ID: 961772952

View in Genome Browser
Species Human (GRCh38)
Location 3:129263576-129263598
Sequence CATCAGTGGGAGCCAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 525}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961772942_961772952 12 Left 961772942 3:129263541-129263563 CCAAAAAGGAGCCAGAGGAGATG 0: 1
1: 0
2: 3
3: 23
4: 352
Right 961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG 0: 1
1: 0
2: 0
3: 26
4: 525
961772947_961772952 1 Left 961772947 3:129263552-129263574 CCAGAGGAGATGATGGGTGGGAA 0: 1
1: 0
2: 2
3: 22
4: 223
Right 961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG 0: 1
1: 0
2: 0
3: 26
4: 525
961772937_961772952 30 Left 961772937 3:129263523-129263545 CCCCAGAGACAGGCTTAACCAAA 0: 1
1: 0
2: 0
3: 12
4: 167
Right 961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG 0: 1
1: 0
2: 0
3: 26
4: 525
961772938_961772952 29 Left 961772938 3:129263524-129263546 CCCAGAGACAGGCTTAACCAAAA 0: 1
1: 0
2: 0
3: 13
4: 165
Right 961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG 0: 1
1: 0
2: 0
3: 26
4: 525
961772939_961772952 28 Left 961772939 3:129263525-129263547 CCAGAGACAGGCTTAACCAAAAA 0: 1
1: 0
2: 0
3: 11
4: 147
Right 961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG 0: 1
1: 0
2: 0
3: 26
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961772952 Original CRISPR CATCAGTGGGAGCCAGTGGT AGG Intronic
900858445 1:5205305-5205327 CATGAGAGGGACCCAGTGGGAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902424900 1:16312490-16312512 AATCAGTGATTGCCAGTGGTTGG + Intronic
902688508 1:18095005-18095027 CATGAGAGGGACCCAGTGGGAGG - Intergenic
902948423 1:19861084-19861106 CCTCCCAGGGAGCCAGTGGTGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903581983 1:24377811-24377833 CTTCAGTGGGCACCAGTGGATGG - Intronic
903696279 1:25209722-25209744 CATTAGTGGTTGCCAGGGGTTGG - Intergenic
903832537 1:26183610-26183632 CATGAGTGGGAGGCAGAAGTGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905017501 1:34787668-34787690 GGTCAGTGGGAGCCACTGGCAGG - Intronic
905340402 1:37273922-37273944 CAACTGTGGGAGCTAGTGGTGGG - Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
905755377 1:40504911-40504933 CATGGGAGGGACCCAGTGGTAGG - Intergenic
905986756 1:42292005-42292027 CAGGAGTGGGAGCCAGGGGATGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907373726 1:54019104-54019126 CACCCGTCAGAGCCAGTGGTAGG - Intergenic
907846069 1:58208134-58208156 CATGAGAGGGACCCAGTGGGAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908800077 1:67871079-67871101 CATGAGAGGGACCCAGTGGGAGG + Intergenic
908957277 1:69648492-69648514 AACCAGTGGGAGACACTGGTTGG + Intronic
908997513 1:70174748-70174770 CATTAGTGGTTGCCAGGGGTTGG + Intronic
909484745 1:76160215-76160237 CAAGAGTGGCAGGCAGTGGTTGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909871076 1:80739821-80739843 CATGAGAGGGACCCAGTGGGAGG - Intergenic
910136150 1:83972279-83972301 GATCAGTGGTTGCCAGGGGTTGG - Intronic
910378875 1:86603803-86603825 CATGAGAGGGACCCAGTGGGAGG - Intergenic
911090572 1:94013930-94013952 CATGAGTGGGAAACAGGGGTAGG + Intronic
911342976 1:96661825-96661847 GATCAGTGGTTGCTAGTGGTTGG - Intergenic
912660684 1:111526847-111526869 CATCAGTGGCTTCCAGAGGTTGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915330077 1:155105935-155105957 CATGACTGGGAGCCACTGGAGGG + Intergenic
915786892 1:158623487-158623509 CATGGGAGGGAGCCAGTGGGAGG + Intronic
917219010 1:172707411-172707433 CATCAGAGGGAGCCAGGCTTAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917723475 1:177808567-177808589 ACTCAGTGGGAGACACTGGTGGG + Intergenic
918592099 1:186251561-186251583 CATCAGTTGTAGCTAATGGTGGG + Intergenic
918833886 1:189434902-189434924 AATCAGTGGTTGCCAGGGGTTGG + Intergenic
919277617 1:195440862-195440884 CATAAGAGGGACCCAGTGGGAGG - Intergenic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920607046 1:207399034-207399056 CATGGGCTGGAGCCAGTGGTGGG + Intergenic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921587750 1:216967402-216967424 GATCAGTGGTTGCCAGAGGTTGG - Intronic
921627281 1:217390821-217390843 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
1063021514 10:2133735-2133757 GATCAGTGGCTGCCAGGGGTTGG + Intergenic
1063035905 10:2286367-2286389 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063441262 10:6075222-6075244 CAGCAGCGGGAGGCAGTTGTGGG + Intergenic
1064023243 10:11826045-11826067 GATCAGTGGCTGCCAGAGGTTGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064170516 10:13028145-13028167 CATGAGAGGGACCCAGTGGGAGG + Intronic
1066174088 10:32885885-32885907 AAACAGTGGAAGGCAGTGGTAGG + Intergenic
1067056395 10:43054839-43054861 ACTCAGGGGAAGCCAGTGGTGGG - Intergenic
1067529064 10:47057469-47057491 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1068100668 10:52548674-52548696 GATCAGTGGTTGCCAGTGGATGG - Intergenic
1068395546 10:56456879-56456901 CATGTGTGGGAACCAGTGTTGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070476490 10:76834314-76834336 CAGCAGTGGGAGTCAGAAGTGGG + Intergenic
1070687517 10:78500121-78500143 CATGGGTGGGACCCAGTGGGAGG - Intergenic
1070747522 10:78943517-78943539 CAACAGTGGAAGCAAGAGGTTGG - Intergenic
1070811800 10:79301809-79301831 CATGATGGGGAGGCAGTGGTAGG + Intronic
1072274252 10:93807061-93807083 CATCCGTGGGTTCCAGGGGTGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073312209 10:102551130-102551152 CACCTGTGGGAGCCAGTTGTTGG + Intronic
1073505970 10:103990159-103990181 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1076528752 10:131130298-131130320 CATGAGAGGGACCCAGTGGGAGG - Intronic
1076568874 10:131418805-131418827 CAGCAGTGTGAGCGTGTGGTTGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1080650192 11:34216338-34216360 GATCAGTGGTTGCCAGGGGTTGG - Intronic
1081594848 11:44452074-44452096 CATCAGAGGGAGCCAAGGGGAGG - Intergenic
1083255430 11:61492537-61492559 CAGCAGCAGGAGCCAGGGGTGGG - Intergenic
1083519230 11:63292319-63292341 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1083854744 11:65387104-65387126 CCTCCGTGGGAGCCCGAGGTGGG + Exonic
1084220217 11:67673444-67673466 CAGCAGTCAGAGCCAGGGGTGGG - Intronic
1084265861 11:68004752-68004774 CTGCAGCGGGAGCCTGTGGTGGG + Intronic
1084318032 11:68356779-68356801 CATCAGTGGTTGCCAGGAGTTGG - Intronic
1084748326 11:71187671-71187693 CCTCAGTGGGAGGCAGTACTTGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086620769 11:88884661-88884683 CATGAGAGGGACCCAGTGGGAGG + Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087960899 11:104347800-104347822 CATGAGAGGGACCCAATGGTAGG + Intergenic
1090682156 11:129072625-129072647 CCTCTGTGGGAACCAGTGCTAGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091599681 12:1910262-1910284 GATAAGTGGTTGCCAGTGGTTGG + Intronic
1092084603 12:5745475-5745497 CACAAGTGGGAGCCACTGCTAGG + Intronic
1092165031 12:6337161-6337183 CAGCAGTGGTGCCCAGTGGTGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093026809 12:14253035-14253057 CCTCACTGGGAGGCAGAGGTAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095188836 12:39232698-39232720 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1095340038 12:41079495-41079517 CATGGGAGGGACCCAGTGGTAGG + Intergenic
1096470371 12:51871814-51871836 CATCTGTGAAAGCCAGTGGTGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098898946 12:76093025-76093047 CATCAGTGATTGCCAGGGGTTGG + Intergenic
1101396795 12:104355865-104355887 CACCATTGGGAGCCACTGGAGGG + Intergenic
1102975037 12:117200736-117200758 AATCATTGGGAGCCAGAGGATGG + Intergenic
1103404387 12:120665053-120665075 GATCAGTGGGTGCAAGGGGTTGG + Intronic
1103574449 12:121866939-121866961 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1103637141 12:122316454-122316476 CATCACTGGGAGGCTGAGGTGGG - Intronic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1104074938 12:125380689-125380711 CATCAGCTGAAGCCAGTTGTGGG - Intronic
1104609510 12:130216829-130216851 CATCAGTGTGAGCCAGGAGTTGG - Intergenic
1104792255 12:131490990-131491012 CATCAGTGGGAGGCTGTGATTGG - Intergenic
1105452250 13:20510464-20510486 GATCAGTGGTTGCCAGCGGTTGG + Intronic
1105621597 13:22072723-22072745 TGTCAGTGTGAGCCAGTGGAAGG - Intergenic
1105654016 13:22414965-22414987 CATGAGTGGAAACCAGTGCTGGG + Intergenic
1105970572 13:25426057-25426079 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1106790314 13:33149030-33149052 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1107896747 13:44972473-44972495 AATCAGTGGTTGCCAGTGGGTGG + Intronic
1108158878 13:47617847-47617869 CATCAGTTGGAGGTGGTGGTGGG - Intergenic
1109750647 13:66686175-66686197 CATGAGAGGGACCCAGTGGGAGG + Intronic
1110970352 13:81753815-81753837 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1111457596 13:88505457-88505479 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1112497064 13:99913768-99913790 CCTCAGAGGGAGCAAGTGCTGGG + Intergenic
1112601209 13:100857416-100857438 CATGAGGAGGAGCTAGTGGTGGG + Intergenic
1113249110 13:108431603-108431625 CAGCTGTGGGAGCCCGAGGTTGG - Intergenic
1113249355 13:108434509-108434531 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114804606 14:25820518-25820540 CATCAGTGGGACTCAGAGGCTGG - Intergenic
1114975972 14:28099914-28099936 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116406099 14:44568009-44568031 CATCAGTGGGGGGCAGGGTTAGG - Intergenic
1116589771 14:46757192-46757214 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1116986786 14:51228479-51228501 AATCAGTGGGAGCTGTTGGTGGG - Intergenic
1117231450 14:53723456-53723478 GATCAGTGGCAGCCAGGGGCTGG - Intergenic
1117293415 14:54355506-54355528 AATCAGTGGTAGCCAGGGGTTGG + Intergenic
1118434269 14:65755293-65755315 CTTCAGTGGGAGCCAGCGAGTGG - Intergenic
1118884002 14:69851638-69851660 CAGCACTGTGGGCCAGTGGTGGG - Intergenic
1120081278 14:80219153-80219175 CATTAGAGGGTACCAGTGGTTGG + Intronic
1120784194 14:88515960-88515982 AAGCAGTAGGATCCAGTGGTAGG - Intronic
1121871065 14:97407950-97407972 AATCAGAGGGAGGCAGAGGTGGG - Intergenic
1122314872 14:100820052-100820074 CATTGGTGGCAGGCAGTGGTAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123035840 14:105471608-105471630 CCTCCGTGGGAGCCTGTGCTGGG + Intergenic
1124513972 15:30350577-30350599 CAGCAGTGGGGGCCAGCAGTAGG - Intergenic
1124718315 15:32088107-32088129 TATCAGTGGTTGCCAGTGGTGGG - Intronic
1124728949 15:32180188-32180210 CAGCAGTGGGGGCCAGCAGTAGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126983473 15:54274122-54274144 CAACAGGGGGAGCCAGTCCTAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127797101 15:62448006-62448028 CATCAGTGGCAGCCAGCCCTTGG - Intronic
1128760181 15:70211332-70211354 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1129684689 15:77678347-77678369 GATCAGTGGTTGCCAGGGGTAGG - Intronic
1129701074 15:77769015-77769037 CAGCAGTGGGAGCCATTGAAGGG - Intronic
1129929440 15:79398157-79398179 AATCAGTGGTTGCCAGGGGTTGG - Intronic
1132128262 15:99249665-99249687 AATCTTTGGGAGCCAGAGGTGGG + Intronic
1132267178 15:100484425-100484447 CATCAGTGGGTGACAGAGCTGGG + Intronic
1132410633 15:101575852-101575874 AATCAGTGGTAGCCTGGGGTTGG + Intergenic
1132660757 16:1060544-1060566 CACCACTGGCAGCCAGTGGGCGG - Intergenic
1133120377 16:3602991-3603013 CCTCAGTGGCAGGCACTGGTAGG - Intronic
1133127434 16:3655933-3655955 AATCAGTGGGTGACAGTGGCAGG + Exonic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1133704932 16:8345251-8345273 CATGAGAGGGATCCAGTGGGAGG + Intergenic
1134205727 16:12236654-12236676 AATCAGTGGTAGCCTGTGGCTGG - Intronic
1134252885 16:12587155-12587177 CACCAGTGGGCTGCAGTGGTGGG - Intergenic
1136241448 16:28946974-28946996 CAGCACTGGGAGCCTGAGGTGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137475197 16:48801937-48801959 CTTCTGTGGGAGCCAGTGCCAGG + Intergenic
1137628731 16:49927069-49927091 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1138127703 16:54452508-54452530 ACTCAGTGGGAGCCGGAGGTCGG - Intergenic
1138895567 16:61199547-61199569 CATGAGAGGAAGCCAGTGGGAGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139730217 16:68937556-68937578 GATCAGTGGTTGCCAGGGGTTGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140939743 16:79710196-79710218 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1203142322 16_KI270728v1_random:1776257-1776279 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143089489 17:4440573-4440595 CCTGAGGGGGAGCCTGTGGTCGG + Intronic
1143143823 17:4760156-4760178 GGTCAGTGGCAGCCAGGGGTTGG - Intergenic
1143167786 17:4906604-4906626 CATCACTGGGAGGCTGAGGTAGG + Intergenic
1143228209 17:5326461-5326483 GATCAGTGGTTGCCAGGGGTAGG + Intronic
1143312935 17:6008182-6008204 GATCAGTGGTTGCCAGTGGATGG - Intronic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144599862 17:16601973-16601995 GATCAGTGGTAGCTAGGGGTTGG + Intergenic
1145228565 17:21152507-21152529 CTTCAGTGGGACCCAGTCATGGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146466686 17:33091753-33091775 CATGAGTGGGAGCAGGTGATAGG + Intronic
1147752762 17:42746427-42746449 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1147897970 17:43763943-43763965 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1148051239 17:44770866-44770888 CATCACTGGGAGGCTGAGGTGGG + Intronic
1148341407 17:46875611-46875633 CACCAGTGGGAGCCAGGCTTAGG + Intronic
1148802312 17:50237650-50237672 GATCAGTGGTTGCCAGGGGTGGG - Intergenic
1149109352 17:53008615-53008637 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1149190190 17:54051584-54051606 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1149401886 17:56305245-56305267 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1149485273 17:57037775-57037797 CAACACTGGGAGGCAGAGGTGGG - Intergenic
