ID: 961779490

View in Genome Browser
Species Human (GRCh38)
Location 3:129313421-129313443
Sequence CCAGATCCCCAGGTGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961779490_961779500 22 Left 961779490 3:129313421-129313443 CCCAGAACCACCTGGGGATCTGG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 961779500 3:129313466-129313488 TAGCCCCAGAGATTCAGATTTGG 0: 1
1: 0
2: 6
3: 31
4: 221
961779490_961779504 30 Left 961779490 3:129313421-129313443 CCCAGAACCACCTGGGGATCTGG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 961779504 3:129313474-129313496 GAGATTCAGATTTGGACAACTGG 0: 1
1: 0
2: 3
3: 7
4: 192
961779490_961779496 -3 Left 961779490 3:129313421-129313443 CCCAGAACCACCTGGGGATCTGG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 961779496 3:129313441-129313463 TGGTCAGAAGGCTGATTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961779490 Original CRISPR CCAGATCCCCAGGTGGTTCT GGG (reversed) Intergenic
900537029 1:3183830-3183852 TTAGAACCCCAGGTGTTTCTGGG - Intronic
901004240 1:6164123-6164145 CCAGCTCCGCAGATGTTTCTTGG + Intronic
901151036 1:7101415-7101437 CCAGATCATCTGGGGGTTCTGGG + Intronic
901262778 1:7885876-7885898 CCAGAGGCCCAGGTGGTGGTGGG + Intergenic
902515077 1:16985829-16985851 CCAGCCCCCCAGGGGGTTCCAGG + Intergenic
906196520 1:43933695-43933717 CCAGATCCCGGGGTGGGGCTGGG - Exonic
906460887 1:46034583-46034605 CCAGTTCCCCAGCCGGCTCTGGG + Exonic
906475626 1:46167454-46167476 CCAGATCTCGAGGTGGGCCTGGG + Intronic
907636023 1:56135343-56135365 CCAGATCCCCAGAAGGCTCTTGG - Intergenic
911190117 1:94940150-94940172 CCAAATCCCCATGTTGTTCATGG + Intergenic
911463555 1:98221867-98221889 CCAGATCACCAGGTGATTAATGG + Intergenic
913195867 1:116455418-116455440 CCAGGTCCCCATGTGGGTTTCGG - Intergenic
915213060 1:154324387-154324409 CCAGATCCTGAGCTGGCTCTGGG - Exonic
915662479 1:157415755-157415777 TCAGATCCCCCAGTGGCTCTTGG - Intergenic
915918196 1:159953915-159953937 CCATATCCCCAGGTGTCTCTCGG + Intronic
918037630 1:180891036-180891058 CCACAATCCCCGGTGGTTCTAGG + Intergenic
918116627 1:181503452-181503474 CCATATTCTCAGGAGGTTCTGGG + Intronic
919805887 1:201380784-201380806 CCACATCCCCAGCTGATTCTGGG + Intronic
922983845 1:229850969-229850991 CCAAATCCCCAGTTGGGTCTGGG - Intergenic
1062927766 10:1329748-1329770 CCAAGCCCCCAGGTGGTTCGCGG - Intronic
1063275959 10:4568279-4568301 CCAGATCCTCAGTTGGGTCTTGG - Intergenic
1063601885 10:7489659-7489681 CCAAAACCCCAGGTGATTTTAGG - Intergenic
1067467158 10:46509750-46509772 CCAGTTCCTCAAGTGGTTCGTGG + Intergenic
1067620028 10:47874855-47874877 CCAGTTCCTCAAGTGGTTCGTGG - Intergenic
1069602377 10:69716406-69716428 CAAGATCTCCAGGTGATTCACGG - Intergenic
1069800885 10:71080802-71080824 CCACATCCTCAGGTCTTTCTGGG + Intergenic
1070770723 10:79080864-79080886 CCAGCTCCCCAGAGGGGTCTGGG + Intronic
1070788607 10:79176618-79176640 TCCTATCCCCAGGTGCTTCTGGG - Intronic
1071473307 10:86003110-86003132 ACAGATGCCCAGGAGGTTCTGGG - Intronic
