ID: 961796848

View in Genome Browser
Species Human (GRCh38)
Location 3:129415300-129415322
Sequence GGTATTGGCCAGGATATCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961796841_961796848 17 Left 961796841 3:129415260-129415282 CCAGGCTGCTCCTTTGCTGAGCC 0: 1
1: 0
2: 5
3: 36
4: 280
Right 961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 108
961796842_961796848 7 Left 961796842 3:129415270-129415292 CCTTTGCTGAGCCATAGACCACT 0: 1
1: 0
2: 2
3: 12
4: 116
Right 961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 108
961796840_961796848 28 Left 961796840 3:129415249-129415271 CCTTGCAGTGGCCAGGCTGCTCC 0: 2
1: 0
2: 3
3: 39
4: 465
Right 961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 108
961796844_961796848 -4 Left 961796844 3:129415281-129415303 CCATAGACCACTGCTTGTAGGTA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 108
961796839_961796848 29 Left 961796839 3:129415248-129415270 CCCTTGCAGTGGCCAGGCTGCTC 0: 1
1: 0
2: 1
3: 17
4: 233
Right 961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961796848 Original CRISPR GGTATTGGCCAGGATATCCA TGG Exonic
903938655 1:26913743-26913765 TGTCTTGGCCAGAACATCCAAGG + Exonic
904993629 1:34614019-34614041 GGCAGGGGCCAGGATATGCAGGG - Intergenic
907480384 1:54741729-54741751 GGTCTTGGCCATGATGTCCTTGG + Exonic
909689007 1:78384562-78384584 TGGATTGGGCAGGATTTCCAGGG + Intronic
912146447 1:106799584-106799606 GGCATAGGCCAAGCTATCCATGG - Intergenic
914264241 1:146024326-146024348 GGTATTGTCCAAGATAGGCAAGG + Intergenic
915079629 1:153343152-153343174 GGTGTTGGCTGGAATATCCAAGG - Exonic
915988991 1:160494094-160494116 GGTATGTGCCAGGATATGAATGG - Intronic
916192617 1:162193928-162193950 GGGATTTGCCAGGAGATCCAAGG + Intronic
923921016 1:238564806-238564828 GGGAATGGGCAGGATATCCCAGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063819574 10:9819313-9819335 GGAATTGGCCAGGAGACCAAGGG - Intergenic
1064954896 10:20896972-20896994 GGAATTGGCCAGAAAATGCACGG - Exonic
1065601511 10:27373686-27373708 GGTTTTGGCCAGGAGTTCCCCGG + Intergenic
1065813662 10:29465001-29465023 GGTATTGGCTAAGTTAGCCAGGG - Intronic
1069614788 10:69800246-69800268 GGTACAGGCCAGGAAATTCAGGG - Intergenic
1070192897 10:74128692-74128714 GGTTTTGCCCAGGTTATGCATGG + Intronic
1071601714 10:86961757-86961779 GGAGTCGGCCAGGCTATCCAGGG - Intronic
1073183776 10:101602970-101602992 GCTGTTGGCCAGGAGCTCCATGG + Intronic
1073994904 10:109304433-109304455 GGCATAGGCCAGGCTAACCATGG + Intergenic
1076383241 10:130039176-130039198 TGTATTGGCCAGTGTCTCCAGGG + Intergenic
1078028628 11:7724899-7724921 GTTATTGGCAAGTATCTCCAAGG - Intergenic
1085210530 11:74773190-74773212 AGGATTGGCCTGGATTTCCATGG + Intronic
1087501271 11:98957505-98957527 TGTCTTTGCCAGGATATCCAGGG - Intergenic
1090373439 11:126272707-126272729 GGTAATGGCCTGGAAGTCCAAGG - Intronic
1094819733 12:34215300-34215322 GGTTTTGGCCATGTTGTCCAAGG + Intergenic
1106864094 13:33944807-33944829 GATATTGCCCTGGATATTCAAGG + Intronic
1108089701 13:46835621-46835643 GGTATTGGCATGGATATACCTGG + Exonic
1108105238 13:47001781-47001803 GGGATTGGCCAAGATACCCCAGG + Intergenic