1149729987 17:58935749-58935771 GATCAGTGTGAGCAAATGGTTGG + Intronic
1150136685 17:62699652-62699674 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1150960554 17:69907651-69907673 CATCAGTGGGAGCGGGAAGTTGG - Intergenic
1151045007 17:70909582-70909604 GATCAGTGGTTGCCAGAGGTTGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152182768 17:78834687-78834709 CACCTGTGGGAGGCAGAGGTGGG - Intronic
1152425836 17:80218236-80218258 CATCAGTGAGAAGCAGCGGTGGG - Intronic
1153087800 18:1308214-1308236 CATAAGAGGGACCCAGTGGGGGG + Intergenic
1153177276 18:2391594-2391616 CATCAGTGGTTGCCTGGGGTTGG + Intergenic
1154329898 18:13421267-13421289 GCTGTGTGGGAGCCAGTGGTAGG + Intronic
1154333738 18:13450172-13450194 CTTCAGTGGGAGGCACGGGTAGG - Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155564392 18:27117561-27117583 CATCAGTGGTTGCCAGGGTTAGG - Intronic
1156169085 18:34460652-34460674 CATGGGAGGGACCCAGTGGTAGG + Intergenic
1156243730 18:35277434-35277456 CATGAGAGGGACCCAGTGGGAGG + Intronic
1156370107 18:36465475-36465497 CAGGGGTGGGAGCCAGGGGTTGG + Intronic
1157478314 18:48037180-48037202 GACCAGTGGGAACAAGTGGTGGG + Intronic
1157501234 18:48192282-48192304 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1157875631 18:51270771-51270793 CATGGGTGGGACCCAGTGGGAGG - Intergenic
1158556573 18:58480031-58480053 CATCAGTGATTGCCAGGGGTTGG + Intergenic
1158894310 18:61898705-61898727 CATCAGAGGGAACAAGTGGGGGG + Intergenic
1159769007 18:72526824-72526846 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1159801692 18:72908083-72908105 CATCAGCAGTAGCCAGTGTTTGG - Intergenic
1159895849 18:73995448-73995470 CATCAGAGGGACCTAGTGGGAGG + Intergenic
1160927807 19:1555514-1555536 CATCTGCGGGGGCCAGGGGTGGG - Exonic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162818863 19:13211000-13211022 CATCGGCCGGAGCCAGGGGTTGG - Intronic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1164827766 19:31297012-31297034 CCTCAGTGGGAGCGGGAGGTGGG + Intronic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1165073714 19:33269548-33269570 ACTCAGGGGGAGCCTGTGGTGGG + Intergenic
1165879317 19:39031654-39031676 CAGCATTGGGAGCCGGTGGGAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166423860 19:42658614-42658636 CCTCAGTGGGAACCAGTACTGGG + Intronic
1166487248 19:43223957-43223979 CCCCAGTGGGAACCAGTGCTGGG - Intronic
1166494092 19:43285844-43285866 CCTCAGCGGGAACCAGTGCTGGG - Intergenic
1167125224 19:47544704-47544726 CCACAGCAGGAGCCAGTGGTGGG + Exonic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168169493 19:54576265-54576287 CAGGGGTGGGAGCCAGGGGTGGG - Intronic
1168172332 19:54596957-54596979 CAAGGGTGGGAGCCAGGGGTGGG - Intronic
1168185809 19:54698652-54698674 CAGGGGTGGGAGCCAGGGGTGGG - Intronic
1168407216 19:56116974-56116996 AATCAGTGGGAGACAGTGCGAGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927422321 2:22946596-22946618 TATCTTTGGGAGCCAGTGGGTGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928304101 2:30151960-30151982 GATCAGTGGTTGCCAGTGGCTGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928763442 2:34611815-34611837 CATTATTGGGAGCCCGTGGCTGG - Intergenic
929275695 2:40022173-40022195 CATGGGAGGGACCCAGTGGTAGG + Intergenic
929493018 2:42413860-42413882 CATGAGAGGGACCCAGTGGGAGG - Intronic
929511619 2:42569174-42569196 ACTCAGTGGGAGCCTGGGGTGGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930446706 2:51482536-51482558 CATGAGAGGGACCCAGTGGGAGG + Intergenic
932488587 2:72103966-72103988 CTTCAGTGAGAGACAGAGGTAGG - Intergenic
932510709 2:72286469-72286491 GATCAGTGGCTGCCAGGGGTTGG + Intronic
933394099 2:81710314-81710336 CATGAGAGGGACCCAGTGGGAGG + Intergenic
933649934 2:84842361-84842383 CATAATTGGGACCCACTGGTAGG - Intronic
935195825 2:100815502-100815524 GATCAGTGGCTGCCAGTAGTTGG + Intergenic
935200973 2:100856350-100856372 CAGCATTGGGAGCCTGTGCTCGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935800486 2:106690637-106690659 AATGAGAGGGAGCCAGTGGGAGG - Intergenic
936261326 2:110961928-110961950 CATGGGAGGGACCCAGTGGTAGG - Intronic
936397841 2:112142471-112142493 CACCAGTAAGAGCCATTGGTTGG + Intronic
936895982 2:117428187-117428209 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
937098954 2:119254085-119254107 CCTGAGTGTGAGCCAGTGATGGG + Intronic
937344059 2:121112449-121112471 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
937541461 2:122959908-122959930 GATCAGTGGTTGCCAGAGGTCGG + Intergenic
937658481 2:124403991-124404013 CATGAGAGGGACCCAGTGGGAGG - Intronic
937836812 2:126479416-126479438 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938279462 2:130053772-130053794 CATTAGGGGGATCCAGTAGTGGG - Intergenic
938330410 2:130444486-130444508 CATTAGGGGGATCCAGTAGTGGG - Intergenic
938359535 2:130677017-130677039 CATTAGGGGGATCCAGTAGTGGG + Intergenic
938435934 2:131283663-131283685 CATTAGGGGGATCCAGTAGTGGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939024741 2:136998465-136998487 CATCTGTGGGAGGAAGGGGTGGG + Intronic
939217664 2:139260340-139260362 CATCACTGTGAGCCAGTGATGGG + Intergenic
939664401 2:144932890-144932912 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
940567602 2:155387710-155387732 CATCAGTGGCTGACAGTGGGAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941058652 2:160818890-160818912 CATCAGTGGTTGCTAGAGGTTGG - Intergenic
942287050 2:174429793-174429815 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
943568711 2:189546597-189546619 CATGAGTAGGACCCAGTGGGAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
946393706 2:219432392-219432414 CATCAGTGGTTGCCAGAGGTTGG + Intergenic
946901970 2:224381506-224381528 AATCAGTGGTTGCCAGGGGTTGG + Intronic
947070363 2:226281473-226281495 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
947413783 2:229871522-229871544 CAAGAGTGGGAGCAAGGGGTGGG - Intronic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
948558295 2:238833071-238833093 GATCAGTGGTTGCCAGTGGCTGG + Intergenic
948998041 2:241594211-241594233 GATTAGTGGTAGCCAGGGGTTGG + Intronic
1169006809 20:2214162-2214184 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169092416 20:2869647-2869669 TATCAGTGGTAGCCAGTGCAGGG + Intronic
1170008194 20:11691964-11691986 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1171046990 20:21818172-21818194 CATCAGTGGTTGCCAGGGATTGG - Intergenic
1172894463 20:38290670-38290692 CATCAGTGGTTGCCAGGGGCGGG + Intronic
1173875525 20:46368236-46368258 CATCACTGGGAACTAGAGGTGGG - Intronic
1174097313 20:48099559-48099581 CATCACTGAGTGCCAGGGGTGGG + Intergenic
1174459676 20:50673491-50673513 CAGCAGGGAGAGCCAGTGGGTGG - Intronic
1174485798 20:50860429-50860451 GATGAGTGGTAGCCAGGGGTTGG - Intronic
1174514323 20:51079820-51079842 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1174715879 20:52758222-52758244 CATGGGTGGGACCCAGTGGGAGG + Intergenic
1175551035 20:59817865-59817887 CATCAGAGGTGGCCAGTGGGTGG - Intronic
1176018215 20:62948993-62949015 CATGAGTGGAAGGCAGTTGTAGG + Intergenic
1176085937 20:63295527-63295549 CACCAGTGGGAGGCGGCGGTGGG - Intronic
1177297879 21:19200799-19200821 AATCAGTGGTTGCCAGTGGAAGG - Intergenic
1177656995 21:24030263-24030285 CATAAGTGGCAGCCGGTGATAGG - Intergenic
1177692449 21:24528975-24528997 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1178861025 21:36289865-36289887 GATCAGTGGTCGCCAGGGGTTGG + Intronic
1179018227 21:37613737-37613759 GATCAGTGGTTGCCAGGGGTTGG + Exonic
1181335631 22:22125811-22125833 CATGAATCGGAGCCTGTGGTGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181881398 22:25983120-25983142 CAACAGTGGGAGGCAGAGATGGG + Intronic
1182146952 22:28002371-28002393 CAACACTGGGTGCCAGGGGTGGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182889760 22:33807677-33807699 GATCAGTGGTTGCCAGGGGTTGG - Intronic
1182975728 22:34622333-34622355 GATCAGTGAGAGCTCGTGGTAGG + Intergenic
1183128230 22:35805950-35805972 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1183352611 22:37342561-37342583 CAGCAGTGGGACCCAGGAGTGGG - Intergenic
1184003279 22:41690679-41690701 CCTGAGTGGGAGCCAGTGCAGGG + Exonic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184299330 22:43546462-43546484 TATCAGTGGGAGCCAGAAGATGG + Intronic
1184647030 22:45901769-45901791 GATCAGTGGCTGCCAGGGGTTGG + Intergenic
1184888182 22:47360222-47360244 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1185133345 22:49053190-49053212 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1185338348 22:50280728-50280750 CATCAATGTGAGCCAGGCGTCGG - Exonic
949363395 3:3255153-3255175 CATCAGTGGTTGCCAGGGGCTGG - Intergenic
950151115 3:10688309-10688331 CAGCAGAGGGCCCCAGTGGTGGG + Intronic
950676882 3:14559532-14559554 CAACTGTGGGAGGCAGTGGTCGG + Intergenic
951737550 3:25884580-25884602 CATGAGAGGGACCCAGTGGGAGG - Intergenic
952108399 3:30094555-30094577 CATCAATGAGAGACAGTGGCAGG - Intergenic
953082636 3:39635025-39635047 CATAAGAGGGACCCAGTGGGAGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954454754 3:50591732-50591754 CATGACTTGGAGGCAGTGGTTGG - Intergenic
954624269 3:52013984-52014006 GTTCAGTGGCAGCCAGAGGTGGG + Intergenic
