ID: 961794892

View in Genome Browser
Species Human (GRCh38)
Location 3:129402424-129402446
Sequence TGCACTCCTGGCACAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961794892_961794894 -4 Left 961794892 3:129402424-129402446 CCAGCTGTTGTGCCAGGAGTGCA 0: 1
1: 0
2: 1
3: 20
4: 195
Right 961794894 3:129402443-129402465 TGCAGAGTCCCAGTTGTCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961794892 Original CRISPR TGCACTCCTGGCACAACAGC TGG (reversed) Intronic
900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG + Exonic
900480705 1:2897703-2897725 TCCACTGGTGACACAACAGCAGG - Intergenic
901242079 1:7701268-7701290 TGAGTGCCTGGCACAACAGCAGG + Intronic
901245592 1:7728116-7728138 TGCACTCATGGCATAGCAACAGG + Intronic
903098285 1:21001886-21001908 TGCACTCCAGGCAAAAAGGCAGG + Intronic
903368717 1:22820625-22820647 TGCACTCCATGCACTCCAGCCGG + Intronic
903426337 1:23257069-23257091 TGCAATCCTGGCACCTCAGGAGG - Intergenic
904831069 1:33307108-33307130 TGCACTCCTGGCACTACCACTGG - Exonic
905172913 1:36119558-36119580 TGCATTCCTGGCTAAGCAGCTGG + Intronic
909458223 1:75874710-75874732 TGCATGCCTGGCACAACTTCTGG + Intronic
909812325 1:79945607-79945629 TGCATGCCTGGCACAACCTCTGG + Intergenic
911901017 1:103504318-103504340 TGCATGCCTGGCACAACCTCTGG + Intergenic
914428281 1:147599170-147599192 TGCACCCCCGGCGCATCAGCGGG + Intronic
914960012 1:152196963-152196985 TGCAATCCTGGCACCTCAGGAGG + Intergenic
915143877 1:153783354-153783376 CGCTCTCCTGCCACAACAGCAGG + Intergenic
915223253 1:154391846-154391868 TGGGCTCCTGTAACAACAGCAGG + Intergenic
916069166 1:161159908-161159930 TGCACTTCTCCCACCACAGCAGG - Intronic
920259227 1:204677692-204677714 TGCAGACCTGGGACAACGGCCGG + Intronic
920853804 1:209647468-209647490 TGCATTCATGGCACATCAGTAGG + Intronic
921089963 1:211832832-211832854 TACACTCTTGGCACAAAACCAGG - Intergenic
923998841 1:239528278-239528300 GGTACTCCTTGCACAACAGCAGG - Intronic
924299730 1:242625274-242625296 TGCACTCCAGGCTCGGCAGCAGG - Intergenic
924665088 1:246063369-246063391 TGGACTCCTGGAAGGACAGCAGG + Intronic
1068859974 10:61838314-61838336 TGCTTTTCTGGCACATCAGCAGG - Intergenic
1069452709 10:68529967-68529989 TACTCTCCTGGCAAAACTGCTGG - Intergenic
1070348612 10:75570074-75570096 TGCACTCATGGCCCAATAGCTGG + Intronic
1071215928 10:83401238-83401260 TGAACTCCTGGCTGAACTGCTGG - Intergenic
1073043761 10:100624152-100624174 TGCAATCCTAGCACAGCACCTGG - Intergenic
1074448798 10:113542152-113542174 TGCAGTCATAGCTCAACAGCAGG + Intergenic
1074522755 10:114239930-114239952 TGCCCTCCTGGCACAGTAGCGGG + Intronic
1074766013 10:116700612-116700634 AGAACTCCTGGCACAGCAGGAGG + Intronic
1075417765 10:122277980-122278002 TGTACTCCTGGGACAGCACCTGG + Intronic
1078219327 11:9338279-9338301 TGCACTCCAGCCTGAACAGCAGG + Intergenic
1082097103 11:48139758-48139780 TGCACTACTGGCATCACAGGTGG + Exonic
1082944148 11:58740440-58740462 TACACTCCTGGAAAAACAGAAGG - Intergenic
1083079298 11:60073673-60073695 TGCAATCCTGGCACCCCAGGAGG + Intergenic
1084374814 11:68769202-68769224 TGCAGTCCTCGTACAAAAGCAGG - Intronic
1085546239 11:77320808-77320830 TGCCCTCTTGGCACAGGAGCTGG - Intergenic