1111453571 13:88450597-88450619 AGTATTGTGAAGGATATCCAGGG + Intergenic
1112920618 13:104607351-104607373 GGTATTGCCGAGGATATTGAAGG - Intergenic
1114435986 14:22708257-22708279 GGTATTGTTCATAATATCCAGGG - Intergenic
1122842120 14:104471089-104471111 GGTAGTGGCCAGGAGGCCCAAGG - Intergenic
1202828496 14_GL000009v2_random:2409-2431 GATATTGTCCATAATATCCAGGG + Intergenic
1125488841 15:40131578-40131600 GGTATTGTTCCGAATATCCAGGG + Intergenic
1129484746 15:75859354-75859376 GGAATTAGATAGGATATCCAAGG + Intronic
1135465888 16:22684465-22684487 GGTAGTGGCCAGCAAACCCAGGG - Intergenic
1138637984 16:58358502-58358524 GATATTGTCCAGGATCTACAAGG - Intronic
1140134145 16:72190302-72190324 GGTATAGGCCAAGTTAACCATGG - Intergenic
1143954677 17:10658910-10658932 AGTATTGGTCAGGACAGCCACGG + Intergenic
1145254772 17:21316521-21316543 GGTCTCGGCCAGGATAACCCAGG - Intergenic
1145321828 17:21771444-21771466 GGTCTCGGCCAGGATAACCCAGG + Intergenic
1149021879 17:51977236-51977258 GGTATTGGTCAGGATTTTGAGGG - Intronic
1154386332 18:13895708-13895730 GGTTTTGGCCCGGAGCTCCAGGG + Intronic
1159663801 18:71131836-71131858 GACATTTGCCAGGATTTCCAGGG + Intergenic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1162449190 19:10744304-10744326 GGGATGGGTCTGGATATCCAAGG + Intronic
1162472960 19:10883320-10883342 GGTCTTGGGCAGGATTCCCAGGG - Intronic
1164505838 19:28860602-28860624 GGCATAGGCCAGGCTAACCATGG - Intergenic
1165264322 19:34647378-34647400 GCCATTGCCCAGGAGATCCAAGG - Intronic
1166250108 19:41564012-41564034 GGTACTGGGCAGGATCGCCATGG + Intronic
1166419958 19:42629062-42629084 GGCATAGGCCAGGCTAACCATGG + Intronic
1166495538 19:43300514-43300536 GGCATAGGCCAGGTTAACCATGG + Intergenic
1202644199 1_KI270706v1_random:125411-125433 GATATTGTCCATAATATCCAGGG - Intergenic
1202644837 1_KI270706v1_random:130480-130502 GGTATTGTTCCTGATATCCAGGG + Intergenic
925482301 2:4289467-4289489 GGTATTGAGAAGGATTTCCATGG + Intergenic
933143327 2:78820874-78820896 GGCATTGGCCTGGATATCTGGGG - Intergenic
934143705 2:89072386-89072408 GGTATTGTCCATAATATCCAGGG + Intergenic
934225533 2:90128172-90128194 GGTATTGTCCATAATATCCAGGG - Intergenic
934506570 2:94898957-94898979 GATATTGTCCATAATATCCAGGG - Intergenic
937492128 2:122380789-122380811 GGTATTAGTCAGGATAGCCTAGG - Intergenic
938145227 2:128828836-128828858 GGTTTTGGCCAGGAAAATCAGGG + Intergenic
942317331 2:174708041-174708063 GGTATTGTCCCTAATATCCAGGG - Intergenic
946707517 2:222473073-222473095 GGTGTAGGCCAGGCTACCCATGG - Intronic
947697243 2:232202016-232202038 GGGATGGGCCAGGAAAGCCATGG - Intronic
1171894170 20:30744350-30744372 GATATTGTCCATAATATCCAGGG - Intergenic
1176607678 21:8847237-8847259 GATATTGTCCATAATATCCAGGG + Intergenic
1179912344 21:44456820-44456842 GGTGTTGGCCGGGATGTCCTCGG - Exonic
1180105192 21:45613680-45613702 GGGCTGGGCCAGGATATCTATGG + Intergenic
1180357764 22:11857028-11857050 GATATTGTCCATAATATCCAGGG + Intergenic
1180380503 22:12135305-12135327 GATATTGTCCATAATATCCAGGG - Intergenic
1180976067 22:19849086-19849108 GGGCTGGGCCAGGACATCCAGGG + Exonic
1181096031 22:20505935-20505957 GGGGTTGCCCAGGACATCCAAGG - Intronic
949710055 3:6862021-6862043 GGGATTCGGCAGGATCTCCAGGG - Intronic
950433407 3:12964868-12964890 AGTATTGGACAGGGTACCCAGGG - Intronic
952619660 3:35322510-35322532 GGTATAGGCCAAGATAACCATGG - Intergenic
952838118 3:37621489-37621511 AGTATTGTCCAGGAGACCCAGGG + Intronic
954714076 3:52518464-52518486 GGTCTTCCCCAGGAGATCCATGG + Intronic
955924827 3:63994657-63994679 GGTAGTGGCCAGGTCAGCCAGGG + Intronic
959158772 3:102698171-102698193 GGCATAGGCCAGGTTAACCACGG - Intergenic
961502905 3:127350274-127350296 GGTATTGGACAGGAAAGCCCCGG - Intergenic
961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG + Exonic
963693705 3:148537327-148537349 GGTGTAGGCCAGGCTAACCATGG - Intergenic
980596171 4:134957627-134957649 GGAATTGGGCAGGATAGCCAAGG + Intergenic
983623456 4:169783213-169783235 GATATTGTCCATAATATCCAGGG + Intergenic
983624111 4:169787194-169787216 GATATTGTCCATAATATCCAGGG - Intergenic
986653671 5:9989673-9989695 GGTATGGGCCAAGCTACCCATGG - Intergenic
988254885 5:28808983-28809005 GGCCTTGGCCAGGAAGTCCAGGG - Intergenic
991234193 5:64375386-64375408 GGGATTTGCCAGTATGTCCATGG + Intergenic
993352647 5:86868864-86868886 GGAATGGGCCAGGCTAACCATGG - Intergenic
993466380 5:88251548-88251570 GGCATTGGCCAGGCTAACCTTGG - Intronic
994392145 5:99201677-99201699 GATATTGATCAGAATATCCAGGG - Intergenic
994392532 5:99204233-99204255 GATATTGTTCAGGATATCCAGGG - Intergenic
1002961687 6:1921191-1921213 GTTATTGGCCAGGGTATGTATGG - Intronic
1005573836 6:27173478-27173500 GGTTTTGGCCATGTTGTCCATGG + Intergenic
1006438746 6:34040497-34040519 GGCATGGCCCAGGATACCCAGGG + Intronic
1014950336 6:127547140-127547162 GTAATTGGCCAGGCTGTCCAGGG - Intronic
1020129179 7:5549843-5549865 GGTACTGGCCAGGATAGAAATGG - Intronic
1020336419 7:7065770-7065792 GATATTGTTCATGATATCCAAGG + Intergenic
1024636956 7:51299034-51299056 GGCATAGGCCAGGAAAGCCAAGG + Intronic
1031893948 7:127326445-127326467 GGTATTTGCCTGTATGTCCATGG + Intergenic
1033498012 7:141919075-141919097 GGTTGTGACCAGGATCTCCAGGG - Exonic
1033617083 7:143026911-143026933 GGTTGTGACCAGGATCTCCAGGG + Exonic
1045925307 8:107574802-107574824 GGTATTGTCCATAATATCTAGGG + Intergenic
1046302482 8:112314543-112314565 GGTAACTGTCAGGATATCCAGGG + Exonic
1047966131 8:130048206-130048228 GGTTGTGGCCAGGAGCTCCATGG + Intergenic
1054354182 9:64045434-64045456 GATATTGGCCATAATATCCGGGG + Intergenic
1054354481 9:64048423-64048445 GATATTGTCCACAATATCCAGGG + Intergenic
1057428125 9:94970571-94970593 GAAATTGGCCAAGATTTCCAAGG + Intronic
1062622556 9:137429358-137429380 GGCCTTGCCCAGGAAATCCACGG - Exonic
1203742815 Un_GL000218v1:17550-17572 GATATTGTCCATAATATCCAGGG + Intergenic
1203703023 Un_KI270742v1:12125-12147 GATATTGTCCATAATATCCAGGG + Intergenic
1203567278 Un_KI270744v1:101882-101904 GATATTGTCCATAATATCCAGGG - Intergenic
1203567583 Un_KI270744v1:104873-104895 GATATTGGCCATAATATCCGGGG - Intergenic
1186838675 X:13463461-13463483 GTTATTGGCCAGATTTTCCAGGG - Intergenic
1196920926 X:120584475-120584497 GATATTGGCCATGCTATGCAGGG + Intergenic
1201156041 Y:11132020-11132042 GATATTGGCCATAATATCCGGGG + Intergenic