ID: 961794598

View in Genome Browser
Species Human (GRCh38)
Location 3:129400756-129400778
Sequence GAATAGCCACAGATGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961794598_961794604 26 Left 961794598 3:129400756-129400778 CCCTGCTGCATCTGTGGCTATTC 0: 1
1: 0
2: 0
3: 11
4: 189
Right 961794604 3:129400805-129400827 GCAGGCTGTATGTAGTGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 174
961794598_961794605 27 Left 961794598 3:129400756-129400778 CCCTGCTGCATCTGTGGCTATTC 0: 1
1: 0
2: 0
3: 11
4: 189
Right 961794605 3:129400806-129400828 CAGGCTGTATGTAGTGAGATGGG 0: 1
1: 0
2: 1
3: 11
4: 157
961794598_961794602 8 Left 961794598 3:129400756-129400778 CCCTGCTGCATCTGTGGCTATTC 0: 1
1: 0
2: 0
3: 11
4: 189
Right 961794602 3:129400787-129400809 ATGAATCTTGCTTATCCTGCAGG 0: 1
1: 0
2: 1
3: 4
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961794598 Original CRISPR GAATAGCCACAGATGCAGCA GGG (reversed) Intergenic
901485552 1:9558288-9558310 CAATAGCCACGGAGGCAGAAGGG - Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
902470046 1:16642936-16642958 GGCCAGCCACAGGTGCAGCAAGG + Intergenic
902541622 1:17159582-17159604 GAACACCCACAGAGGCAGAATGG + Intergenic
903378877 1:22883460-22883482 AAACAGCCACAGAGGCTGCAAGG + Intronic
904097624 1:27993487-27993509 GAACACCCACAGATGAACCATGG + Exonic
904307157 1:29597531-29597553 GATTATCCACAGATCCAGTATGG - Intergenic
905878527 1:41448746-41448768 GCACAGCCTCAGAAGCAGCAAGG + Intergenic
907634972 1:56125188-56125210 GAATAGGCCCACATGGAGCAAGG + Intergenic
909481188 1:76130269-76130291 GAATTGGCAAAGATGTAGCAAGG + Intronic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
916078876 1:161219627-161219649 GAAAAGCCAAATATGCAGAACGG + Intronic
916755055 1:167761465-167761487 GAATGGGCACAGATGCAGGGAGG + Intronic
919530046 1:198705750-198705772 GAGTGGCCACAGAGGCAGGAAGG - Intronic
921246834 1:213252223-213252245 AATTAGCAACAGATGCTGCAGGG + Intronic
921711661 1:218378924-218378946 TAATAGCCACAGACCCAGCGAGG - Intronic
922621848 1:226994724-226994746 GATTGGCCTCAGCTGCAGCAGGG - Intronic
923009541 1:230077192-230077214 GGAAAGCCCCAGAGGCAGCAAGG - Intronic
923092585 1:230751351-230751373 GAAAAGCCACATTTCCAGCAAGG - Intronic
1065468000 10:26045856-26045878 GGATAGGCACAAATGAAGCATGG - Intronic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067808543 10:49409698-49409720 GAAGAGCCAGGGATGCAGGAGGG - Intergenic
1070953652 10:80450562-80450584 GAATACCCACAAAGCCAGCATGG - Intergenic
1074183341 10:111081830-111081852 GAATAGCCACTTATGGAGGAGGG + Intergenic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078655683 11:13236649-13236671 GAGGAGCCACAGAGGCAGCATGG + Intergenic
1079171375 11:18099142-18099164 GAATAGCCACTGCTCCAGTATGG - Intronic
1079898308 11:26149599-26149621 GACAAGCCCCAGATGAAGCAGGG + Intergenic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1085054246 11:73394738-73394760 AGATGGGCACAGATGCAGCAGGG + Intronic
1085768789 11:79307198-79307220 GAATTGCCCCAGATGCAGAGTGG + Intronic
1087166479 11:95009533-95009555 CATGAGCCCCAGATGCAGCAAGG + Intergenic
1089270621 11:117299462-117299484 GCACAGCCACAGAGGCACCACGG - Intronic
1090261050 11:125320465-125320487 GAGGAGCCAGAGATGCAGAAAGG + Intronic
1091463520 12:664043-664065 GATTAGCCATAGAGGGAGCAGGG + Intergenic
1093148715 12:15597383-15597405 CAATAGCCACAGTTGCCACAGGG - Exonic
1094598243 12:31884850-31884872 GAAGACCCCCAGATGCAGAAAGG + Intergenic
1094809026 12:34120005-34120027 GATTAGGAACATATGCAGCATGG + Intergenic
1095511732 12:42958412-42958434 GCATACACACAGAGGCAGCAAGG - Intergenic
1095600578 12:44008643-44008665 GAAAAGCCACAGAAGAAGGAAGG - Intronic
1095837901 12:46658414-46658436 GAATAGCTAAAAAAGCAGCAAGG - Intergenic
1102552470 12:113701860-113701882 GCACAGCCACAGAGGCAGGAGGG - Intergenic
1104038694 12:125115649-125115671 GACTCCCCACAGATGCAGGAGGG + Intronic
1105787034 13:23759775-23759797 GAAAACCCACAGGAGCAGCAGGG + Intronic
1106405099 13:29466353-29466375 GCATAGACACAGAAGAAGCAAGG - Intronic
1107322117 13:39201020-39201042 GGTTAGCCACAGAGGCAGCCAGG + Intergenic
1110610314 13:77480518-77480540 GAAGAGACAAGGATGCAGCAAGG - Intergenic
1113161660 13:107388718-107388740 GCATAGCCACAGCTTCATCACGG + Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1114826482 14:26086866-26086888 GAGCAGCCACAGTTGCTGCAAGG - Intergenic
1117308400 14:54498460-54498482 GAATAGCCACCCATGCAGGAAGG - Intergenic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120684858 14:87526581-87526603 TAATAGCAACACATGCTGCAGGG + Intergenic
1121390018 14:93565851-93565873 GAATAGTCACCCATGCAGGATGG - Intronic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1125329311 15:38566276-38566298 TCACAGCCACAGATGCAGAAGGG + Intergenic
1127332285 15:57950907-57950929 GCAGGGCCACAGAAGCAGCATGG + Intergenic
1128041764 15:64581058-64581080 GAATAGCCACTGAACCAGCCTGG - Intronic
1128765457 15:70248446-70248468 GAACAGTCACAGAGGCAGGAAGG + Intergenic
1132765524 16:1532453-1532475 GTATATCCACAGGTGAAGCAAGG - Intronic
1133453589 16:5923409-5923431 GATTAGCCCCAGCTCCAGCAAGG + Intergenic
1137284863 16:47007101-47007123 AAATAGACACAGATGCAATAGGG + Intergenic
1140623361 16:76763252-76763274 AAAGAGCCTCAGATACAGCATGG + Intergenic
1141250349 16:82350836-82350858 CATTAGCCACAGATGCATGAGGG + Intergenic
1142389914 16:89792533-89792555 GAACAGCATCAGATGCTGCAGGG + Exonic
1142577886 17:921470-921492 GACAAGCCACAGATGCAGAGGGG - Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1151059650 17:71077304-71077326 GAATGGGCACAGATGCAGAAAGG - Intergenic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151663991 17:75535124-75535146 GAGTTGGCACAGATGCCGCAGGG + Intronic
1151712107 17:75812899-75812921 GGACAGCCCCAGGTGCAGCAAGG - Intronic
1153833133 18:8940675-8940697 GAATTTCCACAGAAGCAGGAAGG + Intergenic
1155275956 18:24187761-24187783 GAGAAGCTACAGAAGCAGCATGG + Intronic
1155816882 18:30323362-30323384 AAGTAGCTACAGATGCAGCTAGG - Intergenic
1157046592 18:44107526-44107548 GGATGGCCACAGATGCAGGGAGG + Intergenic
1159192694 18:65068097-65068119 GAATAGCCAGAGATGCACTGAGG + Intergenic
1160534221 18:79583836-79583858 GGATACCCACAGATGCACCGTGG + Intergenic
1161041049 19:2110968-2110990 TAATGACCACAGAGGCAGCAGGG + Intronic
1161662524 19:5555731-5555753 CAAAAGCCACAGAAGCTGCAGGG - Intergenic
1164437536 19:28244368-28244390 GAAAAGCCTAAGATGAAGCAAGG - Intergenic
1166632479 19:44419228-44419250 AAATAGCCTCAGGTGCAGCCTGG - Intronic
1167413341 19:49357544-49357566 GAGTAGCCACAGAGAGAGCATGG - Intronic
1167815498 19:51877129-51877151 GGATGGACACAGATGCAGAAAGG + Intronic
1168225842 19:54994477-54994499 CACTAGCCACAGATTCAGTAAGG - Intronic
925431061 2:3793734-3793756 GTTCAGACACAGATGCAGCAAGG + Intronic
926556946 2:14369265-14369287 GAATAGAGACAACTGCAGCAGGG + Intergenic
928410131 2:31048306-31048328 CAAAAGCCACAGAGCCAGCAGGG - Intronic
929420278 2:41783348-41783370 GAACACCCACAGATACAGGATGG - Intergenic
