ID: 961795149

View in Genome Browser
Species Human (GRCh38)
Location 3:129403761-129403783
Sequence CTCTCGAAAGGGCTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961795140_961795149 16 Left 961795140 3:129403722-129403744 CCAAAGGAGGCCATTTTCTTAGA 0: 1
1: 0
2: 2
3: 20
4: 189
Right 961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 15
4: 217
961795141_961795149 6 Left 961795141 3:129403732-129403754 CCATTTTCTTAGAGAAGACTCAG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 15
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961795149 Original CRISPR CTCTCGAAAGGGCTGGAGGC AGG Intronic
900620293 1:3583942-3583964 CCCTCGACAGCTCTGGAGGCCGG - Intronic
902283361 1:15390455-15390477 CTTTCTAAGGGGCTGGAAGCTGG - Intronic
902400145 1:16153009-16153031 CTCTGGAAAGGGTGGGAGCCTGG + Intronic
902414720 1:16231983-16232005 CTCGACATAGGGCTGGAGGCTGG - Exonic
903070852 1:20726418-20726440 CTCTCGATAGGGCTGTAGGTGGG + Intronic
903142132 1:21345216-21345238 CTCTCGGAAGGCGTGGAGTCGGG - Intronic
903766053 1:25735035-25735057 TTGAAGAAAGGGCTGGAGGCTGG + Intronic
906065202 1:42975542-42975564 CACTGGAAAGGGGTGGAGCCAGG - Intergenic
906749418 1:48245608-48245630 CTCTCCAAAGGCCTGCAGGTAGG + Intronic
910245345 1:85132729-85132751 TTCTGGAAAGGGCTGGATGGAGG - Intronic
915355613 1:155253922-155253944 CTCTGGACAGGGCCGGAGGAGGG + Exonic
916172648 1:162012228-162012250 GTCTCGACAGGGGTGGAGGGTGG + Intronic
917027925 1:170662570-170662592 CTCTCGCAAGGACTAAAGGCAGG - Intergenic
919763015 1:201110258-201110280 GTCTCGAAGGGCCTGGAGCCAGG + Exonic
920215437 1:204359101-204359123 CTCTTGAAGGAGCTGGAGCCTGG - Intronic
921055734 1:211541244-211541266 CTCAGGCAGGGGCTGGAGGCAGG - Intergenic
922344347 1:224683988-224684010 CTCTGGAAAGGACAGGTGGCTGG - Intronic
922667136 1:227480277-227480299 CTCTGGAAAGTGATGGTGGCAGG + Intergenic
922792270 1:228317037-228317059 CACTCGCAAGCTCTGGAGGCGGG - Intronic
922905109 1:229168383-229168405 CTCTCGGCAGGGCTGGAGAGTGG + Intergenic
923016858 1:230133481-230133503 CTGTCGACCAGGCTGGAGGCTGG + Intronic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1065516936 10:26533087-26533109 CACTGGCAAGAGCTGGAGGCTGG - Intronic
1071794443 10:88990392-88990414 CTTTAGAAAGGGCAGGAGGCCGG + Intronic
1072265840 10:93727108-93727130 CTCTTGAAAGTGCTGGAGTGTGG - Intergenic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1074549159 10:114427140-114427162 ATCCCGAAGGGGCTGGAGGCAGG - Intergenic
1076536151 10:131179022-131179044 CTGTCAGAGGGGCTGGAGGCTGG - Intronic
1076695501 10:132245493-132245515 CTCTGGACGGGGCTGGAGACAGG + Intronic
1077340635 11:2024842-2024864 CTCTGGAAAGGGCTGCAGAGGGG + Intergenic
1077369468 11:2174700-2174722 CTCTGGAGAGGGCCAGAGGCAGG - Intergenic
1077603559 11:3591482-3591504 CTCTCGAAAGGGGAGGCGGTGGG - Intergenic
1078086173 11:8234161-8234183 CTCTAGCAGGGGGTGGAGGCAGG + Intronic
1079228864 11:18632114-18632136 CTGTCGTCCGGGCTGGAGGCTGG - Intronic
1081031398 11:38088718-38088740 CTGTCGCAGAGGCTGGAGGCTGG - Intergenic
1082790053 11:57340883-57340905 CTCTGCAAAGGGAAGGAGGCTGG + Intronic
1083809631 11:65096377-65096399 CTCTCGGAAGGGGAGGCGGCGGG + Exonic
1084371529 11:68748096-68748118 CTCCCCAAAGGCCAGGAGGCAGG + Intronic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085262895 11:75218468-75218490 CTCTCTAAAGGCCTGGGGTCTGG - Intergenic
1085267418 11:75245488-75245510 TTCTGCAAAGGTCTGGAGGCAGG + Intergenic
1085399003 11:76224413-76224435 CACTGGTAAGAGCTGGAGGCTGG + Intergenic
1086915789 11:92528679-92528701 CCCTCAAAAGAACTGGAGGCCGG - Intronic
1088358341 11:108966402-108966424 GCCTCTAAAGGGCTGGAAGCAGG - Intergenic
1089486860 11:118853281-118853303 GTCTCGAAAGGGGAGGAGGCCGG - Intergenic
1202823620 11_KI270721v1_random:80031-80053 CTCTGGAAAGGGCTGCAGAGGGG + Intergenic
1091882329 12:3990050-3990072 CCCTGGAGAGGGCTGAAGGCAGG - Intergenic
1092430770 12:8407042-8407064 CTCTCGAAAGGGGAGGCGGTGGG - Intergenic
1094117901 12:26937848-26937870 CTCTGGAAAAGGCTGCTGGCTGG + Exonic
1094208985 12:27870589-27870611 CTCTCTGAAGTGCTGGAGCCCGG - Intergenic
1096796638 12:54082048-54082070 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1096867048 12:54570800-54570822 CTCTTGACAGGGCTCGGGGCGGG + Intronic
1097285525 12:57874142-57874164 CCCTCCAAATGGCAGGAGGCTGG + Intergenic
1103995436 12:124826944-124826966 CTCAGGAGAGGGCTGGGGGCTGG + Intronic
1104963844 12:132500409-132500431 CTCAGGCAAGGGCTGGAGGCTGG + Intronic
1105773767 13:23637881-23637903 CTTTCACAGGGGCTGGAGGCCGG + Intronic
1108992921 13:56686023-56686045 CTCTCTAAAGGACTTCAGGCTGG + Intergenic
1111886541 13:94028705-94028727 GTCTCTAGAGGGCAGGAGGCAGG + Intronic
1119519528 14:75275936-75275958 CTATTGACTGGGCTGGAGGCTGG - Intergenic
1119635804 14:76272292-76272314 TTCTCTACAGTGCTGGAGGCTGG + Intergenic
1121220961 14:92285090-92285112 CTCTTGACAGGGTTGGAGGGGGG + Intergenic
1121277717 14:92679188-92679210 CTGACAAAAGGGCTGGATGCAGG - Intronic
1121795868 14:96734963-96734985 CTCTGGAAAGGTCTGCATGCTGG - Intergenic
1121836967 14:97101144-97101166 CTCTCCTAAGGCCAGGAGGCAGG + Intergenic
1123403955 15:20009674-20009696 GGGTAGAAAGGGCTGGAGGCAGG + Intergenic
1123513295 15:21016320-21016342 GGGTAGAAAGGGCTGGAGGCAGG + Intergenic
1130136395 15:81185072-81185094 CTCTGCATAGGGCTGGAGGGTGG + Intronic
1132546031 16:533853-533875 CTGCAGAGAGGGCTGGAGGCGGG + Intronic
1135771424 16:25221142-25221164 ATCTCTGAAGGGCTGGAGGGAGG + Intronic
1136023803 16:27456971-27456993 ATGTCCACAGGGCTGGAGGCTGG - Intergenic
1136775510 16:32869740-32869762 CTCTGGGAGGGGCTGGAAGCAGG - Intergenic
