ID: 961787634

View in Genome Browser
Species Human (GRCh38)
Location 3:129357231-129357253
Sequence CCTGCTTTGCTGGGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961787627_961787634 3 Left 961787627 3:129357205-129357227 CCAGGGCTGTCGGGAGCGCACAG No data
Right 961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG No data
961787624_961787634 14 Left 961787624 3:129357194-129357216 CCTTGGCTGAGCCAGGGCTGTCG No data
Right 961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961787634 Original CRISPR CCTGCTTTGCTGGGGGAGAA AGG Intergenic
No off target data available for this crispr