931643165 2:64399207-64399229 GAATGGCTACCGGTGCAGCAGGG + Intergenic
932413198 2:71559221-71559243 GTGTAGCCCCAGACGCAGCACGG - Intronic
934506184 2:94896605-94896627 GAAAAGCCACAGAAGAGGCAGGG + Intergenic
935271241 2:101436050-101436072 GGGTGCCCACAGATGCAGCAGGG - Intronic
938251015 2:129815713-129815735 GATAAGCCACAGAGACAGCAGGG + Intergenic
943771957 2:191727651-191727673 GAAAAACCACAGAGGCAGGAAGG + Intergenic
946935009 2:224710862-224710884 GGATAGAGACAGATGCAGGAAGG + Intergenic
948217206 2:236240583-236240605 AGAAAGCCCCAGATGCAGCATGG + Intronic
948292578 2:236837017-236837039 TGATGGCTACAGATGCAGCATGG + Intergenic
948904926 2:240975221-240975243 GAATAGATGCAGAGGCAGCAGGG + Intronic
1173730548 20:45325462-45325484 TAATGGCCACTGGTGCAGCAAGG + Exonic
1174379884 20:50149635-50149657 GAATGGTGACAGGTGCAGCAGGG - Intronic
1181681792 22:24500437-24500459 GAAGAGCCAGAGATGCAGGCTGG - Intronic
1181944096 22:26502064-26502086 GAATACAGTCAGATGCAGCAAGG + Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953550396 3:43898118-43898140 GAATAGCCACAGCTGCCACCAGG + Intergenic
954299387 3:49691317-49691339 GGCCAGCCACAGGTGCAGCAAGG - Intronic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
956819545 3:72941232-72941254 GAATAGAGACACATGTAGCAGGG - Intronic
957521759 3:81327508-81327530 GCATAGCAACAGAAGCAGCATGG + Intergenic
957946481 3:87069613-87069635 GAATAGTCAGAGATGTAGCAAGG + Intergenic
959761294 3:109968856-109968878 GTACAGCTACATATGCAGCAAGG + Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
962739527 3:138352877-138352899 GAGAAGTCACAGATGCAGCCTGG - Intronic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
963743241 3:149099924-149099946 GAGTAGCCACTCCTGCAGCATGG + Intergenic
964327489 3:155563037-155563059 GAATAGCCAGAAATGCCACAGGG - Intronic
964420446 3:156496792-156496814 GAAGAGCCTCAGAAACAGCAAGG + Intronic
965468410 3:169060701-169060723 GAATAATAACAGAAGCAGCATGG + Intergenic
967135981 3:186512970-186512992 GAATGGCCAAAGATCCAGCTGGG - Intergenic
967946287 3:194806794-194806816 GAATAGCCACAGAAGAGTCAAGG + Intergenic
971017232 4:22500904-22500926 GAATAAACAAAGAGGCAGCAGGG + Intronic
975724302 4:77277149-77277171 GAAGAGCCACAGAACCAACAAGG - Intronic
975767096 4:77680488-77680510 GAAAAGCCACAGAAGTAGAAGGG - Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
985304371 4:188522351-188522373 GAAGAGCCACAGAGCCAGGAGGG + Intergenic
986157909 5:5195305-5195327 GCATTGGCACAGATGCACCAAGG + Intronic
989373974 5:40740519-40740541 CCATGGCCACATATGCAGCAAGG + Intronic
991188431 5:63838954-63838976 ACATAGCAAGAGATGCAGCAAGG + Intergenic
991389210 5:66124513-66124535 GAATAGTCAAAGATGAAGAAAGG + Intergenic
992803915 5:80318334-80318356 GACTACTCACAGATACAGCAGGG - Intergenic
993146176 5:84096272-84096294 GAAAAGCCACAGATGCTCAAAGG + Intronic
993744657 5:91582640-91582662 GAACAGACACGGAGGCAGCAGGG - Intergenic
997230492 5:132238903-132238925 GAAGAGCCAGAGAAGCAGGATGG + Intronic
997865118 5:137455219-137455241 GAATAGACCCAGATCCATCAAGG - Intronic
998013398 5:138713334-138713356 CAATAGCCAAATATTCAGCAAGG - Intronic
998416720 5:141951549-141951571 GAATTGGCCCTGATGCAGCAAGG + Exonic
1001291522 5:170466153-170466175 GAATAGTGACAGATGATGCATGG + Intronic
1006946141 6:37785581-37785603 GAGGGGCCGCAGATGCAGCAGGG - Intergenic
1008518755 6:52343355-52343377 CAATAGCCAAAGATGCTTCAGGG - Intergenic
1009522026 6:64695004-64695026 GATGAACCAAAGATGCAGCATGG - Intronic
1009985912 6:70780768-70780790 GAAGAGACACAGAGACAGCATGG - Intronic
1012104461 6:95137805-95137827 GAATAGCAAGAGACGAAGCAAGG - Intergenic
1017840048 6:158214468-158214490 GAATAGCCACTGCTCCAGCCTGG + Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1021685971 7:23186354-23186376 GAATTGCAACAAATGCAGAAAGG - Intronic
1021846758 7:24770458-24770480 GAATCGCCACATTTGCAGCCCGG + Intergenic
1022236500 7:28466962-28466984 GACTAGCCACAGCCACAGCAGGG + Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1022991049 7:35707540-35707562 AAAAAGCCACAGAAGCATCATGG + Intergenic
1024063119 7:45713598-45713620 GGACAGCAACAGATGCAGGATGG + Intronic
1026423794 7:70269281-70269303 GAAGAGCCAGAACTGCAGCAAGG - Intronic
1028485963 7:91357526-91357548 AATTAGCCAGAGGTGCAGCAAGG + Intergenic
1029382991 7:100225482-100225504 GAAGAGCCCCAAATGCAGCCTGG - Intronic
1029513492 7:101011367-101011389 CAATAGCCAATGATGCAGCTGGG - Intronic
1030313296 7:108089367-108089389 GTATAGTCACAGGTACAGCAGGG - Intronic
1032274191 7:130440410-130440432 AAACTGCCACAAATGCAGCAGGG + Intronic
1036289127 8:7471827-7471849 GAAAAGGAACAGATGCAACAGGG - Intronic
1036332348 8:7839700-7839722 GAAAAGGAACAGATGCAACAGGG + Intronic
1037413255 8:18619903-18619925 GAATCGCCATTGATGCAGCCAGG + Intronic
1037953461 8:23034791-23034813 GAATCACCACAGATGCATCCTGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039942471 8:42102894-42102916 GAATTGCAGCAGGTGCAGCACGG - Intergenic
1040903080 8:52437439-52437461 GAAGAACAACAGAGGCAGCAGGG + Intronic
1041309908 8:56505771-56505793 GTAAAGCCAGAGATGTAGCAAGG - Intergenic
1041378454 8:57225968-57225990 GAAGAGCTAGAGATACAGCAAGG + Intergenic
1042870013 8:73389933-73389955 GAACAGCCACATCAGCAGCATGG - Intergenic
1044040121 8:87356980-87357002 AAACAGCCCCAGATACAGCATGG + Intronic
1044482124 8:92703328-92703350 GAATATCTAAAGATGCAGGAGGG - Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1048385864 8:133912159-133912181 GAATGGCCCCAGGTGCAGGAGGG - Intergenic
1049333868 8:142071557-142071579 GAAGAGCCTCAGATTCAACAGGG + Intergenic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054154361 9:61629697-61629719 GGATAGCAGCAGATGCCGCAGGG - Intergenic
1055243036 9:74207366-74207388 GATTAGGCACAGATCCACCAAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057478088 9:95421670-95421692 GGAAAGCCACAGTTACAGCATGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058056713 9:100456119-100456141 AAAAAGCAGCAGATGCAGCATGG - Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1060518580 9:124281088-124281110 GAAAAGCGGGAGATGCAGCAGGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1062722580 9:138052061-138052083 GAGAAGCCACAGATGCAGACAGG - Intronic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1186346967 X:8703595-8703617 GAAAAGCCACAGGTGAAGAAAGG + Intronic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1187077448 X:15949035-15949057 TTATAGCCACTGATGAAGCAGGG + Intergenic
1187828519 X:23357102-23357124 GAAGAGCCCCAGAGGCAGCCTGG - Intronic
1190154202 X:47974285-47974307 GAAAAGCCACAGAAGCATGAGGG + Intronic
1196376557 X:115039700-115039722 GAGTGACCACAGAAGCAGCATGG + Intergenic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1201723607 Y:17131376-17131398 GAAGAGCCACAGAGGAAGAAGGG + Intergenic
1201755177 Y:17479438-17479460 GATTAGGAACATATGCAGCATGG + Intergenic
1201846375 Y:18426547-18426569 GATTAGGAACATATGCAGCATGG - Intergenic