1085888875 11:80553985-80554007 TCCACTCCTGACAAAACAGGGGG - Intergenic
1086446715 11:86878519-86878541 TGCAATCCTGGCACCTCAGGAGG - Intronic
1087748941 11:101984285-101984307 TGCATTCCTGGCACAACCTCTGG + Intronic
1088144246 11:106655497-106655519 TGCATGCCTGGCACAACCTCTGG - Intergenic
1088400611 11:109419868-109419890 AGCACTCCTGGTATAACAGATGG + Intergenic
1089676877 11:120096209-120096231 TACCCTCCTGGCACAGAAGCTGG - Intergenic
1090699340 11:129279732-129279754 TGCGCTCCCGGGACAACAGCAGG - Intergenic
1090818831 11:130322345-130322367 TACTCTCGTGGCAAAACAGCTGG - Intergenic
1092247663 12:6872617-6872639 TGCACGCCTGGGAGATCAGCTGG - Exonic
1094423300 12:30295004-30295026 TGCACCACTGGCACAATAGGAGG + Intergenic
1094477116 12:30849639-30849661 TACTCTCCTGGCAAAACTGCTGG - Intergenic
1094524974 12:31225493-31225515 AGCACTCCTGTCACAGCAGCGGG + Intergenic
1095786112 12:46110292-46110314 TCCACTCCTGCCACCAGAGCTGG + Intergenic
1096177591 12:49533242-49533264 TTCACTGCTGTCAAAACAGCAGG + Intergenic
1097021982 12:56027098-56027120 GGCAGTGCTGGGACAACAGCAGG + Intronic
1099921672 12:88965736-88965758 TGAATTCCTAGCACAAAAGCTGG + Intergenic
1100849961 12:98699042-98699064 TTCATTCCTGGCACAGCAGAGGG + Intronic
1102210083 12:111120232-111120254 TGTACCCCGGGCACAACACCAGG - Intronic
1102482401 12:113232860-113232882 CTCACTCCTGGCACAGCAGGTGG + Intronic
1103568309 12:121828119-121828141 GGCCCTCCTGGCACAGAAGCAGG - Intronic
1104936425 12:132366720-132366742 TGCCCTCATGGCACAACTACAGG - Intergenic
1105646773 13:22328191-22328213 TGCACATCTGGCACAACCTCTGG + Intergenic
1105705312 13:22964608-22964630 TGCACTCCTGAGAGAGCAGCTGG - Intergenic
1105858225 13:24389623-24389645 TGCACTCCTGAGAGAGCAGCTGG - Intergenic
1106281552 13:28277984-28278006 TGGACTACTGTCACAACAGAAGG + Intronic
1106828354 13:33549866-33549888 TGCATGCCTGGCACAACCTCTGG - Intergenic
1108934782 13:55870691-55870713 TGCACACCTGGCTCAGCTGCAGG - Intergenic
1110028961 13:70580971-70580993 AACATTTCTGGCACAACAGCAGG - Intergenic
1110362429 13:74642769-74642791 TGCACTGCTGGGACCAGAGCTGG - Intergenic
1110808654 13:79788769-79788791 TGGAGTCTTGGCAGAACAGCTGG + Intergenic
1111403807 13:87775855-87775877 TGCAAGCCTGGCACAGTAGCTGG - Intergenic
1111586435 13:90289454-90289476 TGCTCTCATGGCAAAACTGCTGG - Intergenic
1112929519 13:104716362-104716384 TACTCTCCTGGCAAAACTGCTGG + Intergenic
1114311019 14:21467239-21467261 TGCACTCCTGCCTCAGCAACAGG - Intronic
1116662255 14:47725882-47725904 TGCACTCCTTTCACAACTGCTGG - Intergenic
1117586366 14:57211472-57211494 TGCATGCCTGGCACAACCTCTGG - Intronic
1121705962 14:95993902-95993924 TGCCCTACAGGCAGAACAGCAGG - Intergenic
1127269881 15:57390861-57390883 CACACTCCTGCCACCACAGCTGG - Intronic
1127569096 15:60223496-60223518 TGCATTCCTGGCTCAATGGCTGG - Intergenic
1128379854 15:67104586-67104608 GGCACTCATGGGAAAACAGCTGG - Intronic
1129846733 15:78771285-78771307 TGCTCTCCTGGAACAGCAGCTGG + Exonic
1129869165 15:78929735-78929757 TGCACTCCTGACAGAGCGGCTGG - Intronic
1130255165 15:82322606-82322628 TGCTCTCCTGGAACAGCAGCTGG - Intergenic
1130599809 15:85267400-85267422 TGCTCTCCTGGAACAGCAGCTGG + Intergenic
1131514878 15:93070746-93070768 TGCTCTCCTGTCACGCCAGCTGG - Intronic
1133008531 16:2897708-2897730 TCCCCTCCTGGCCCCACAGCAGG + Intronic
1135229702 16:20694303-20694325 TACTCTCCTGGCAAAACTGCTGG + Intronic
1135240781 16:20805909-20805931 TACTCTCCTGGCAAAACTGCTGG + Intronic
1138558623 16:57787202-57787224 TGGACTCCTGGCCCAAGAGCTGG + Intronic
1140931933 16:79635822-79635844 TCCACTCCAGGCACCTCAGCTGG - Intergenic
1144731594 17:17529249-17529271 TGCACACCTGGCAGGACAGGTGG - Intronic
1147533648 17:41303223-41303245 TGCATTCCTGGAGGAACAGCAGG - Intergenic
1150286997 17:63960286-63960308 TGGACTCGTGGCACAGCTGCTGG - Intronic
1152286767 17:79417109-79417131 TGCCATCCTGGCAGAACACCTGG - Intronic
1155519038 18:26651121-26651143 TTCTCTCTTGGCATAACAGCAGG + Intronic
1156707308 18:39898940-39898962 AGCACTCTTGTCACAACAGCAGG + Intergenic
1161038233 19:2096951-2096973 GGCACACCAGGCACAGCAGCAGG - Exonic
1163927256 19:20357513-20357535 TACACTCATGGCAAAACTGCTGG - Intergenic
1167492061 19:49798742-49798764 TGCCCACCTGGCACACCTGCTGG - Intronic
1167764691 19:51473749-51473771 TGCACTCCTCTCCTAACAGCAGG + Intergenic
925170404 2:1746691-1746713 TCCTCTCCAGGCACAACAGTGGG + Intergenic
925442550 2:3900855-3900877 TGGACCACTGGCACACCAGCGGG - Intergenic
926153460 2:10436991-10437013 AACATTCCTGGCACATCAGCAGG - Intergenic
928684703 2:33736449-33736471 TGCATACCTGGCACAACCTCTGG - Intergenic
929574081 2:43041387-43041409 TGCACTCTAAGCACCACAGCAGG - Intergenic
930650721 2:53961805-53961827 TACTCTCCTGGCAAAACTGCTGG - Intronic
930786991 2:55280859-55280881 TACTCTCCTGGCAAAACTGCTGG - Intergenic
931786149 2:65621114-65621136 TGCACTCTTGTCTCCACAGCTGG + Intergenic
932456767 2:71854365-71854387 TGAACACTGGGCACAACAGCTGG - Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
934128253 2:88920174-88920196 TGCAATCCTGGCACCTCAGGAGG - Intergenic
934548965 2:95243106-95243128 TGCAATCCTGGCACCTCAGGAGG - Intronic
942096049 2:172537428-172537450 TGCACTCCCGGCACCTCAGGAGG - Intergenic
943474171 2:188333948-188333970 TGCACTCCAGGCTCAGCTGCAGG + Intronic
945880790 2:215322834-215322856 TGTAGTACTGGCATAACAGCAGG - Intronic
1169716691 20:8627458-8627480 TGTACTCCTGGCTCAGAAGCTGG + Intronic
1170461430 20:16580377-16580399 TGCATTCCTGGGACAAAAGAGGG + Intergenic
1171045319 20:21805121-21805143 CGCACTCCAGGGACAACAACAGG - Intergenic
1171900010 20:30847678-30847700 TGCAATCCTGGCACCTCAGGAGG + Intergenic
1172357006 20:34287250-34287272 TACCCTCCTGGTACAACAGTGGG + Intronic
1172501938 20:35433836-35433858 TGCACTCCTGGAATCACAGAGGG - Exonic
1172521401 20:35568878-35568900 AGCATTCCAGGCAGAACAGCTGG - Intergenic
1173593608 20:44244555-44244577 GGCACTCCTGGTCCAACTGCTGG + Intergenic
1174773692 20:53324274-53324296 AGCACTCATGGTCCAACAGCAGG + Intronic
1175721689 20:61291409-61291431 TGACCTCCTGCCACAAGAGCAGG - Intronic
1178036653 21:28591365-28591387 TGCATGCCTGGCACAACTTCTGG + Intergenic
1178392731 21:32212590-32212612 TGCACTCTTGAAACAGCAGCTGG - Intergenic
1179215298 21:39362192-39362214 TCCACTCCTGGCCCAACTCCAGG - Intergenic
1180155431 21:45975091-45975113 TGCCCTCCGGGCACAAACGCAGG + Intergenic
