ID: 961783848

View in Genome Browser
Species Human (GRCh38)
Location 3:129337655-129337677
Sequence ATGCTCTTCTTGAGGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961783848_961783857 18 Left 961783848 3:129337655-129337677 CCCTTTAGCCTCAAGAAGAGCAT No data
Right 961783857 3:129337696-129337718 CTGAAACCTAAACCACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961783848 Original CRISPR ATGCTCTTCTTGAGGCTAAA GGG (reversed) Intergenic
No off target data available for this crispr