ID: 961779069

View in Genome Browser
Species Human (GRCh38)
Location 3:129310964-129310986
Sequence CCCTAACAGCAGTTGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961779065_961779069 -2 Left 961779065 3:129310943-129310965 CCAGCTTGCAAGTGTGAGTAGCC No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779059_961779069 24 Left 961779059 3:129310917-129310939 CCATACCTCTGCAAGTATCACCG No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779064_961779069 -1 Left 961779064 3:129310942-129310964 CCCAGCTTGCAAGTGTGAGTAGC No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779063_961779069 0 Left 961779063 3:129310941-129310963 CCCCAGCTTGCAAGTGTGAGTAG No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779062_961779069 1 Left 961779062 3:129310940-129310962 CCCCCAGCTTGCAAGTGTGAGTA No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779058_961779069 25 Left 961779058 3:129310916-129310938 CCCATACCTCTGCAAGTATCACC No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779060_961779069 19 Left 961779060 3:129310922-129310944 CCTCTGCAAGTATCACCGCCCCC No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data
961779061_961779069 4 Left 961779061 3:129310937-129310959 CCGCCCCCAGCTTGCAAGTGTGA No data
Right 961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961779069 Original CRISPR CCCTAACAGCAGTTGCTGTG GGG Intergenic
No off target data available for this crispr