 13:19678231-19678253 TTGCAGACACAGTGGGAGTGAGG - Intronic
1105894876 13:24709297-24709319 CTCTACCCACAGTAGGGGAGGGG - Intronic
1107015604 13:35706103-35706125 CTAAAGACACAGGAGGAGAAAGG + Intergenic
1107392422 13:39980892-39980914 ATTTATACACAGTGGGAGAGAGG - Intergenic
1110666431 13:78122829-78122851 TTGCAGACAAAGTGGGAGAGAGG + Intergenic
1112445172 13:99457837-99457859 CTGTTCACACAGTAGCACAGTGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1114266779 14:21076941-21076963 CTGAAGACATTCTAGGAGAGAGG + Intronic
1114438237 14:22726065-22726087 CTGGAGACACCGTGGGGGAGTGG - Intergenic
1116200406 14:41786889-41786911 GAGTAGACACAGTAGAAGAAAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1120524232 14:85559275-85559297 CTGAAAACAGAGTAGAAGAGGGG + Intronic
1121318248 14:92974875-92974897 CTGTGGTCACAGGAGGAGCGGGG + Intronic
1121712957 14:96052857-96052879 CAGTTGACTCAGGAGGAGAGTGG + Intronic
1121951489 14:98174779-98174801 CTGTAGACACCCTTGGATAGTGG + Intergenic
1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG + Intergenic
1122524030 14:102367440-102367462 CTGTAGGCAGAGTAGGTCAGTGG - Intronic
1122778578 14:104134085-104134107 CTGGAGAGAGAGTAGGAGTGGGG - Intergenic
1124569390 15:30848252-30848274 CTGTATACAGAGTACCAGAGCGG + Intergenic
1126535700 15:49760917-49760939 TATTAGACACAGTAGAAGAGAGG + Intergenic
1127109578 15:55653359-55653381 TTCTAAACTCAGTAGGAGAGGGG - Intronic
1128190002 15:65683912-65683934 CTGTAGACACAGTATATTAGTGG - Intronic
1132307987 15:100831492-100831514 CTGTACACAGTGCAGGAGAGGGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132445318 15:101912426-101912448 CTGTAGAGGCAGTGGCAGAGGGG + Intergenic
1133481065 16:6171173-6171195 ATATAGACAAAGAAGGAGAGAGG - Intronic
1134261805 16:12656929-12656951 TTGTAGGCACTGAAGGAGAGCGG - Intergenic
1136736893 16:32474451-32474473 CTGTAGAAAGAGGAGGTGAGGGG + Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1141381027 16:83577232-83577254 CAGTGGACACAGTAGGACAGGGG - Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142414203 16:89932548-89932570 CTGCAAACAAAGTGGGAGAGGGG - Intronic
1142434225 16:90046945-90046967 CTGAGGACAAGGTAGGAGAGAGG - Intergenic
1203016176 16_KI270728v1_random:355126-355148 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1203034511 16_KI270728v1_random:628284-628306 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1144874020 17:18387612-18387634 CTTTATTCACAGTAGGAGGGGGG + Intronic
1148582094 17:48751323-48751345 CTGCAGACAGAGAAGCAGAGTGG - Intergenic
1148589684 17:48806510-48806532 CTGTGGACATCGGAGGAGAGGGG - Intronic
1149680777 17:58505584-58505606 CTGTAGACATGACAGGAGAGTGG + Intronic
1152113306 17:78369424-78369446 CTGTAGACGCAGTAGCTGTGTGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1154004969 18:10519392-10519414 GTGTAGACACAGTGCTAGAGGGG - Intergenic
1154181651 18:12144151-12144173 CTGTAGAGGCAGTGGCAGAGAGG + Intergenic
1154182253 18:12147433-12147455 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1155369704 18:25084752-25084774 ATGTGGACACATTGGGAGAGAGG + Intronic
1155530686 18:26763555-26763577 TTTTAGACACAGGAGGCGAGAGG + Intergenic
1157357222 18:46946962-46946984 CCGCAGCAACAGTAGGAGAGGGG - Intronic
1158850757 18:61493903-61493925 GTGTAGACAAAGTTGGTGAGTGG - Intronic
1159236428 18:65679982-65680004 CTGTAGACATAGCAAGAGTGAGG - Intergenic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160639991 19:121281-121303 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1160748814 19:724064-724086 CTGCAGACAGATGAGGAGAGGGG + Intronic
1161197752 19:2996473-2996495 CTGGAGACACCGCAGGAAAGGGG - Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162232457 19:9278962-9278984 CTGGTGACACAGTAGTACAGGGG + Intergenic
1162687013 19:12395447-12395469 TTGTAGATAAAGTAGAAGAGAGG - Intronic
1162691344 19:12435281-12435303 TTGTAGATAAAGTAGAAGAGAGG - Intronic
1164888827 19:31805677-31805699 CAGTTGTCACACTAGGAGAGGGG - Intergenic
1165100071 19:33434049-33434071 CTGGTGACAGAGGAGGAGAGGGG - Intronic
1165342556 19:35223432-35223454 CTGTCCACACTGGAGGAGAGGGG + Intergenic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166329774 19:42071099-42071121 CTCTAGTCACAGGAGCAGAGAGG + Intronic
925803374 2:7624714-7624736 CTTTAGACAGAGAAGCAGAGGGG - Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927356284 2:22177401-22177423 CAGTAGGCACAGTAGGGCAGGGG + Intergenic
927363832 2:22270519-22270541 CATTAGACACAGCAGGAGAGAGG + Intergenic
927880251 2:26685335-26685357 CTGTAGAAACAGTATCAAAGGGG - Intergenic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
929205781 2:39290954-39290976 CTGTAGTCCCAGCAGGAGAATGG + Intronic
930154667 2:48093869-48093891 CTGTAGTCAATGTAGGGGAGTGG + Intergenic
931543390 2:63354035-63354057 CTGTAGAGGCAGTGGCAGAGAGG - Intronic
931930340 2:67126191-67126213 GTGTAAATACAGTAGGAGATTGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
932983332 2:76697494-76697516 TTCTGGACACAGTAGGAGGGTGG - Intergenic
933996042 2:87670744-87670766 CTCTAGAGAGAGTAGGACAGAGG + Intergenic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
934528010 2:95063837-95063859 CTGTGCACACAGCAGGAAAGGGG - Intergenic
937245722 2:120491333-120491355 CTGTACACACACTAGAATAGTGG - Intergenic
937305777 2:120869751-120869773 CTGAAGACAGAGGAGTAGAGTGG + Intronic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
939389699 2:141550659-141550681 ATCTAGAAAAAGTAGGAGAGAGG - Intronic
941344613 2:164352203-164352225 CTGGATAGATAGTAGGAGAGAGG - Intergenic
941547323 2:166868252-166868274 CTGGCCACACAGCAGGAGAGCGG + Intergenic
943011200 2:182451796-182451818 CCGTGGAGGCAGTAGGAGAGAGG - Intronic
943076357 2:183200358-183200380 ATGTAGAAACAGTAGGACAGTGG + Intergenic
943561253 2:189465647-189465669 TTATAGCCACAGTACGAGAGTGG - Intronic
945406238 2:209452227-209452249 AAGTAGACAGAGTAGGGGAGAGG + Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
1169938770 20:10914398-10914420 GTGAAGACACAGCAAGAGAGTGG + Intergenic
1170421967 20:16201875-16201897 CGGTGCACACAGTAGGACAGGGG - Intergenic
1170445054 20:16417921-16417943 TTGTAGTCGCAGAAGGAGAGGGG + Intronic
1170727957 20:18946828-18946850 CTGTAGGTACAAGAGGAGAGGGG + Intergenic
1170805298 20:19624616-19624638 CTTTGGACACTGAAGGAGAGTGG - Intronic
1174558352 20:51412561-51412583 CTGTAACCACAGCAGGAGGGAGG + Intronic
1174563651 20:51448963-51448985 GTGGAAAAACAGTAGGAGAGGGG - Intronic
1175093932 20:56527110-56527132 CAATAAACACTGTAGGAGAGAGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1177590697 21:23162447-23162469 CTGTAGAGTCAGTGTGAGAGAGG + Intergenic
1180535654 22:16391461-16391483 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1182250958 22:28999865-28999887 ATGTAGAGACAGAAGGAAAGGGG + Intronic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
952515881 3:34104411-34104433 CTGTTGACACATTAGGGGAAGGG + Intergenic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
952929739 3:38349806-38349828 GTGAAGACACAGCAAGAGAGTGG - Intronic