954748771 3:52802279-52802301 CATCAGTGGGAGCCTGACCTGGG + Intronic
956948136 3:74247942-74247964 CTTCAGAGGGACCCAGTGGGAGG - Intergenic
957296028 3:78333635-78333657 CATCAGTGGTTGCCAGGGGTTGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960717340 3:120589785-120589807 GATCAGTGGTTGCCAGAGGTTGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG + Intronic
962000585 3:131291104-131291126 GATCAGTGGTTGCCAGGGGTTGG - Intronic
962705937 3:138044588-138044610 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
963257998 3:143165427-143165449 CTTCAGTGGGAGCCATTGATTGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964972774 3:162581759-162581781 CATGAGAGGGACCCAGTGGGAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968063073 3:195740806-195740828 GATCAGTGGTTGCCAGGGGTTGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969908226 4:10417511-10417533 CATAAGAGGGATCCAGTGGGAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970424228 4:15931666-15931688 CATGAGAGGGACCCAGTGGGAGG - Intergenic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
971729638 4:30361050-30361072 CAGCAGTAGGAGGCTGTGGTGGG + Intergenic
972603247 4:40591161-40591183 CATCAGTGGTTGCCAGGGGCTGG + Intronic
972645459 4:40963748-40963770 CATCAGTGGGACCAAGTGCATGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973598164 4:52513633-52513655 CATGAGAGGGATCCAGTGGGAGG + Intergenic
973770417 4:54201360-54201382 GATCAGTGGTTGCCAGGGGTTGG + Intronic
973966216 4:56164629-56164651 GATCAGTGGGTACCAGAGGTTGG + Intergenic
975284869 4:72605976-72605998 CATGAGAGGGACCCAGTGGGAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975866985 4:78734019-78734041 CCTAGGTGGGAGGCAGTGGTGGG - Intergenic
975932569 4:79543073-79543095 TATCAGTGGTTGCCAGGGGTTGG - Intergenic
977374742 4:96187727-96187749 AATCAGTGGTTGCCAGGGGTTGG - Intergenic
978262612 4:106779090-106779112 TATCAGTGGTTGCCAGGGGTTGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979125904 4:116971109-116971131 CATGGGAGGGAACCAGTGGTAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979783678 4:124688337-124688359 CATCAGTGGTTGCCATAGGTTGG + Intronic
980666692 4:135949006-135949028 CCTGAATGGAAGCCAGTGGTAGG - Intergenic
980704407 4:136473984-136474006 CATCAGTGGTTGCCATGGGTTGG - Intergenic
981224743 4:142280512-142280534 GATCAGTGGTGGCCAGGGGTTGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982045394 4:151440226-151440248 CATGAGAGGGACCCAGTGGGAGG - Intronic
982202393 4:152973454-152973476 CAGCTGTGGGAGGCAGTGGTGGG + Intronic
983162811 4:164438076-164438098 CATTAGTGAAAGACAGTGGTTGG - Intergenic
983164697 4:164460572-164460594 CATGAGAGGGACCCAGTGGGAGG + Intergenic
983886612 4:172987425-172987447 CATGGGAGGGACCCAGTGGTAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985436520 4:189935466-189935488 CATCATAGGGAGCCAGGTGTGGG - Intergenic
985502309 5:256400-256422 CATCAGTAGGAGCGAATGGCTGG - Exonic
985734714 5:1572215-1572237 CATCAGTAGGAGCGAATGGCTGG + Intergenic
986088259 5:4475404-4475426 GATCACTGGGAGCCATTGGAGGG + Intergenic
986181693 5:5399041-5399063 CAACTCTGGGAGGCAGTGGTTGG - Intergenic
986583333 5:9288368-9288390 ACCCAGTGGCAGCCAGTGGTGGG + Intronic
987315946 5:16723926-16723948 AATCAGTGGTTGCCAGGGGTCGG + Intronic
988362531 5:30254796-30254818 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
988623520 5:32847408-32847430 CATCAATGAGAGACACTGGTGGG - Intergenic
988623731 5:32849260-32849282 CATCACTGGGAGCCATTGCAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990147264 5:52776131-52776153 GGCCAGTGGGAGCCAGTGGCAGG + Intergenic
990280929 5:54250141-54250163 CAGGAGTGGGAGCAAGAGGTGGG + Intronic
990757891 5:59096079-59096101 AATCTGTGGGAGTTAGTGGTAGG + Intronic
991068893 5:62455271-62455293 CAGCACTGGGAGGCCGTGGTGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991606845 5:68411046-68411068 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
992334463 5:75751448-75751470 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
993967337 5:94373667-94373689 CATGAGAGGGACCCAGTGGGAGG - Intronic
994081947 5:95716783-95716805 CATGAGAGGGACCCAGTGGGAGG + Intronic
994301430 5:98152744-98152766 CATCAGTGGGAAGCACTAGTGGG - Intergenic
995283316 5:110358770-110358792 CATGAGAGGGACCCAGTGGGAGG + Intronic
996699901 5:126439790-126439812 CATGGGAGGGAGCCAGTGGGAGG + Intronic
996967440 5:129322354-129322376 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
997148603 5:131466508-131466530 CATGGGAGGGAGCCAGTGGGAGG + Intronic
