ID: 961786609

View in Genome Browser
Species Human (GRCh38)
Location 3:129351102-129351124
Sequence CAGAGGAAACAGCATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961786609_961786611 2 Left 961786609 3:129351102-129351124 CCTTGCTCATGCTGTTTCCTCTG No data
Right 961786611 3:129351127-129351149 TAGAATGTCCTTTCACATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961786609 Original CRISPR CAGAGGAAACAGCATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr