ID: 961787753

View in Genome Browser
Species Human (GRCh38)
Location 3:129357848-129357870
Sequence CCTCGGAAGGCTCTGAGATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961787749_961787753 0 Left 961787749 3:129357825-129357847 CCGAGGAGACTCTTCAGTGCTGA No data
Right 961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG No data
961787745_961787753 28 Left 961787745 3:129357797-129357819 CCTTACCTGGAGGGTGATGGCCT No data
Right 961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG No data
961787748_961787753 8 Left 961787748 3:129357817-129357839 CCTCACAGCCGAGGAGACTCTTC No data
Right 961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG No data
961787746_961787753 23 Left 961787746 3:129357802-129357824 CCTGGAGGGTGATGGCCTCACAG No data
Right 961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961787753 Original CRISPR CCTCGGAAGGCTCTGAGATA CGG Intergenic
No off target data available for this crispr