1000498127 5:162011561-162011583 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1000691031 5:164320955-164320977 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1000758213 5:165186923-165186945 GATCAGTGGCTGCCAGGGGTTGG + Intergenic
1001946809 5:175785945-175785967 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002084542 5:176764458-176764480 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1002439630 5:179257560-179257582 CATCAGCGGGAGCCAGCAGCGGG - Intronic
1002654855 5:180737835-180737857 CTTCTGTGGAAGGCAGTGGTGGG - Intergenic
1002654862 5:180737900-180737922 CTTCTGTGGAAGGCAGTGGTGGG - Intergenic
1003686040 6:8303096-8303118 CATCTGTGGGAGTCTGTGATGGG + Intergenic
1004626158 6:17379286-17379308 CATCAGTGGGTGCCTGGGGATGG + Intergenic
1004762282 6:18680817-18680839 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1005318284 6:24626165-24626187 AATCAGTGGCTGCCAGTGGTGGG + Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1006992550 6:38227934-38227956 GATCAGTGGTTGCCAGAGGTTGG + Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007610448 6:43145486-43145508 CAAAGGTGGGAGTCAGTGGTTGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008625504 6:53311783-53311805 CATCAGTGGTTGCCAGGGGCTGG + Intronic
1009911573 6:69936706-69936728 GTTTAGTGGGAGCCAGTGTTTGG + Intronic
1010650903 6:78454825-78454847 CATGAGAGAGACCCAGTGGTAGG - Intergenic
1010819283 6:80394830-80394852 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1010864150 6:80952735-80952757 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1011003901 6:82622519-82622541 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1011441839 6:87395689-87395711 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1012946812 6:105475060-105475082 CATCAGTGGAAGCCAGATGATGG - Intergenic
1013145689 6:107389046-107389068 CATCAGTGGTTGCCAGGGGTTGG + Intronic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1014134125 6:117867746-117867768 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1014619432 6:123647437-123647459 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1015054136 6:128878900-128878922 GATCAGTGGTTGCCAGTGTTTGG + Intergenic
1015400238 6:132780343-132780365 CATAAGTGGGAGGCTGAGGTGGG - Intronic
1015757503 6:136622309-136622331 CCTCTGTGGGAACCAGTGCTGGG - Intronic
1016233810 6:141837157-141837179 GATCAGTGGTTGCCAGTGGTTGG + Intergenic
1016564330 6:145436115-145436137 GATCAGTGGCTGCCAGTGGTTGG - Intergenic
1017396213 6:154002583-154002605 GACCACTGGGAGCCAGTGGAAGG + Intergenic
1019073308 6:169367228-169367250 CATCAGTGGGAGCTAATAGCTGG - Intergenic
1019141058 6:169943543-169943565 CTTCTGTGGGAACCAGTGCTGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019548856 7:1592364-1592386 CAACAGTGGGAGTGGGTGGTGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019968688 7:4522765-4522787 CATCTGTGGGAGACCTTGGTTGG + Intergenic
1020433752 7:8140308-8140330 CATGAGGGGGAGCGAGTGGCAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022043852 7:26607216-26607238 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1022587476 7:31628228-31628250 CATCAATGGGAGGCACCGGTAGG - Intronic
1022704104 7:32787156-32787178 CAGCAGTGGGGGTCAGTGGGTGG + Intergenic
1022729277 7:33007370-33007392 CACTAATGGGAGCCAGTGGCAGG - Intergenic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1024032574 7:45476075-45476097 GATCAGTGGTTGCCAGAGGTTGG + Intergenic
1024274232 7:47664931-47664953 CAACAGAGGGAGCTCGTGGTGGG + Intergenic
1024928304 7:54641563-54641585 CACCAGTGGGAGGCATTGGAGGG - Intergenic
1024964399 7:55009387-55009409 GATCAGTGGCTGCCAGTGGTTGG - Intergenic
1025044378 7:55680610-55680632 CACTAATGGGAGCCAGTGGCAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1028099210 7:86798808-86798830 CATGGGTGGGACCCAGTGGGAGG + Intronic
1028668655 7:93375643-93375665 CATCAATGGGAGCCATTGGCTGG + Intergenic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1031164516 7:118212970-118212992 GATCAGTGGTTGCCAGTGGCTGG + Intergenic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033764070 7:144468669-144468691 CATCAGTGGTATCTAGTTGTTGG + Intronic
1033880755 7:145880544-145880566 CATAAGTGGGAGCCAAACGTTGG - Intergenic
1034347090 7:150393153-150393175 AACCAGTGGTAGCCAGGGGTTGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1037231025 8:16659137-16659159 GATCAGTGTTTGCCAGTGGTTGG + Intergenic
1037263552 8:17034974-17034996 CATGAGAGGGACCCAGTGGGAGG + Intronic
1037914821 8:22766632-22766654 GAGCTGTGGGAGCCAGTGGAGGG + Intronic
1038121292 8:24619230-24619252 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1038477984 8:27882052-27882074 GATCAGTGGTTGCCAGGGGTAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038917865 8:32046745-32046767 AATCAGTGAGTGCCAGGGGTTGG + Intronic
1038978902 8:32734571-32734593 CATTTGTGAGAGCAAGTGGTGGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041333881 8:56758146-56758168 CATGGGTGGGACCCAGTGGGAGG - Intergenic
1042188325 8:66159205-66159227 CATCAGTGGTTGCCAGAGGCAGG - Intronic
1042383155 8:68142309-68142331 AATCAGTGGATGCCAGGGGTTGG - Intronic
1042882486 8:73509495-73509517 CATCAGTGGCTGCCAGGGGTGGG + Intronic
1043494379 8:80783897-80783919 GATCAGTGGTTGCCAGGGGTTGG - Intronic
1043801054 8:84610028-84610050 CATGAGAGGGATCCAGTGGGAGG - Intronic
1044365899 8:91345193-91345215 CAACACTGGGAGTCAGAGGTTGG - Intronic
1044856349 8:96480003-96480025 GATCAGTGGCTGCCAGGGGTTGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046552254 8:115731643-115731665 CATGAGAGGGACCCAGTGGGAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047190769 8:122677335-122677357 GATCAGTGGTTGCCAGGGGTTGG + Intergenic
1047314830 8:123723171-123723193 CATCAGTGGGAGGCAGGGGGAGG + Intronic
1047684293 8:127288695-127288717 CATCACTTGAAGCCAGTGGTGGG + Intergenic
1047898884 8:129397853-129397875 CATACTTGGGAGCCAGTGGTGGG - Intergenic
1048633382 8:136268765-136268787 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
1049091449 8:140517651-140517673 CATCACTGGGAGGCCGAGGTGGG - Intergenic
1049118028 8:140707162-140707184 CATAAGTGGTTGCCAGGGGTTGG + Intronic
1049812340 8:144581147-144581169 CACCAGCGAGAACCAGTGGTGGG - Exonic
1050490903 9:6186822-6186844 CATTAGAGGGACCCAGTGGGAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050777797 9:9288766-9288788 CATGGGTGGGACCCAGTGGGAGG + Intronic
1052053833 9:23881893-23881915 CATCAGGGGGACCCAATGGGAGG - Intergenic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1056164019 9:83924551-83924573 CATCAGTAAGAGGCAGTGGGAGG + Intergenic
1056644572 9:88399614-88399636 CATTCGTGTGAGGCAGTGGTTGG - Intronic
1056733767 9:89186707-89186729 CAACAGTGTAAGGCAGTGGTAGG - Intergenic
1056886886 9:90451408-90451430 CATAAGAGGGACCCAGTGGGAGG + Intergenic
1057368547 9:94447846-94447868 GATCAGTGGTTGCCAGGGGTTGG - Intronic
1057514734 9:95711629-95711651 CATGAGTGGCAGGCAGTGGCTGG - Intergenic
1059353433 9:113682364-113682386 CATCAGTGGTAGTGAGTGGCAGG - Intergenic
1059447246 9:114346030-114346052 CATCAGAGGGGGCAAGGGGTGGG + Intronic
1060310723 9:122458673-122458695 CATGGGTGGGACCCAGTGGGAGG - Intergenic
1061655799 9:132089081-132089103 CATTATTGGGAGGCAGTGGGTGG + Intergenic
1061695743 9:132372141-132372163 CAACACTGGGAGGCAGAGGTGGG + Intergenic
1061906946 9:133703783-133703805 CACAAGTGGGAGCCAGTGTGAGG + Intronic
1061984743 9:134124003-134124025 GATCAGTGATAGCCAGGGGTTGG + Intergenic
1062097508 9:134710759-134710781 CATCTGTGGGGTGCAGTGGTGGG + Intronic
1203786724 EBV:132357-132379 CATCAAGGGGGGCCAGTGGGTGG + Intergenic
1185550147 X:976479-976501 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1185882172 X:3751211-3751233 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1186871775 X:13781047-13781069 CAGCAGTGGGAGGAAGTGGGAGG - Intronic
1186880349 X:13859250-13859272 GATCAGTGGTTGCCAGAGGTTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188466570 X:30488306-30488328 CAACAGTGGCTCCCAGTGGTAGG + Intergenic
1189269348 X:39740053-39740075 CTTCTGTGGGCCCCAGTGGTAGG - Intergenic
1189818426 X:44846834-44846856 CATCAGTGTTTGCCAGAGGTTGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189937494 X:46084828-46084850 CATCAGTGGTTGCCAGGAGTTGG - Intergenic
1190468336 X:50749854-50749876 CATCAGTGGAAGCCAGTTCAGGG - Intronic
1192304546 X:69944870-69944892 GACCAGTGCTAGCCAGTGGTTGG - Intronic
1192376001 X:70562838-70562860 CATCAGTGATTGCCAGAGGTTGG - Intronic
1192489860 X:71566588-71566610 CATGGGAGGGACCCAGTGGTAGG - Intronic
1193536276 X:82719297-82719319 GATCAGTGGTTGCCAGGGGTTGG - Intergenic
1194778070 X:97990560-97990582 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1194893135 X:99405592-99405614 CATGAGTGGGATCCTGTGGGAGG + Intergenic
1195830282 X:109050092-109050114 TACCACTGGGTGCCAGTGGTAGG + Intergenic
1196457962 X:115903257-115903279 CACCAGTGGTAGCCAGCGCTGGG - Intergenic
1198639715 X:138743357-138743379 GATCAGTGGTTGCCAGGGGTTGG + Intronic
1200076822 X:153555294-153555316 CAGGAGTGGGAGCCAGGGGTAGG - Intronic
1200120201 X:153786557-153786579 CACCAGCGGGTGCCAGGGGTTGG + Intronic
1200362601 X:155625752-155625774 AATTAGTGGTTGCCAGTGGTAGG - Intronic