1180659635 22:17454915-17454937 TACTCTCATGGCACAACTGCTGG - Intronic
1181595736 22:23913448-23913470 TCCCTTCCTGTCACAACAGCTGG + Intergenic
1181631816 22:24155666-24155688 GGCACTACTGGCACAACTCCAGG + Intronic
1181633825 22:24165185-24165207 TGAACTCCTGGCACATCGCCTGG - Intronic
1182032505 22:27170596-27170618 TGCATTCCTGGACCAACTGCTGG + Intergenic
1183595812 22:38810183-38810205 TGAACTCCTGCCACCACACCTGG - Intergenic
1184815651 22:46867308-46867330 TGCATGCCTGGCACAACCTCTGG + Intronic
949093047 3:51791-51813 TACTCTCCTGGCAAAACTGCTGG + Intergenic
949485063 3:4530272-4530294 TGCACTCCTGGCCCAGCACCTGG + Intronic
950084164 3:10245463-10245485 TGTACTCGTGGCAAAACTGCTGG + Intergenic
952752808 3:36839139-36839161 TGCAGTGTTGGCAGAACAGCTGG + Intronic
953551394 3:43906502-43906524 TGCAGCCCTGGCAAAGCAGCAGG - Intergenic
954000379 3:47552120-47552142 TGCACTCCAGCCTCAACAACAGG - Intergenic
954582967 3:51713023-51713045 TGGACCCTTGGAACAACAGCCGG + Exonic
955133149 3:56190384-56190406 TACTCTCCTGGCACCACTGCTGG - Intronic
960289183 3:115862878-115862900 TGCGCTCCTGACACTGCAGCTGG - Intronic
960520669 3:118651448-118651470 TGCACTCCTGACACAGAAGCAGG + Intergenic
961794892 3:129402424-129402446 TGCACTCCTGGCACAACAGCTGG - Intronic
962771626 3:138615783-138615805 TGCTCTTCTGGCTCAAAAGCAGG - Intronic
963040496 3:141066394-141066416 TGCACGCCTGGCAGATCAACTGG + Exonic
963502689 3:146147834-146147856 TGCACTCCAGTCACCATAGCAGG - Intronic
965203933 3:165696341-165696363 TGCTCTCCTGGTTCAACAGCTGG - Intergenic
967178787 3:186885293-186885315 TGCAATCCTGGCACCTCAGGAGG + Intergenic
968809738 4:2794451-2794473 TCCACTCCTGGCAGGACAGGAGG + Intronic
968845145 4:3036830-3036852 TGCACTCCTGGCAAAGCACCCGG - Intronic
969117911 4:4884879-4884901 TGCATGCCTGGCACAACCTCTGG + Intergenic
972235528 4:37129499-37129521 TGCACACCTGGCCCAAGAGCTGG + Intergenic
973927138 4:55749689-55749711 TGCAATGAAGGCACAACAGCAGG + Intergenic
976320499 4:83708934-83708956 TGCACTTCAGGCATAACACCAGG + Intergenic
977640416 4:99351766-99351788 TACACTCCTAGCACAACAAATGG + Intronic
978329210 4:107593973-107593995 TGCATGCCTGGCACAACCTCTGG + Intronic
978846308 4:113276927-113276949 TGCTCTTCTGGCACTACAGTGGG - Intronic
981805416 4:148709715-148709737 TGCAGTCCTGGCACCTCAGAAGG - Intergenic
982228546 4:153187587-153187609 TGCATTCTTGCCCCAACAGCTGG - Intronic
983801024 4:171929900-171929922 CTCACACCTGGCCCAACAGCCGG + Intronic
983886967 4:172990508-172990530 AGCACTGCTGGCTCAACAACAGG - Intronic
989656045 5:43746829-43746851 TGCAATCCTGGCACCTCAGGAGG + Intergenic
992263240 5:74991575-74991597 AGCTCTCCTGCCACCACAGCAGG - Intergenic
993202527 5:84834497-84834519 TACTCTCCTGGCAAAACTGCTGG + Intergenic
995416064 5:111914627-111914649 TACTCTCCTGGCAAAACTGCTGG + Intronic
996717551 5:126600250-126600272 TACTCTCCTGGCAAAACTGCTGG + Exonic
997443970 5:133927866-133927888 TGGACTCCAGGCAGGACAGCAGG + Intergenic
999563200 5:152827738-152827760 TGCACTCATGTGAGAACAGCAGG - Intergenic
1002633572 5:180596322-180596344 TGCTCTCCTGGGATAGCAGCTGG + Intergenic
1003194954 6:3906299-3906321 CGCCCTGCTGGCACACCAGCGGG + Intergenic
1003240255 6:4338878-4338900 TGCATGCCTGGCACAACCTCTGG - Intergenic
1003475577 6:6479111-6479133 TACTCTCCTGGCAAAACTGCTGG - Intergenic
1006412258 6:33881003-33881025 TGTACTCGTGGCAAAACTGCTGG + Intergenic
1008087830 6:47262953-47262975 TTTATTCTTGGCACAACAGCTGG - Intronic
1010434521 6:75813988-75814010 TGCACTCCTGGCCGCCCAGCTGG + Intronic
1011898662 6:92264041-92264063 AACACTCCTTGCACTACAGCCGG - Intergenic
1012879202 6:104764889-104764911 TGCATGCCTGGCACAACCTCTGG - Intronic
1013710725 6:112894628-112894650 TGCATGCCTGGCATAACATCTGG - Intergenic
1014110518 6:117615735-117615757 TGCTCTCATGGCAAAACTGCTGG + Intergenic
1014456403 6:121639773-121639795 TGCATGCCTGGCACAACCTCTGG - Intergenic
1014908320 6:127057877-127057899 TGCATGCCTGGCACAACCTCTGG - Intergenic
1016927814 6:149370393-149370415 AGCTCTCCTGGCAGAACAGGTGG - Intronic
1017913120 6:158812221-158812243 AGCACTCCTGGCATTTCAGCCGG + Intronic
1018891685 6:167987476-167987498 TCCTCTCCTGGCAGGACAGCGGG + Intergenic
1018970766 6:168527267-168527289 TGCTCTCCTGGCTCTACAGTGGG + Intronic
1021329637 7:19319944-19319966 TGCATGCCTGGCACAATATCTGG + Intergenic
1024619775 7:51147402-51147424 TACTCTCCTGGCAAAACTGCTGG - Intronic
1025617194 7:63130944-63130966 TGTAATCCTGGCACTACAGAAGG + Intergenic
1030651698 7:112123066-112123088 TGCCTTCCTGGCAAAATAGCAGG + Intronic
1033456209 7:141506270-141506292 TGCACTCCTCTCAAATCAGCAGG - Intergenic
1035201779 7:157272406-157272428 TGAACTCCAGGCAAATCAGCTGG - Intergenic
1035581413 8:741892-741914 TGCACTGATGCCACAACTGCAGG - Intergenic
1038622489 8:29157220-29157242 TCCACTCCTGCCACAACAGCTGG + Intronic
1038964665 8:32558468-32558490 TGCACTCAGGGCAGAGCAGCAGG - Intronic
1044979111 8:97697307-97697329 TGCTTTCCTGTTACAACAGCAGG - Intronic
1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG + Intronic
1050526652 9:6552259-6552281 TACATGCCTGGAACAACAGCTGG - Intronic
1051250164 9:15151187-15151209 TGAACATCTGGCACAATAGCAGG - Intergenic
1054988463 9:71291393-71291415 AGCACTGCTGGCAAAACAGTTGG - Intronic
1057250845 9:93500365-93500387 AGCCCTCCAGGCACAAAAGCCGG - Intronic
1057934785 9:99227907-99227929 TGCACTCCTTGTCCCACAGCTGG - Exonic
1058244310 9:102604010-102604032 TGCACTCCTGGCACCTCGGGAGG + Intergenic
1059818416 9:117944706-117944728 TGCTCTCATGGCAAAACTGCTGG - Intergenic
1061762594 9:132860758-132860780 TGCAAGCCTGGCACAGCAGGTGG + Intronic
1062561218 9:137142911-137142933 TCCAATCCTGGAACATCAGCTGG + Intronic
1185703812 X:2251617-2251639 TACTCTCCTGGCAAAACTGCTGG + Intronic
1187382965 X:18822002-18822024 TCCAGTCCTGGCCCACCAGCCGG - Intronic
1188127524 X:26388105-26388127 TGCATGCCTGGCACAACCTCTGG + Intergenic
1192739805 X:73881942-73881964 TGCAATCCTGGCACCTCAGGAGG - Intergenic
1196793587 X:119485408-119485430 TGCACTAAGGGCACAAAAGCAGG + Intergenic
1196874245 X:120143502-120143524 TACTCTCATGGCAGAACAGCTGG + Intergenic
1199221897 X:145326324-145326346 TACTCTCCTGGCAAAACTGCTGG - Intergenic
1199789029 X:151132703-151132725 TGCATGCCTGGCACAACCTCTGG + Intergenic
1199864424 X:151830001-151830023 TGCACTCCTTACTCAACTGCAGG + Intergenic
1200048062 X:153413044-153413066 TGCCCACCTGGCAGAACGGCTGG - Intergenic