1136895107 16:33991772-33991794 CTCTGGGAGGGGCTGGAAGCAGG + Intergenic
1137430774 16:48416703-48416725 CTCCCAAAAGGGGTGGCGGCCGG + Intronic
1138524319 16:57593127-57593149 CTCTGGCAGGGGGTGGAGGCAGG + Intergenic
1139477818 16:67211477-67211499 CTCTAGAAAGTGGGGGAGGCTGG - Intronic
1140623878 16:76769372-76769394 CTCTGGAAAGGTGTGGAGGTTGG + Intergenic
1141464591 16:84197338-84197360 CTGTTCACAGGGCTGGAGGCAGG + Intergenic
1142266885 16:89068047-89068069 CTCTCCCCAGGGCTGGAGGCTGG + Intergenic
1203077928 16_KI270728v1_random:1131849-1131871 CTCTGGGAGGGGCTGGAAGCAGG - Intergenic
1143474060 17:7192957-7192979 CTCTCGCACGGACTGGACGCTGG + Exonic
1143725204 17:8839751-8839773 CTCTCGGAAGGAATGGAGGTGGG - Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1143993718 17:10988924-10988946 CTTTAGAAAGTGCTGGGGGCAGG + Intergenic
1146565380 17:33908545-33908567 CTCTCACAAGGGCTGGAATCAGG - Intronic
1147213563 17:38886272-38886294 GTCTCGCCAGGGCTGGGGGCTGG + Intronic
1148719238 17:49738994-49739016 CCCTTGAAGGGGCTGCAGGCTGG + Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1151396618 17:73827123-73827145 CTCTGGACAGGTCTGGAGTCAGG - Intergenic
1152123770 17:78434292-78434314 ATCTGGCAAGGGCTGGACGCTGG - Intronic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1154005171 18:10521230-10521252 CACTGGAAAGGGCTGGGTGCAGG + Intergenic
1160452990 18:78978602-78978624 CTCCCGGCAGGGCTGGTGGCGGG - Intergenic
1162304031 19:9860668-9860690 CTCTCGAGATGGCAGGAGTCGGG - Exonic
1163691739 19:18742178-18742200 CTCTGAACAGGGCTGGAAGCTGG - Intronic
1165173624 19:33910888-33910910 ATCTAGAAATAGCTGGAGGCTGG + Intergenic
1165177631 19:33941743-33941765 CTCTCGAAAGGACAAGAAGCGGG - Intergenic
1165437127 19:35802083-35802105 CTCTGGAAGGATCTGGAGGCTGG + Intronic
1167582942 19:50357265-50357287 CTCTAGAAACGGGTGGCGGCTGG - Intronic
1167584900 19:50368786-50368808 CTCTAGAAACGGGTGGCGGCTGG - Intronic
925759146 2:7167483-7167505 CTCTCGAGGGGCATGGAGGCTGG - Intergenic
926384492 2:12322861-12322883 CTCTAGAAAGTGCAGGAGTCAGG + Intergenic
927175010 2:20399707-20399729 CCCATGAAAGGGCTGGGGGCAGG - Intergenic
928102793 2:28449271-28449293 CACTGGTAAGGGCTGGAGCCAGG + Intergenic
929212060 2:39368042-39368064 CTCTCAAAAGAGCTGGATCCAGG - Intronic
929825855 2:45309304-45309326 CCCTCCAAAGGGCTGGAAGAGGG - Intergenic
931748568 2:65311583-65311605 CTCTCGACAGCACTGGAGGCTGG + Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933271768 2:80240425-80240447 CTGTGGAGATGGCTGGAGGCAGG - Intronic
935347055 2:102118166-102118188 CTCTGGGAAGACCTGGAGGCTGG + Intronic
937150770 2:119684071-119684093 GTCTCTAAAGGGCTTTAGGCAGG - Intronic
937868627 2:126771960-126771982 CTCTGGAAAGGGCTGAGGGTCGG + Intergenic
942453294 2:176121930-176121952 CCCTCGGAAGGGCGGGCGGCCGG - Intergenic