1072244435 10:93529976-93529998 CCAGATCACCCTGTGGCTCTGGG - Intergenic
1073133463 10:101205747-101205769 CTACATCTCCAGGTTGTTCTGGG + Intergenic
1073535728 10:104275127-104275149 CCAGATCCCAAGATGGCTGTGGG - Intronic
1073858126 10:107701435-107701457 CCAGATCACCAGGTCTCTCTTGG + Intergenic
1074190445 10:111130695-111130717 GCACATCCCAAGGTGGCTCTTGG - Intergenic
1074422526 10:113322072-113322094 CAAGCTCCACAGGTGGTTCTGGG + Intergenic
1074863615 10:117532127-117532149 CCAGATCCCAAGTGGGCTCTGGG + Intergenic
1074977323 10:118592142-118592164 AAAGTTCCCCAGGTGATTCTAGG + Exonic
1075262104 10:120971970-120971992 CAAGCTCCCCAGGTGATTTTTGG + Intergenic
1075623006 10:123941334-123941356 CCAGCTTCCCTGGTGTTTCTCGG + Intergenic
1076751650 10:132546412-132546434 CCTGAGCCCCTGGTGGGTCTCGG + Intronic
1076903291 10:133350372-133350394 CAAGACACCCAGGTGGTCCTAGG + Intronic
1076903786 10:133352378-133352400 CCAAATCACCAGGTGCTCCTGGG + Exonic
1078823741 11:14907035-14907057 CCAGCTCCACATGTTGTTCTAGG + Intronic
1079159207 11:17976821-17976843 CAAGCTCACCAGATGGTTCTGGG - Intronic
1081723245 11:45305291-45305313 ATAGGTCCCAAGGTGGTTCTGGG + Intergenic
1081794814 11:45811901-45811923 GCAGATCCCCAGGGGCTGCTGGG + Exonic
1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG + Intronic
1083599185 11:63936047-63936069 CCAGAAGCCAGGGTGGTTCTAGG + Intergenic
1083863994 11:65443751-65443773 CCTGCGCCCCAGATGGTTCTAGG + Intergenic
1084176475 11:67424901-67424923 CCAGCTCCCCAGGTGGGAGTGGG + Exonic
1084440025 11:69167513-69167535 CCAGCTCCCCAGGTGGTCTGGGG - Intergenic
1085203033 11:74713214-74713236 CCAGATCCCCAGGCAGTGCTGGG - Intronic
1085476901 11:76794721-76794743 CCAGATTCCCAGATGGGTTTTGG - Intronic
1088689378 11:112312033-112312055 CCAGCTCCATAGTTGGTTCTAGG + Intergenic
1091633600 12:2180719-2180741 CTAGGTCCCCAGCTGATTCTGGG - Intronic
1091640870 12:2236193-2236215 CAGGATCCCCAGATGGCTCTTGG - Intronic
1092103633 12:5905218-5905240 CCAGAGCCCCAGGTGGCTCCAGG - Intronic
1093104948 12:15075087-15075109 CCAGGTTCTGAGGTGGTTCTGGG - Intergenic
1093741883 12:22698608-22698630 CCAGAGCCCAAGAGGGTTCTTGG + Intergenic
1095256411 12:40041769-40041791 CGAGAGCCCCAGTTAGTTCTGGG + Intronic
1095490509 12:42728567-42728589 CCAGATACCCACGTGGCTCATGG + Intergenic
1097032481 12:56099715-56099737 CCAGATACCGTGGTGGGTCTCGG - Exonic
1097130275 12:56806366-56806388 CAGGAGCCCCAGGTGATTCTGGG - Intergenic
1098506753 12:71261423-71261445 CTAGATCACCATTTGGTTCTGGG - Intronic
1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG + Exonic
1103864392 12:124040346-124040368 CCTGATCCCCAGGAAGTCCTAGG - Intronic
1104281119 12:127378609-127378631 CCAGAGTCCAAGGTGGTTCTGGG + Intergenic
1105843331 13:24274224-24274246 CCACATGCTCAGGTTGTTCTAGG - Intronic
1106192221 13:27463648-27463670 CCAGAGCACCACGTGGTTCTGGG - Intergenic
1107964131 13:45584560-45584582 CCAGATCCCCAGAGGATGCTTGG - Intronic
1107984170 13:45760730-45760752 CAAGATCTCCAGGTGGTTTGGGG + Intergenic
1110478448 13:75945535-75945557 GCACATCCCTAGGTGCTTCTTGG - Intergenic
1119327707 14:73771281-73771303 CCAGGGCCCCAGCTGGGTCTGGG + Intronic
1121144806 14:91574357-91574379 CCCGCTCCCCAGGCGTTTCTGGG + Intergenic
1121671907 14:95716635-95716657 CAAGACCCCCAGGTGATTCACGG + Intergenic
1122548402 14:102537490-102537512 CCAGACCCCCCTGTGGTCCTAGG - Intergenic
1122938580 14:104971073-104971095 CCAGATACCCTGGTGCTTCGAGG - Intronic
1124092075 15:26614934-26614956 TCAGATTCCCAGGTGCTTTTTGG + Intronic
1126271926 15:46829293-46829315 CCATATCCCCAGTTTGTTCCAGG - Intergenic
1127856580 15:62958556-62958578 CCTGATCCACAGGTTGCTCTGGG + Intergenic
1130252440 15:82308508-82308530 CCTGACCCCCAAGTTGTTCTGGG - Intergenic
1131831694 15:96358932-96358954 CCAGCTCCCCAGCTGGTTGAGGG + Intergenic
1132146313 15:99431955-99431977 CCAGAACCCCAGCTGGTGCGGGG + Intergenic
1132208553 15:100003249-100003271 CTAGAACCCCAGGTGGAGCTGGG - Intronic
1132387613 15:101411496-101411518 ACAGATCCCCATGTGGCTGTGGG - Intronic
1133033632 16:3023066-3023088 CCAGGTCCCCAGGGGCTCCTGGG + Intronic
1134666509 16:16022617-16022639 CAAGATCTCCAGGTGGTTCAGGG + Intronic
1135207470 16:20495070-20495092 CAGGAGCCCCAGGTGATTCTAGG + Intergenic
1135211415 16:20528562-20528584 CAGGAGCCCCAGGTGATTCTAGG - Intergenic
1136093123 16:27934915-27934937 CCAAATCCCCACATGGTGCTTGG - Intronic
1136272537 16:29157078-29157100 CTTTATCCCCAGGTGGTCCTCGG + Intergenic
1136714254 16:32264242-32264264 CCACATACCTAGGTGGTTGTGGG + Intergenic
1136753641 16:32665175-32665197 CCACATACCTAGGTGGTTGTGGG - Intergenic
1136814472 16:33205190-33205212 CCACATACCTAGGTGGTTGTGGG + Intronic
1136820948 16:33315270-33315292 CCACATACCTAGGTGGTTGTGGG + Intergenic
1136827511 16:33371809-33371831 CCACATACCTAGGTGGTTGTGGG + Intergenic
1136832577 16:33470580-33470602 CCACATACCTAGGTGGTTGTGGG + Intergenic
1137451460 16:48578286-48578308 CCAGAGCCCCTGGGGGTCCTGGG - Intronic
1137723924 16:50644559-50644581 GAATATCCCCAGGAGGTTCTGGG - Intergenic
1138029214 16:53546491-53546513 CAAGTTTCCCAGGTGCTTCTTGG + Intergenic
1138429711 16:56960929-56960951 CCGGCTCCCCACGTGCTTCTGGG + Intergenic
1139380036 16:66524777-66524799 CAAGATGCACAGGTGGTTGTGGG + Intronic
1139590294 16:67929424-67929446 CCAGTTCCCCAAGTGTCTCTGGG + Exonic
1139824300 16:69745074-69745096 CCAGAGCACAAGGTGGGTCTCGG + Intronic
1141207153 16:81941423-81941445 GCAGCTCCCCAGATGGTGCTTGG + Intronic
1202993048 16_KI270728v1_random:28164-28186 CCACATACCTAGGTGGTTGTGGG + Intergenic
1203055799 16_KI270728v1_random:925527-925549 CCACATACCTAGGTGGTTGTGGG - Intergenic
1143156617 17:4841334-4841356 TCCCATCCCCAGGTGGTTCCTGG - Intronic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1144290808 17:13824470-13824492 CCAAATCCCCATGTGGTTCAGGG - Intergenic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1146057334 17:29588098-29588120 ACAGATGCTCTGGTGGTTCTGGG - Intronic
1146915788 17:36677492-36677514 CCAGACCCCGAGAGGGTTCTTGG + Intergenic
1147438177 17:40430821-40430843 CTAGATGCCCAGGAGTTTCTGGG - Intergenic
1149607269 17:57933871-57933893 CCAGGTCCCCAGATGCTCCTGGG - Intronic
1151222610 17:72624091-72624113 CCCGCTCACCAGGTGGTTCCAGG - Intergenic
1151546188 17:74794641-74794663 CCTGAACCCCAGGTGCGTCTGGG - Intronic
1152717663 17:81907652-81907674 CCCCATCCCCAGCCGGTTCTGGG - Intronic
1152789240 17:82269834-82269856 CCAGACACCCCTGTGGTTCTGGG + Intronic
1153545187 18:6197647-6197669 CCAGGTCCCTACTTGGTTCTAGG + Intronic
1155452260 18:25975655-25975677 CCAGACCCCAAGAGGGTTCTTGG - Intergenic
1158886973 18:61837891-61837913 CCAGATCCCCAGGATCTTGTGGG - Intronic
1161296982 19:3525098-3525120 CCACACTCCCAGGTGGCTCTGGG + Intronic
1161705949 19:5821738-5821760 TCAGATCCCCAGGCTGGTCTAGG + Intergenic
1162300376 19:9841685-9841707 CCAGAACCCCTGAAGGTTCTGGG - Intronic
1162823618 19:13237792-13237814 CCCCATCCCCAGGTGGAGCTGGG - Intronic
1163305478 19:16475556-16475578 CCAGACCCCGAGAGGGTTCTTGG + Intergenic
1163494729 19:17639642-17639664 GCAGATCCCCAGTTGCTTCGAGG - Intronic
1163545275 19:17937701-17937723 CCAGGTCCACAGGTTCTTCTAGG + Intronic
1163874224 19:19853011-19853033 CCAGCTCCCAAGGTGTTTCGAGG - Intergenic
1164365808 19:27580467-27580489 CCAGATCACCTAGTGGCTCTGGG + Intergenic
1164551465 19:29216074-29216096 CCAGATCACCAGGTGTCTCTGGG - Intergenic
1165267489 19:34673413-34673435 CCAGACCCCAAGAGGGTTCTTGG + Intronic
1166919708 19:46221007-46221029 CCACAACCCCAGGTGCTGCTGGG - Intergenic
1167083954 19:47296403-47296425 CAAGACCCCCAGGTGATTCCTGG - Intronic
1167258602 19:48444795-48444817 CCAGATCTCCAGCCGGGTCTGGG + Exonic
1168583759 19:57576578-57576600 TCAGATCCCCAGGTATTTCTGGG - Intronic
925987443 2:9227680-9227702 CCAAATACTCAGCTGGTTCTGGG - Intronic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
927812447 2:26187580-26187602 ACAGGACCCGAGGTGGTTCTGGG - Exonic
929583897 2:43101557-43101579 CCAGCTCTCCTGGTGGTCCTTGG - Intergenic
929732605 2:44511712-44511734 CAAGAGCCCCAGATGGTTTTAGG - Intronic
930095331 2:47562188-47562210 GCAGATTCCCAGGTGGTTCCAGG + Intronic
931127397 2:59293201-59293223 CCAGTTCCCCAGGTGGTCTGAGG + Intergenic
932214392 2:69957592-69957614 CAAGATCCCCAAGTGATTCTAGG - Intergenic
932302700 2:70678395-70678417 CCACATCCACAGGGGGCTCTTGG - Intronic
932629366 2:73325163-73325185 CCAGAGCCCCATTTGGTCCTAGG - Intergenic
935110141 2:100085587-100085609 CTGGATCCCCAGCTGATTCTGGG + Intronic
935197097 2:100823520-100823542 CAAGGGCCCCAGGTGATTCTCGG - Intronic
935289412 2:101597049-101597071 CCAGTTCCTCAGGTTGTTGTAGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936124833 2:109779619-109779641 CTGGATCCCCAGCTGATTCTGGG - Intergenic
936219858 2:110591847-110591869 CTGGATCCCCAGCTGATTCTGGG + Intergenic
938176751 2:129140295-129140317 CCAAGTCGCCATGTGGTTCTAGG + Intergenic
940009427 2:149038655-149038677 CCCGCGCCCCAGGTGGTTCAGGG + Exonic
941342803 2:164328761-164328783 CTATATCCCCAGGTGGTTGGAGG - Intergenic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
945109063 2:206345320-206345342 CCAGATCCCGAGAGGGTTCTTGG + Intergenic
946365107 2:219244225-219244247 CAAGATTCCCAGGTGATCCTAGG + Intronic
948075554 2:235162877-235162899 CCAGGTCCCCAGGCAGGTCTGGG + Intergenic
948423476 2:237874426-237874448 CCAAGTCCCCAGGAGGGTCTGGG - Intronic
1168800221 20:639979-640001 CCAGAGCCCCAGGTGATGCTTGG - Intergenic
1168995657 20:2130948-2130970 CTAGGTCCCCAGGGGGTTCCAGG - Intronic
1171410949 20:24948738-24948760 CCGGATCCCCAGATAGTCCTTGG - Intergenic
1172875917 20:38164344-38164366 CCAGAATCCCAGCTGGCTCTTGG - Intronic
1173136168 20:40441084-40441106 CTATCTCCCCAGGTGATTCTAGG - Intergenic
1173951405 20:46996491-46996513 CAAGATCCCCAGGTGAATCCTGG + Intronic
1174081761 20:47974906-47974928 CCAGGGACCCAGGTGGCTCTTGG - Intergenic
1174134692 20:48371691-48371713 CCAGGGACCCAGGTGGCTCTTGG + Intergenic
1174532748 20:51227120-51227142 CCAGCTCTCCCAGTGGTTCTGGG + Intergenic
1174994123 20:55546244-55546266 CAAGATCAGCAGGTTGTTCTGGG - Intergenic
1175633719 20:60562698-60562720 CAAGATCCCCAGATGATTCTGGG + Intergenic
1175786611 20:61716033-61716055 CCAGAGCCCCAGCTGGCACTGGG - Intronic
1175948684 20:62570788-62570810 CCAGCTCCCCAGTGTGTTCTGGG + Intergenic
1177749233 21:25259080-25259102 TCAGCTACCCAGATGGTTCTAGG - Intergenic
1179535546 21:42049232-42049254 CAAGATCTACAGGTGGTTCTTGG - Intergenic
1179542633 21:42093581-42093603 CCACATCCACAGCTGGCTCTGGG - Intronic
1179902109 21:44399714-44399736 GCAGAAGCCCAGGTGGCTCTGGG + Intronic
1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG + Intronic
1184087195 22:42271975-42271997 GCAGAGCCCCAGGTGGTCCTGGG + Intronic
1185398700 22:50605147-50605169 CCAGACCCTCAGGTGGCCCTGGG - Intronic
950649913 3:14401030-14401052 GCTGATCCCCAGGTGCTTCCTGG + Intergenic
950885805 3:16361838-16361860 CCAGTTAGCCAGTTGGTTCTAGG + Intronic
952210815 3:31227546-31227568 CCAGTTCCCAAGGTTCTTCTTGG - Intergenic
953169969 3:40498064-40498086 CCAGATCCCTGGGTGCTGCTTGG + Intergenic
954692729 3:52404278-52404300 CCAGGTCCCCAGGAAGTTTTTGG - Intronic
956486804 3:69731700-69731722 CCAGATCCCCAAGTTGGTTTTGG - Intergenic
957745013 3:84329251-84329273 CTAGATCCTCCTGTGGTTCTGGG - Intergenic
957824079 3:85417840-85417862 CAAGATCCCTAGGTTATTCTTGG - Intronic
960583915 3:119303444-119303466 CCAGAAACTCAGTTGGTTCTGGG - Intronic
960745478 3:120883183-120883205 CAAGAACCCAAGGTAGTTCTGGG - Intergenic
961506827 3:127375606-127375628 CAAGTTCCCCAGGTGATTCTCGG + Intergenic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962482737 3:135811578-135811600 CCAGATCTCCAGGTGGATCCAGG - Intergenic
963801708 3:149682915-149682937 CCAGAGCCACAGGAGGTTCAAGG - Intronic
964868599 3:161289026-161289048 CCAGAGGCTCAGGTGGTTCCAGG + Intergenic
966687257 3:182709535-182709557 GCCCAGCCCCAGGTGGTTCTAGG + Intergenic
966971434 3:185048902-185048924 GCAGATGCCCAGGAGGGTCTAGG - Intronic
967976197 3:195035963-195035985 CCAGCTCCACATCTGGTTCTCGG + Intergenic
968837722 4:2977684-2977706 CGAGATCCACAGGAGGATCTTGG - Intronic
968890822 4:3367560-3367582 CCACATCCCCAGAAGATTCTGGG - Intronic
970917178 4:21349678-21349700 CCAGAGCCCTGGGTGTTTCTGGG + Intronic
970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG + Intergenic
973152697 4:46908225-46908247 ACAGATCTCAAAGTGGTTCTAGG - Intronic
975465360 4:74703240-74703262 ACAGATCCTCAGGTGATTTTTGG - Intergenic
979160930 4:117460082-117460104 CCTCATCCCTATGTGGTTCTGGG - Intergenic
980131453 4:128819905-128819927 CCAGTTCCCCAGGTGGGTGGAGG - Intronic
982110052 4:152045713-152045735 CCAGCTCCCCACGTGGATTTGGG - Intergenic
983589280 4:169389824-169389846 CCAAATCCCCAAGTTGTTCAAGG - Intergenic
986030453 5:3888578-3888600 GCAGGTCCCCAGGTGCTCCTTGG + Intergenic
990470571 5:56111547-56111569 CCTGATCACCAGGCTGTTCTTGG + Exonic
991550116 5:67826362-67826384 CCAGCTACCCAGGTGGTGCCTGG + Intergenic
992159720 5:73989484-73989506 CCAGACCCCCAGAGTGTTCTTGG + Intergenic
992549295 5:77845988-77846010 CCAGCTCCCCAGGTGCCTGTGGG - Intronic
995372569 5:111435575-111435597 CAAGATCCCCAGGTTCTGCTTGG + Intronic
995730051 5:115229257-115229279 CCAGATACCCAGGTCCTGCTTGG + Intronic
996688584 5:126312002-126312024 CCAAAGACCCAGATGGTTCTGGG - Intergenic
996838985 5:127825583-127825605 CCACACCCCTAGGTGCTTCTGGG + Intergenic
996959756 5:129233318-129233340 CCAGATCACCAGTTGTTTTTGGG - Intergenic
997840353 5:137234086-137234108 CCAGCTGCCCAGGTGTCTCTGGG + Intronic
997998316 5:138604260-138604282 CCAGATCCAAAGGCTGTTCTTGG + Intergenic
998957334 5:147452066-147452088 CCAGCTTCCCAGCTGGTGCTGGG - Intronic
999206465 5:149851807-149851829 CCCCATCCCATGGTGGTTCTGGG - Exonic
999716748 5:154367300-154367322 CCAGTTTCCCTGGGGGTTCTTGG + Intronic
1001768467 5:174273867-174273889 CATGATCTCCAGGTGGCTCTTGG + Intergenic
1002400675 5:178990196-178990218 CCAGATCCACAGGTAGGACTGGG + Intronic
1002763831 6:222762-222784 CCACATCCGCATGTGGGTCTGGG + Intergenic
1003006606 6:2388718-2388740 CCAGCTCCCCAGGAGTTGCTTGG + Intergenic
1003245783 6:4380948-4380970 CCAGATCCCCATGTTGTACTGGG - Intergenic
1006276797 6:33010582-33010604 CATGCTCCCCAGGTGGTTCTCGG + Intergenic
1007432687 6:41785912-41785934 CCAGACCCCCAGGTCGCACTGGG + Intronic
1007662665 6:43496273-43496295 CCACATACCCAGGTGGGTTTAGG + Intronic
1010652154 6:78467851-78467873 CCAGATCTCCAGCTGCTGCTGGG - Intergenic
1010760470 6:79716687-79716709 CAAGATCCCCAGGTGATTCAGGG + Intergenic
1014105674 6:117558104-117558126 CCAGATCTCCCCATGGTTCTAGG + Intronic
1019657305 7:2202701-2202723 CCAGACGCCCTGGTGGTGCTTGG - Intronic
1020748747 7:12112119-12112141 CCAGAGCCCTAGCAGGTTCTAGG + Intergenic
1026280865 7:68920649-68920671 CCAGAGCCCATGGTGGTGCTAGG - Intergenic
1026904480 7:74055038-74055060 CCACATCCCCAGGCAGTTTTGGG - Intronic
1029544031 7:101201037-101201059 CCAGAGCCCCAGATGTCTCTGGG + Intergenic
1030625548 7:111842216-111842238 TCAGGTCCCAAGGAGGTTCTTGG - Intronic
1031783444 7:125998452-125998474 TCAGATGCCCAGGTAGTTATGGG + Intergenic
1031922900 7:127614471-127614493 TCAGGTCACCAGGTGGGTCTTGG - Exonic
1033419069 7:141189838-141189860 CCAGCAGCCCTGGTGGTTCTTGG - Intronic
1033657512 7:143383144-143383166 CTGGAGCCCCAGGTGGATCTGGG + Exonic
1033904450 7:146184639-146184661 ACAGTTCCCCAGGTGGATATTGG + Intronic
1039059865 8:33565090-33565112 CCAGATCCCCTGGTCTTTCTTGG - Intronic
1039195856 8:35030748-35030770 CCAGCACCCCAGATGGTTATGGG - Intergenic
1039438181 8:37575700-37575722 CCAGACCCCAAGAGGGTTCTTGG - Intergenic
1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG + Intergenic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1040750401 8:50698775-50698797 CCACATCCCAAGGTAGATCTAGG + Intronic
1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG + Intergenic
1041443408 8:57924040-57924062 CAAGATCCACAAGTGTTTCTGGG + Intergenic
1043175209 8:77016556-77016578 ACACATCTCCAGGTGGTGCTAGG + Intergenic
1045036251 8:98178592-98178614 CCATATCCAGAGGTGCTTCTTGG - Intergenic
1045295508 8:100868854-100868876 AAAGTTCCCCAGGTGATTCTAGG - Intergenic
1047431612 8:124798184-124798206 CCAGACCCCCAGGGGGCTCTGGG + Intergenic
1049615536 8:143574276-143574298 CCAGATGCCAGGGTGGTGCTGGG + Intergenic
1049716587 8:144095774-144095796 TCAGATCCCCAGGTAGGGCTGGG + Intronic
1052619846 9:30892279-30892301 CCAGATCACCAATTGATTCTTGG + Intergenic
1052995385 9:34549313-34549335 CCAGTTCCCATGGTGGTTCTGGG - Intergenic
1053432812 9:38054397-38054419 TCAGATTCCCAGGTGGATTTGGG - Intronic
1053590765 9:39512049-39512071 CCATATTCCCAGGATGTTCTAGG - Intergenic
1053848616 9:42267410-42267432 CCATATTCCCAGGATGTTCTAGG - Intergenic
1054575539 9:66853240-66853262 CCATATTCCCAGGATGTTCTAGG + Intergenic
1055595331 9:77860164-77860186 GCAGATGCCCAGGTGGTCATGGG - Intronic
1056514631 9:87338300-87338322 CCAGACCCCAAGAGGGTTCTTGG + Intergenic
1056714819 9:89020456-89020478 TCAGGTCCCCAGGTGGTTGGTGG + Intronic
1056753253 9:89366838-89366860 CCAGTCCCCTGGGTGGTTCTTGG - Intronic
1059137030 9:111817039-111817061 CAAGCTCCCCAGGTGTTGCTTGG + Intergenic
1061790348 9:133055816-133055838 CCAACTCCCCAGGAGGCTCTGGG - Intronic
1061825414 9:133255675-133255697 CCGGACCGCCTGGTGGTTCTTGG + Exonic
1061924204 9:133798045-133798067 CCTGAGTCCCAGGTGGTTCTAGG + Intronic
1062423815 9:136497004-136497026 CCCGATGCCCAGGTGGGTGTCGG + Exonic
1185620750 X:1451310-1451332 CCCCATCCCTAGGTGGTCCTGGG + Intronic
1187971992 X:24668133-24668155 CCAGGTCCCATGCTGGTTCTAGG - Intronic
1189167911 X:38879739-38879761 CCTGATTCCAGGGTGGTTCTTGG + Intergenic
1189272190 X:39759542-39759564 CGCCATCCTCAGGTGGTTCTTGG - Intergenic
1191727183 X:64293588-64293610 CCAGATCCCTATGTGGGTGTGGG - Intronic
1194368557 X:93040068-93040090 CCAGATCCCGAGATGGTTCTTGG + Intergenic
1195750939 X:108161664-108161686 CAAGAGCCCCAGGTGGGCCTGGG + Exonic
1197555876 X:127952492-127952514 CCAGGTCTTAAGGTGGTTCTAGG + Intergenic
1197714527 X:129696913-129696935 TGCGATCCCCAGGTGCTTCTTGG - Intergenic
1197729621 X:129798605-129798627 CCAGGTCCCCAGGAGGTGTTGGG + Intergenic
1200326383 X:155244819-155244841 CCAGATCCCAAAGTGATTCTGGG + Intergenic
1200676758 Y:6156322-6156344 CCAGATCCCGAGATGGTTCTTGG + Intergenic