ID: 961779895

View in Genome Browser
Species Human (GRCh38)
Location 3:129315324-129315346
Sequence CCCGGCGGCCGCCGTCTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961779887_961779895 -1 Left 961779887 3:129315302-129315324 CCGCCTTCTTCACCTTCTTGCCC 0: 1
1: 0
2: 5
3: 121
4: 1113
Right 961779895 3:129315324-129315346 CCCGGCGGCCGCCGTCTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
961779888_961779895 -4 Left 961779888 3:129315305-129315327 CCTTCTTCACCTTCTTGCCCCCG 0: 1
1: 0
2: 3
3: 19
4: 327
Right 961779895 3:129315324-129315346 CCCGGCGGCCGCCGTCTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
961779882_961779895 30 Left 961779882 3:129315271-129315293 CCCTTGGGCACTTTGGGGACGCT 0: 1
1: 0
2: 1
3: 3
4: 94
Right 961779895 3:129315324-129315346 CCCGGCGGCCGCCGTCTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
961779883_961779895 29 Left 961779883 3:129315272-129315294 CCTTGGGCACTTTGGGGACGCTG 0: 1
1: 1
2: 0
3: 11
4: 179
Right 961779895 3:129315324-129315346 CCCGGCGGCCGCCGTCTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961779895 Original CRISPR CCCGGCGGCCGCCGTCTTCT TGG Exonic