943365179 2:186961924-186961946 GTCTCGAAAGGGGTGGGGGGAGG - Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG + Intronic
947394903 2:229676697-229676719 CTCTGGAAATGGCTAGGGGCAGG + Intronic
947481003 2:230499907-230499929 CTCTCATAAGGCCTGGAGGTGGG + Intronic
948589400 2:239039520-239039542 CTGTGCAAAGGCCTGGAGGCAGG + Intergenic
1169067916 20:2704973-2704995 CTCTCCCAAAGCCTGGAGGCAGG + Intronic
1171848101 20:30290061-30290083 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1171969107 20:31552284-31552306 TTCAGCAAAGGGCTGGAGGCAGG + Intronic
1172033110 20:31995423-31995445 GTCTCGAGAGGCCTGGAGGGTGG - Intronic
1172579679 20:36037024-36037046 CTCAGGAAAGGGATGGAGCCTGG - Intergenic
1172648224 20:36484692-36484714 CTCTCGGAAAGGCAGGAGCCTGG - Intronic
1172940430 20:38650174-38650196 CTCTCTGGAGGGCTGGAGGGTGG - Exonic
1173186051 20:40841136-40841158 CCCTCCAAAGGGTGGGAGGCTGG + Intergenic
1174046734 20:47739141-47739163 CTCTCAACAGTTCTGGAGGCCGG - Intronic
1174424523 20:50422709-50422731 TTGTGCAAAGGGCTGGAGGCAGG + Intergenic
1175595037 20:60224210-60224232 CTGTTCAAAGGGATGGAGGCTGG - Intergenic
1175994710 20:62806926-62806948 CACTAGACAGGGCTGGAGGCTGG + Intronic
1176178004 20:63737707-63737729 CGCGGGAAGGGGCTGGAGGCAGG + Intronic
1177611187 21:23450632-23450654 CTCTTGAAAGGGCTGTTGCCAGG - Intergenic
1179639658 21:42738985-42739007 CTCTTAAAAGGACTGTAGGCCGG - Intronic
1179968730 21:44821674-44821696 CTCTAGAACTGTCTGGAGGCTGG - Intergenic
1181861011 22:25818163-25818185 CTCTGGAGTGGGCTGGGGGCAGG + Intronic
1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG + Intronic
1184341084 22:43886302-43886324 CTCTCACCAGAGCTGGAGGCTGG - Exonic
949671522 3:6402361-6402383 CTCTCAAGAGGGCTGGTGTCTGG - Intergenic
952706136 3:36380225-36380247 CCCTGGAAAGGGCTGGGGGAAGG - Intergenic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953929826 3:47000324-47000346 CTCTCCAATGTGCTGGAGGACGG + Exonic
957570012 3:81935062-81935084 TTCTCCAAAGTGCTGGAGGAGGG - Intergenic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
961935624 3:130579700-130579722 GACTTGAAAGGACTGGAGGCAGG - Intronic
963080544 3:141389284-141389306 CTCTCTAATGGGCTGAAGGGTGG + Intronic
965608561 3:170520954-170520976 CTCTCCAAAAGGCTGTAGGTGGG + Intronic
966875436 3:184319194-184319216 CTTTGTAAAGGGCTGGAGACAGG + Intronic
969339630 4:6532029-6532051 CTTTGCAAAGGGCAGGAGGCTGG + Intronic
969570008 4:8002668-8002690 CTGTAGACAGGTCTGGAGGCAGG - Intronic
969590087 4:8117026-8117048 CTCTAGAGAGGTCTGGAGCCAGG - Intronic
969833889 4:9822856-9822878 CTCTGGGAAGGGATCGAGGCAGG + Intronic
969936434 4:10686593-10686615 GCCTGGAAAAGGCTGGAGGCTGG - Intergenic
970418634 4:15883672-15883694 CTCTGGCAAGAGCTGGAAGCAGG + Intergenic
972587294 4:40449602-40449624 CTCCCGAAAGGGGTGGAGTGGGG + Intronic
973603372 4:52563215-52563237 ATTTCCACAGGGCTGGAGGCGGG - Intergenic
975478976 4:74856848-74856870 CTCTCCATAAGGCTGGAGACAGG + Intergenic
975484192 4:74916169-74916191 CACTGGAAAGGGCTGAAGCCAGG - Intergenic
978501945 4:109419185-109419207 CTCTGGAATGGGCTGGAATCAGG + Intergenic
981561831 4:146056436-146056458 CTGTAGAAAGGGATGCAGGCTGG + Intergenic
985967173 5:3346524-3346546 CTCTCCCACGGGATGGAGGCTGG - Intergenic
986066170 5:4236396-4236418 CTGCTGCAAGGGCTGGAGGCTGG - Intergenic
986402979 5:7396682-7396704 CTCTGGCAAGGGCTGCGGGCGGG + Intronic
986783278 5:11086221-11086243 AGCTCAAAAGGGATGGAGGCAGG + Intronic
989133854 5:38133992-38134014 ATCTCAACAGTGCTGGAGGCTGG + Intergenic
991400254 5:66244356-66244378 CTCTGCAAAGGCCTGGAGGTGGG - Intergenic
991623495 5:68571584-68571606 CTCGGGAAAGGGTGGGAGGCAGG + Intergenic
993852003 5:93022202-93022224 CTCTTGAAAAGACTGAAGGCTGG + Intergenic
996068958 5:119112658-119112680 CTTTAGAAAGAGCTGTAGGCTGG + Intronic
996860964 5:128065218-128065240 TTCTCCAAAGGGATGGATGCTGG - Intergenic
999095972 5:148978584-148978606 CTATGGAAAGAGCTGGAGGGAGG - Intronic
1001752898 5:174145168-174145190 CTCTAGACAGGGCTGCAGGGTGG + Intronic
1002136341 5:177110164-177110186 CTCTGCAAAGGTCTGGAGGCAGG + Intergenic
1003192464 6:3886599-3886621 GTCTTGAAGGGGCTGCAGGCAGG + Intergenic
1003278205 6:4670388-4670410 CTCCCGACAGGGCTGGAAGCAGG - Intergenic
1006224211 6:32522413-32522435 CTCCAGAATAGGCTGGAGGCGGG - Intronic
1006228196 6:32558425-32558447 CTCCAGAACAGGCTGGAGGCAGG - Intronic
1006230807 6:32584615-32584637 CTCCAGAACAGGCTGGAGGCAGG - Intronic
1006810707 6:36818687-36818709 CTCCAGAAAGGGCTGGAGCCAGG + Intronic
1006831437 6:36970558-36970580 CCCTGGTAATGGCTGGAGGCAGG - Intronic
1007299136 6:40853164-40853186 TTCTTGAAAGCCCTGGAGGCTGG + Intergenic
1018429516 6:163712531-163712553 CTCCCGGAAGAGCTGGACGCTGG - Intergenic
1019070931 6:169344297-169344319 CTCTGGGCAGGGCAGGAGGCAGG + Intergenic
1019648636 7:2144397-2144419 CTTTGGAGAGGGCTGGTGGCGGG - Intronic
1020288327 7:6703502-6703524 TTCTCGATAGGGCTACAGGCTGG + Intronic
1022959849 7:35416005-35416027 CTCTAGGAAGAGATGGAGGCTGG - Intergenic
1023742018 7:43289399-43289421 CATTAGAAAGTGCTGGAGGCTGG - Intronic
1024666042 7:51548236-51548258 CTCTCAGAAGGGCTGGAGCTGGG - Intergenic
1026072756 7:67137172-67137194 TTCTAGAAAGTGCTGGAGGAAGG - Intronic
1026704127 7:72675036-72675058 TTCTAGAAAGTGCTGGAGGAAGG + Intronic
1026991867 7:74590744-74590766 CTAGGGAAAGGGCTGGAGTCTGG - Intronic
1029853562 7:103489958-103489980 CTCTCCCAGAGGCTGGAGGCAGG - Intronic
1030012886 7:105189048-105189070 CTGAGGAAAGGGCTGGAGTCTGG - Intronic
1034226815 7:149490853-149490875 CTCTAGAGAGGGATTGAGGCTGG + Intronic
1034540514 7:151755153-151755175 CTCTGGGAGGGGCTGAAGGCTGG + Intronic
1035303555 7:157915506-157915528 CTCTCCATTGGGCTGGAGGATGG - Intronic
1038489096 8:27956918-27956940 CTCTCCAAAAGGGTGGAGGACGG + Intronic
1038578707 8:28728274-28728296 CTCGCCAAAGGGCGGGAGGGTGG - Intronic
1042525555 8:69761286-69761308 TGGTTGAAAGGGCTGGAGGCTGG + Intronic
1044931973 8:97259920-97259942 CTCTAGGTAGGGCTGGAGACTGG + Intergenic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1047826067 8:128576911-128576933 CTCTAGACAGGTCTGGAGTCTGG + Intergenic
1048335604 8:133499874-133499896 CTCGCAACAGGGCTGGGGGCAGG + Intronic
1048873144 8:138815310-138815332 CTCTCGGAAGTCCTGGAGCCTGG - Intronic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049867964 8:144950925-144950947 CTCTCTAGATGGCGGGAGGCCGG + Intergenic
1052862227 9:33444108-33444130 CTATGGAAAGGGCTGGAAGCAGG + Intronic
1052939529 9:34121630-34121652 CTCTTGAAGGGGCTGGGGGTGGG - Intronic
1053786231 9:41654713-41654735 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1054158820 9:61659486-61659508 CTCTCCAAGGGGCTGAAAGCTGG - Intergenic
1054174946 9:61868657-61868679 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1054449805 9:65397701-65397723 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1054478594 9:65590491-65590513 CTCTCCAAGGGGCTGAAAGCTGG - Intergenic
1054662592 9:67712136-67712158 CTCTCCAAGGGGCTGAAAGCTGG - Intergenic
1055158155 9:73089916-73089938 CTCTAGAAAGGTATGCAGGCTGG + Intergenic
1056813623 9:89783397-89783419 CTCTTGAAAGGTCTTGAGACAGG + Intergenic
1061250384 9:129422991-129423013 CTGTGGACAGGGCTGCAGGCGGG - Intergenic
1061396463 9:130346459-130346481 CTCACGGTGGGGCTGGAGGCAGG + Intronic
1061491861 9:130949388-130949410 CTCTTGAAGGGGCTGCAGGTGGG + Intergenic
1061491885 9:130949489-130949511 CTCTAGAAGGGGCTGCAGGTGGG + Intergenic
1062262697 9:135670830-135670852 CAGGCGAGAGGGCTGGAGGCGGG - Intergenic
1062541327 9:137042970-137042992 CTCCTGGAAGGGCTGAAGGCAGG + Exonic
1187410969 X:19050243-19050265 CTCTAGGAAGGGCTGGAGACTGG + Intronic
1188491777 X:30745495-30745517 CTGAAGGAAGGGCTGGAGGCTGG - Intergenic
1189705317 X:43753897-43753919 CTATTGAAAGGGCTTGAGTCTGG - Intergenic
1189887908 X:45568012-45568034 CTCTGGAATGGGGTGGAGACTGG + Intergenic
1190944470 X:55077503-55077525 CTCACTAAAGTGCTGGAAGCAGG + Exonic
1190945714 X:55091436-55091458 CTCACTAAAGTGCTGGAAGCAGG + Exonic
1194975996 X:100396492-100396514 CTCCCCAAGGGGCTGGAGGCAGG - Intronic
1195105443 X:101598836-101598858 TTCAAGAAGGGGCTGGAGGCGGG + Intergenic
1195107439 X:101614931-101614953 TTCAAGAAGGGGCTGGAGGCGGG - Intergenic
1198586611 X:138128816-138128838 CTCTTGGAAGGGCTCGTGGCAGG + Intergenic
1200018450 X:153182362-153182384 CTCTCGTCAGGGCAGCAGGCAGG - Exonic
1200104406 X:153704316-153704338 CTCTCAGAGGGGCTGGAAGCAGG + Intronic