953624324 3:44558151-44558173 AGGTAGAATCAGTAGGAGAGAGG + Intronic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
955569667 3:60291102-60291124 CTGCAGACACACAAGGAGTGAGG + Intronic
956304829 3:67812214-67812236 CTGTAGATAGAGTAGTTGAGAGG + Intergenic
956423083 3:69104834-69104856 CTTCAGACACAATAGGAGGGTGG - Exonic
957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG + Intergenic
959550054 3:107644029-107644051 CTATAGATAAAGTAGCAGAGGGG - Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962254362 3:133860345-133860367 CTGAAGACAGAGGCGGAGAGTGG + Intronic
963063260 3:141241855-141241877 CTGGAGGCTGAGTAGGAGAGGGG + Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
965162311 3:165150109-165150131 CTGTAGTCCCAGCAGGAGAATGG - Intergenic
966058827 3:175731024-175731046 CAGGAAACACAGTAGTAGAGTGG + Intronic
967822310 3:193849539-193849561 CCATAGACACAGTGGAAGAGGGG - Intergenic
968582233 4:1400484-1400506 CTGGGGACCCAGTAGGAGTGTGG + Intergenic
969590080 4:8116962-8116984 TGGTATAGACAGTAGGAGAGGGG + Intronic
970139334 4:12964222-12964244 CTTTAGTCAGAATAGGAGAGAGG + Intergenic
970478828 4:16452303-16452325 ATGAAGACACAGCAGGAAAGGGG - Intergenic
972125617 4:35761168-35761190 CTGTAATGACAGTAGCAGAGGGG - Intergenic
974402751 4:61426456-61426478 CTGCTGACTCTGTAGGAGAGGGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
978208243 4:106105063-106105085 CTGCAGAGACAGTGGCAGAGAGG - Intronic
980023782 4:127740359-127740381 CTGTAGACAATGTTGGACAGGGG + Intronic
980427444 4:132644760-132644782 TTGTGGACACAGTAGCAGAGAGG - Intergenic
980432789 4:132726320-132726342 CTCTAGACAAAGTCAGAGAGTGG + Intergenic
981281402 4:142964054-142964076 TTTAAGACACAGTATGAGAGAGG + Intergenic
982646211 4:158027422-158027444 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
983706446 4:170666070-170666092 CAGTTGCCACAGTAGGAGAATGG + Intergenic
983973662 4:173904863-173904885 CTGTAGAATAAGTAGGAGAGGGG - Intergenic
985999807 5:3621378-3621400 CTCTAGGCACAGGAGGAGTGGGG + Intergenic
987170609 5:15253509-15253531 ATATAGACAAAGTAGGAGATGGG + Intergenic
987674824 5:21061902-21061924 CTGCAGAGACAGTAGCAAAGAGG + Intergenic
987871937 5:23630735-23630757 ATTTAGAGACAGTAGGATAGAGG + Intergenic
988282069 5:29162492-29162514 CTGTAAACACAGCAGCACAGAGG + Intergenic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
992752389 5:79873359-79873381 CTGTACACAGAGCATGAGAGTGG + Intergenic
993018681 5:82564631-82564653 CTGCAGATACAGTGGCAGAGAGG - Intergenic
993625775 5:90223196-90223218 ATCTCGACTCAGTAGGAGAGGGG - Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
995063543 5:107837000-107837022 ATGGAGACAGAGTAGGAGAGAGG - Intergenic
996403542 5:123086879-123086901 CTGTAGACGTAGTGGGCGAGGGG + Intergenic
997360397 5:133291146-133291168 CAGGAGACACAGGAGGGGAGGGG + Intronic
998951546 5:147397688-147397710 TTGTAGACATAGTCGGAGAACGG + Exonic
999420954 5:151442666-151442688 CTGTACAAACAGTAGAACAGAGG - Intronic
999880648 5:155860025-155860047 CTGTATTTACAGCAGGAGAGGGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1002335991 5:178478624-178478646 CTGTGGACACAGGAAGGGAGGGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002593639 5:180307641-180307663 CTTGAGACACAGCAGGAAAGAGG - Intronic
1002747341 6:69688-69710 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1005215382 6:23521350-23521372 CTCCAGACACAGGAGGCGAGAGG - Intergenic
1005695001 6:28343646-28343668 CTGTAGTCCCAGCAGGAGAATGG - Intronic
1007630580 6:43270951-43270973 GTGAAGACACAGCAGAAGAGAGG + Intronic
1009769553 6:68127247-68127269 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1011303599 6:85902183-85902205 CTGAACACAGAGTAGCAGAGGGG + Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013822150 6:114167373-114167395 CTGTAGACACAGTAGTAAGTAGG + Intronic
1016448515 6:144157157-144157179 CACAATACACAGTAGGAGAGAGG + Intronic
1020363987 7:7360285-7360307 TTGTAGATACAGTAGCAGATTGG + Intronic
1021613558 7:22480362-22480384 CTGTAGTCACAGTCTGTGAGCGG + Intronic
1022905153 7:34848617-34848639 CTGAAGACACAGTAGATGAGGGG - Exonic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023983995 7:45084897-45084919 CAGAAGACAGAGGAGGAGAGCGG - Exonic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1027431273 7:78114905-78114927 CTGTGGACACACTGTGAGAGGGG + Intronic
1027808234 7:82857815-82857837 CTTTTGACAAAGGAGGAGAGAGG + Intronic
1028169164 7:87575022-87575044 TTGTATACAAAGTAGGAGAATGG - Intronic
1028217078 7:88146816-88146838 CAGGAGACACAGTGGTAGAGTGG - Intronic
1029233662 7:99093364-99093386 CTGAAAGCAAAGTAGGAGAGTGG - Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030809396 7:113956214-113956236 CTGCAGAGACAGTGGCAGAGAGG + Intronic
1033593569 7:142836460-142836482 ATATAGACACAGTGGGAGTGGGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036679924 8:10864491-10864513 CTGTTGAGGCAGTAGGGGAGTGG + Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1041786099 8:61636366-61636388 CTATAGAGACAGAGGGAGAGAGG + Intronic
1042024983 8:64413770-64413792 CTGTAGACACATGAGGAAGGGGG - Intergenic
1042040831 8:64586914-64586936 CTTTAGACACAGTAGGTGGAAGG + Intergenic
1042200590 8:66276579-66276601 CTGTAGACATGGGAGGAGACAGG - Intergenic
1043785550 8:84394101-84394123 CTGTAGAAACAGTGGAAGACTGG - Intronic
1044593590 8:93937722-93937744 CAGGAGACAGTGTAGGAGAGTGG + Intergenic
1046830527 8:118740980-118741002 CTGAACACACAGGAGGTGAGAGG - Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1050828111 9:9975165-9975187 CAGTAGACACAGTAAGACTGTGG + Intronic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1052415513 9:28172060-28172082 CAGTAGCCACAGCAGGAAAGTGG - Intronic
1055708094 9:79030537-79030559 CTGTAGGAACTGTAGGAGAGAGG + Intergenic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1056436767 9:86581770-86581792 CTGTATACAGAGTAAGTGAGTGG + Intergenic
1056630130 9:88286657-88286679 CTGTAATCACAGCAGGAGACGGG + Intergenic
1057027563 9:91746543-91746565 GTGTAGACACACTTGGCGAGCGG + Intronic
1057054707 9:91951318-91951340 CTGTAAATCCAGTAGGAGAATGG + Intergenic
1057865808 9:98679796-98679818 CTGAAGACACAGGAGCACAGAGG + Intronic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059472595 9:114517536-114517558 CTCTAGACACAGTAAGTAAGTGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060679769 9:125551895-125551917 CTTTAGACAAAGTAGGACAAGGG - Intronic
1188715013 X:33449618-33449640 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1189317140 X:40064217-40064239 CCGTAGACAGAGTCGGTGAGGGG - Intronic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1192373030 X:70531345-70531367 CTGTGAACAAAGTAGCAGAGGGG - Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1194467591 X:94253250-94253272 CTCTATACACATTAGGAGGGTGG - Intergenic
1194917528 X:99723408-99723430 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1195856505 X:109338199-109338221 CTGCAGAGACAGTGGCAGAGGGG + Intergenic
1197929485 X:131679808-131679830 CGGTAGAGAAAGGAGGAGAGAGG - Intergenic
1198676866 X:139140481-139140503 CAGTAGATACATTAGGAGACTGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic