ID: 961797849

View in Genome Browser
Species Human (GRCh38)
Location 3:129422575-129422597
Sequence AAGAGTGCCCAGGGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961797849_961797853 -9 Left 961797849 3:129422575-129422597 CCATCCACACCCTGGGCACTCTT 0: 1
1: 1
2: 1
3: 25
4: 315
Right 961797853 3:129422589-129422611 GGCACTCTTCCTTATCCTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961797849 Original CRISPR AAGAGTGCCCAGGGTGTGGA TGG (reversed) Intronic
901193771 1:7428305-7428327 ACCAGTGCCCAGGGTGTAGGAGG + Intronic
901478069 1:9504552-9504574 AACAGGGCCCGGGGTGTGGTGGG - Intergenic
901624153 1:10614060-10614082 AATAGGCCCCAGGGTGGGGAGGG + Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901871133 1:12139925-12139947 AAGACTGCCCAGGCTGGGCATGG - Intronic
902456971 1:16540689-16540711 AAGAGAGCACTGGCTGTGGACGG + Intergenic
902474604 1:16675257-16675279 AAGAGAGCACTGGCTGTGGACGG + Intergenic
902484257 1:16732487-16732509 AAGAGAGCACTGGCTGTGGACGG - Intergenic
902495196 1:16867225-16867247 AAGAGAGCACTGGCTGTGGACGG - Intronic
902562700 1:17287669-17287691 AGGAGGGCCCTGGGTGAGGATGG + Intergenic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
903662865 1:24989360-24989382 AACAGAGGCCAGGGTGTGCAGGG + Intergenic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
905034153 1:34906455-34906477 TGGAATGCACAGGGTGTGGAAGG - Intronic
905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG + Intergenic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG + Intergenic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
911098048 1:94071644-94071666 AACAGTGCCCAGCATGTGGCTGG + Intronic
911175406 1:94812664-94812686 ATGAGTGCCCAAGCTGTGGGGGG + Intergenic
911872873 1:103121338-103121360 AAGAGTGCCCAAAGTCTGGAAGG + Intergenic
915865017 1:159490349-159490371 AAGAGAGACAAGGGTGGGGAAGG - Intergenic
916728593 1:167545988-167546010 CAGACTGCCCAGGGTGTCCAGGG + Intronic
917214906 1:172668299-172668321 AAATGTCCCCATGGTGTGGAGGG + Intergenic
918380627 1:183951010-183951032 AAGATTGTCGAGGCTGTGGATGG - Exonic
919823015 1:201484679-201484701 AGGAGTGGGCAGGGTGTGGTGGG + Exonic
919910306 1:202106915-202106937 AAGAGAGGACAGGGTGTGGAAGG + Intergenic
920343010 1:205287444-205287466 AAGAGGGAACAGGGTGGGGAGGG - Intergenic
920777988 1:208959078-208959100 TAGAGTGGCCAGGATGTGGGAGG - Intergenic
922525877 1:226303393-226303415 AAGAATACGCAGGGTGGGGATGG + Intronic
924464138 1:244284946-244284968 ACGAGTTCCCACGGGGTGGATGG + Intergenic
924775424 1:247112189-247112211 AGGAGGGCCCAGGGGCTGGAGGG + Exonic
1065807304 10:29406051-29406073 TACAGTTCCAAGGGTGTGGAGGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067290425 10:44935630-44935652 AAGACTGCTCAGGGTCGGGAGGG + Exonic
1067571963 10:47378247-47378269 GGAAGTGCCCACGGTGTGGAAGG + Intronic
1067800539 10:49355389-49355411 AAAGGTGGCCAGGGTGTGGTGGG - Intergenic
1069286458 10:66721180-66721202 AAGAGACCCAAGGGTGTGGAAGG + Intronic
1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG + Intronic
1069786655 10:70992638-70992660 TGGAGTGCCCATGGTGAGGATGG + Intergenic
1071251668 10:83825393-83825415 AAGAATGCCCTGGGTGCTGAGGG + Intergenic
1072198588 10:93138443-93138465 AAAAGTTGCCAGGCTGTGGAAGG + Intergenic
1072608490 10:97001995-97002017 AGCAGTGCCCAGAGGGTGGAGGG + Intronic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073339607 10:102735091-102735113 AGGAGTGACCAGGATGGGGAGGG - Intronic
1073424341 10:103447201-103447223 AAGTGGGCCCAGGGTCTGGCAGG - Exonic
1073457681 10:103647408-103647430 TGGAGAGACCAGGGTGTGGAGGG + Intronic
1073474101 10:103741639-103741661 CAGAGAGCCCAGGCTGTCGAGGG + Intronic
1075153897 10:119958358-119958380 TAAAGTGCCCAGGATTTGGAAGG + Intergenic
1075403424 10:122177591-122177613 ATGATGGCCCAGGGAGTGGATGG + Intronic
1075580040 10:123610547-123610569 AGGAGCACCCAGGTTGTGGATGG + Intergenic
1076406509 10:130215612-130215634 AAGAGGGCCCAGGCGGTGAATGG + Intergenic
1076634651 10:131874269-131874291 GGGAGGGCCCAGGGTTTGGAGGG + Intergenic
1077184293 11:1229408-1229430 CAGAGGGCCCAGGGTGGGAAGGG + Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1081389067 11:42507590-42507612 AAGAGGGTCTAGTGTGTGGAGGG + Intergenic
1081668338 11:44929490-44929512 GAGAGGGCCCAGGGTCTGGCTGG - Exonic
1083378309 11:62244010-62244032 GAGAGTGTCGTGGGTGTGGAGGG - Intronic
1083883762 11:65560773-65560795 AAGAGAGCCCAGGGTGCCCAGGG + Intergenic
1084005097 11:66318258-66318280 AAGAGTGCAGCGGGTGTGCATGG - Intergenic
1084357746 11:68651233-68651255 AAGACTGCACTGGGTGAGGATGG - Intergenic
1084774817 11:71368351-71368373 AAGAGCGCCAAGGGTGAGCAGGG + Intergenic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1089294246 11:117458460-117458482 AAGAATGCCCATGGTGTGGGAGG + Intronic
1089395878 11:118136121-118136143 AGGAGTGCCCAGAGTGGCGATGG + Exonic
1089563871 11:119360206-119360228 AAGAGTGCCCAGGGTCTGGCTGG - Exonic
1089861692 11:121595789-121595811 AAACGTGCCCAGGGGGTGAAGGG - Intronic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091124806 11:133084282-133084304 TGGAGTGCGCAGGGTGTGCAAGG - Intronic
1091282543 11:134390253-134390275 AGCAGTGGCCTGGGTGTGGAGGG - Exonic
1091311120 11:134575977-134575999 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091311135 11:134576038-134576060 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091806629 12:3361585-3361607 AAAAGGGCCCATGGTGAGGAGGG - Intergenic
1092141931 12:6190015-6190037 AAGGGGGCCCAGGGTGTGTCTGG + Intergenic
1092148113 12:6228779-6228801 AAAAGTAGCCAGGGTGTGGCTGG - Intronic
1092928312 12:13291965-13291987 CAGAGTACCCAGGGTGAAGAAGG - Intergenic
1095293362 12:40501598-40501620 ACGACTGCCTTGGGTGTGGAAGG - Intronic
1096430706 12:51540552-51540574 AACAGTGCCCAGGGTAGGCAGGG - Intergenic
1096638872 12:52978473-52978495 AAGAGTGAACTGGGTGAGGAAGG - Intergenic
1098034067 12:66284211-66284233 AAGAGAACTCAGGCTGTGGATGG + Intergenic
1098247865 12:68538968-68538990 AGGAGGGGCCAGGGTGTGGGCGG - Intergenic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1098595686 12:72271949-72271971 TAAAGTGCCCAGGGTGGAGAAGG + Intronic
1098738715 12:74142593-74142615 AAGAGTGTGAAGGATGTGGAAGG - Intergenic
1099994830 12:89767240-89767262 AAGAGTCCCAAGGCTGTGCAGGG - Intergenic
1100892138 12:99137459-99137481 AACAGGGCTGAGGGTGTGGAGGG + Intronic
1101327949 12:103733037-103733059 GAGAGTGACTGGGGTGTGGATGG - Exonic
1103982781 12:124747269-124747291 GTGATTGCCCAAGGTGTGGAGGG - Intergenic
1104650384 12:130527083-130527105 AAGTCATCCCAGGGTGTGGAGGG + Intronic
1106041741 13:26100187-26100209 GAGAGGGCCAAGGCTGTGGATGG + Intergenic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1107963617 13:45579868-45579890 CAGAGTGCCCTGGGTGGGGAAGG - Intronic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1113203336 13:107890183-107890205 AAGAGTGTGCTGTGTGTGGAAGG + Intergenic
1113450852 13:110408229-110408251 AAGGGTCCCCAGGGCGGGGAGGG + Intronic
1114138431 14:19882129-19882151 AAGAGTGCTGAGGGTGATGAAGG - Intergenic
1114189471 14:20429760-20429782 AGGAGTGGGCAGGGTGTGGCAGG - Intronic
1115480056 14:33851730-33851752 AGGAGTCCCCGGGGAGTGGAGGG + Intergenic
1118462261 14:65997903-65997925 AAAAGTTCCCTGGGTTTGGAAGG - Intronic
1119168490 14:72515150-72515172 GAGAGTCCCCAGTGTGTGCAGGG + Intronic
1119547585 14:75483432-75483454 CAAAGTGTTCAGGGTGTGGATGG - Intergenic
1121597848 14:95179515-95179537 AGGAGTGCCCAGGCTGCGGATGG + Intergenic
1122523839 14:102365750-102365772 GGGAGTGCACAGTGTGTGGATGG + Intronic
1123106856 14:105845793-105845815 AGGAGTGCCCAGGGTGAGCGGGG + Intergenic
1123107093 14:105846730-105846752 AATACTGCCTAGGATGTGGAGGG - Intergenic
1123630261 15:22256268-22256290 AAATGTGCCCAAGGTGTGGAGGG + Intergenic
1126097925 15:45102266-45102288 AGGGGTGTCCAGGGTGTGCATGG + Intronic
1126233360 15:46353839-46353861 ACAAGAGCCCAGGGTGAGGATGG - Intergenic
1126412943 15:48390697-48390719 GAGAGGGACGAGGGTGTGGATGG - Intergenic
1127707636 15:61562809-61562831 GACAGTGCCCAGGGTTTGCATGG + Intergenic
1128591979 15:68906223-68906245 AAGCAGGCCCAGGGAGTGGAGGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129842301 15:78751317-78751339 AAGAGTGCCAAGGCGGTGGCAGG + Intergenic
1130097558 15:80867371-80867393 AAGAGAGACCAGGCTTTGGAGGG + Intronic
1131432215 15:92395913-92395935 AAAAGTTCCCAGCATGTGGAAGG - Intronic
1132305292 15:100807645-100807667 AACAGTGCCCAAAGTCTGGAGGG - Intergenic
1132734435 16:1378558-1378580 CAGAGTGCGCAGCATGTGGAGGG + Intronic
1134083404 16:11340069-11340091 AAGGGTTCCCAGGGTGGGGATGG + Intronic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1138909498 16:61379302-61379324 AAGAGTTTCAAGGGTGTAGAGGG - Intergenic
1139208871 16:65056673-65056695 AATAATGCCCAGGGTATGGTTGG + Intronic
1139754168 16:69129682-69129704 AAGAGGGGCCAGATTGTGGAGGG - Intronic
1140196385 16:72859036-72859058 CAGAGGGCAGAGGGTGTGGAGGG - Intronic
1141469062 16:84226190-84226212 GAGAAGGCCCAGGGTGTGAATGG + Intronic
1141574496 16:84955382-84955404 AAGAGGGCACAGGGTGTGGGGGG - Intergenic
1141972825 16:87494375-87494397 AAATGTGCCCAAGGTGTGGAGGG - Intergenic
1142319230 16:89370377-89370399 AACTGGGCCCAGGGTGTGGCTGG - Intronic
1143358313 17:6347477-6347499 AAGAGAGGCCAGGGTATGGAAGG - Intergenic
1143595167 17:7909595-7909617 AAGAGGCCCCACTGTGTGGAGGG - Intronic
1143919641 17:10320680-10320702 AAGACTACCCAGGGTGGGGCTGG + Intronic
1145762477 17:27433710-27433732 GACAGTGGCCAGGGTGAGGATGG - Intergenic
1145837284 17:27964069-27964091 AACAGTGCCTGGGATGTGGAAGG - Intergenic
1147167489 17:38601300-38601322 AAGGGGCCCCAGGGCGTGGATGG + Intronic
1147248761 17:39139804-39139826 ATGAGGGCCCAGGCTCTGGATGG - Exonic
1147755005 17:42761900-42761922 GTGGGTACCCAGGGTGTGGAAGG + Intronic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148293687 17:46479907-46479929 AAGAATGCCAAAGGTTTGGATGG + Intergenic
1148315872 17:46697610-46697632 AAGAATGCCAAAGGTTTGGATGG + Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152656278 17:81520414-81520436 AAGAGAGCCCAAGGTGTGTGTGG - Intronic
1155083210 18:22430629-22430651 AAGAGAGACCAGGCTGTGGCAGG - Intergenic
1156887437 18:42151767-42151789 AAGTGTGCCCAGGGTGTTGCTGG - Intergenic
1157960733 18:52150802-52150824 AGCAGTGCCAAGGGTTTGGAGGG - Intergenic
1158533273 18:58282962-58282984 AAGAGTCCCCAGGATGATGACGG + Intronic
1160971710 19:1771193-1771215 AAAAGGACCCAGGGTATGGAGGG - Intronic
1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG + Intronic
1161349641 19:3784753-3784775 AAGGGGTCTCAGGGTGTGGACGG + Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1162821192 19:13224657-13224679 AAGATTGCCAAGGGTAAGGAAGG - Exonic
1163272381 19:16262065-16262087 AAGAGTGCCTGGGCAGTGGAGGG + Intergenic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1164158220 19:22609557-22609579 CAGAATGCCCAGGGAGCGGAGGG - Intergenic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165445251 19:35853304-35853326 GGGAGTGCACAGGGTGTGGGCGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1165863310 19:38920388-38920410 AAGAGGGCGCGGGGTGGGGAAGG + Intronic
1167720022 19:51172886-51172908 AAGAATGACCAGGGTCAGGATGG - Intergenic
1168516447 19:57013430-57013452 AAGATTGCCCTGGGAGTGCACGG + Intergenic
1202707925 1_KI270713v1_random:37340-37362 AAGAGAGCACTGGCTGTGGACGG + Intergenic
925135096 2:1521492-1521514 AAGAGGGCCCTGGGGGAGGAGGG - Intronic
926522010 2:13927308-13927330 TAGAGTTCCAAGAGTGTGGAGGG - Intergenic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927091908 2:19718902-19718924 CAGAGTCCCCAGGGTTTGGCCGG + Intergenic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
928115228 2:28541421-28541443 AAGACAGCCCAGCGTGTGGCAGG - Intronic
929883557 2:45858562-45858584 AAGGGTGCCCAGGGGCTGAAAGG - Intronic
931235213 2:60406981-60407003 AAGAGAGCCTAGGGTGGGGCTGG - Intergenic
931957509 2:67443881-67443903 GAGAAGGCCCAGGGTGTGGCTGG - Intergenic
932591066 2:73068070-73068092 AAGAGGGTGGAGGGTGTGGAGGG - Intronic
933995665 2:87667666-87667688 AAGCCTGCCCAGGCTCTGGAAGG + Intergenic
934574174 2:95390050-95390072 AACTGTGCCCTGTGTGTGGAAGG - Intergenic
934773256 2:96921394-96921416 TAGAGTGCCCTGGGTGGGGATGG - Intronic
935215407 2:100971694-100971716 TAGAGGGCTCAGTGTGTGGAAGG - Intronic
936298192 2:111283246-111283268 AAGCCTGCCCAGGCTCTGGAAGG - Intergenic
938316755 2:130334893-130334915 AAGAGGACCAAGGGTGTGGCTGG + Intergenic
938947376 2:136225319-136225341 AGGAGTGCCCAGGGCATGGGAGG + Intergenic
943115969 2:183670687-183670709 AACAGTCCCCAGAGTGTGAAAGG - Intergenic
944457697 2:199911936-199911958 AAGGGCGCCAAGGGCGTGGAAGG - Intronic
945219387 2:207468589-207468611 GAGAGTGCCCAGGGAGGGCATGG - Intergenic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
948488417 2:238295891-238295913 AAGAGTTCCCCGGGTGTGGGTGG - Intergenic
948710100 2:239820017-239820039 AGGGGTGCCCAGGGTCTGCAGGG + Intergenic
949040138 2:241844192-241844214 AGGAGCGCCCTGGGTGTGGCCGG - Intergenic
1168895433 20:1320439-1320461 CAGAGTGCAGAGGGTGGGGAAGG + Intronic
1168931774 20:1630091-1630113 AAGACTTCCGAGGGTGCGGAGGG + Intronic
1170885136 20:20334082-20334104 AAGGGAGCCCAGGGTGTGGGAGG + Intronic
1170915863 20:20624935-20624957 AAAAGTGCCTGGGGTGGGGATGG - Intronic
1172100180 20:32480564-32480586 AAGAATGTCCAGGGCCTGGAAGG - Intronic
1172393130 20:34580126-34580148 AAGAGTGCCCAGTGTGGGATGGG + Intronic
1172777248 20:37414830-37414852 AAGACAGCTCAGGATGTGGAGGG - Intergenic
1173169110 20:40708643-40708665 GAAAGTGCCCAGGATGTGGCAGG + Intergenic
1173227356 20:41169670-41169692 AAGGGAGCCCAGGGTGTCAAGGG - Intronic
1173247914 20:41348875-41348897 CAGAGCCCCCAGGGTGTGTAAGG + Exonic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174402924 20:50285539-50285561 AAGTGAGGCCAGGGTGAGGAAGG - Intergenic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175610499 20:60347385-60347407 AAGAGGGCCCAGGGAAGGGAGGG + Intergenic
1177834572 21:26173940-26173962 GAGAATGGCCAAGGTGTGGAAGG - Intergenic
1178894720 21:36548916-36548938 GAATGTGCCCAGGGTGTGGTGGG - Intronic
1179826359 21:43968433-43968455 AAGAGGGCCCTGGGTGGGGGAGG + Intronic
1182433211 22:30313000-30313022 AAAAGACCCCAGGGTGAGGACGG + Intronic
1182711791 22:32327840-32327862 CAGAGTGCAGAGGGTGTGCAGGG - Intergenic
1183240416 22:36653627-36653649 AAGAGTTCCAAGGGTTGGGACGG + Intronic
1183282989 22:36942784-36942806 AAGAGGCCCCAGGTTGGGGAGGG - Intergenic
1183654939 22:39179231-39179253 CACAGTGCCTAGCGTGTGGATGG - Intergenic
1184018243 22:41801746-41801768 AACAGTGCCTAGAGTGTGGTAGG + Intronic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
952068428 3:29601933-29601955 CAGAGTTCCCAAGGTGGGGAAGG - Intronic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
953106280 3:39883241-39883263 AAGAGTGAACTGGATGTGGAAGG + Intronic
953628128 3:44587667-44587689 AAGAAAGCCCAGGGTGGTGATGG - Intronic
953932640 3:47013331-47013353 AAGAGGGCCCAGGATATGGTGGG + Intergenic
955347442 3:58171605-58171627 AAGACTGCCCAGGCTGATGAAGG - Intronic
955794745 3:62623898-62623920 AAATGTCCCCAGGGAGTGGAAGG - Intronic
958129945 3:89405519-89405541 AAAAGTGCTCAGAGTGTGGCAGG - Intronic
959578781 3:107963167-107963189 AAGAGTGGCCAGGCTGGGGGAGG - Intergenic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
962407287 3:135110988-135111010 AAGAGTGCATAGGGTTTAGAGGG + Intronic
962584922 3:136832614-136832636 ATGAGTGCCTATGATGTGGAAGG - Intronic
964429782 3:156593223-156593245 AAGAGTACCTAGTGCGTGGAAGG - Intergenic
964842140 3:161005889-161005911 AAGAAATCCCAGGGTGGGGAAGG + Intronic
965259812 3:166467637-166467659 AAGAGTGGCCATGGTGTCAAGGG + Intergenic
967104120 3:186241926-186241948 CAGAGTGCCCAGGCTGAGGCTGG + Intronic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
968666630 4:1825939-1825961 AGGAGTGGCCAGGGTGGGGCTGG - Intronic
969564997 4:7972145-7972167 AAGAGGTCCCGGGGTATGGAGGG - Intronic
970423897 4:15929215-15929237 AAGACTGTCCAGGGAGTGTAAGG - Intergenic
976947373 4:90787074-90787096 AGGCGTGCCCAGGGTGGGCAAGG - Intronic
977568731 4:98608876-98608898 AAGAGTTTACAGGGTGTGGTGGG - Intronic
979938759 4:126732247-126732269 GAGAGTGCACGGGGGGTGGAGGG - Intergenic
980537760 4:134150707-134150729 AAGAATGCCAAGGGTGGGGGAGG - Intergenic
981291360 4:143080207-143080229 AAGAGGGTCCTAGGTGTGGAAGG - Intergenic
982259138 4:153479105-153479127 AAGACTGCCCAAGGTGGGGCTGG + Intronic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
985839721 5:2297284-2297306 AACAGTGCTCAGACTGTGGATGG - Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
986471528 5:8081298-8081320 CAGAGTGCACAGAGTGTGCAGGG + Intergenic
986723706 5:10578573-10578595 GAGAGGGCCCATGGGGTGGAGGG + Intronic
986916321 5:12625023-12625045 CAGTGTCCCCAGGGTGTGCAGGG - Intergenic
987887736 5:23832352-23832374 GTGATTGCTCAGGGTGTGGAAGG - Intergenic
988528731 5:32008948-32008970 AAGAGTCCAAAGGGTTTGGAAGG + Intronic
989153495 5:38322329-38322351 ATGAGTACCCAAGGAGTGGATGG + Intronic
989180955 5:38576423-38576445 AAGAGTGCCAAGGTTGAGCAAGG - Intronic
990422924 5:55654620-55654642 AAAAGAGCACAGGCTGTGGATGG + Intronic
991589143 5:68230891-68230913 AAGAGTGTGCTGGGTGTGCAAGG + Intronic
991965031 5:72082234-72082256 TCTAGTGCCCAGGGTGTGGTGGG - Intergenic
994002338 5:94794913-94794935 AACAGTGCCCAGGGAGAGGTGGG + Intronic
995517438 5:112968099-112968121 AAGAGTGATCAGGCTGGGGATGG - Intergenic
996540812 5:124628979-124629001 AGGTGTGCTCAGGGTGTGGTGGG - Intergenic
996757229 5:126947773-126947795 AAGATTGGCCAGGGTGAGGTAGG - Intronic
997297056 5:132775033-132775055 CAAAGTGCAGAGGGTGTGGAAGG + Intronic
998585032 5:143418619-143418641 AAGAGGGCACAGGGTGTGAAGGG + Intronic
999237558 5:150108142-150108164 AAGAGTGCACAGGGTATGGGAGG + Intronic
999247892 5:150165131-150165153 CACAGAGCCCAGTGTGTGGAAGG + Intergenic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
999641085 5:153673913-153673935 AAAAGAGCACAGGGTGAGGATGG + Intronic
1000998337 5:167981209-167981231 CAGACTGCCCTGGGTGGGGATGG - Intronic
1001279949 5:170379527-170379549 AAGAATTGCCAGGGTGTGGCAGG + Intronic
1001473831 5:172035268-172035290 AAGAGAGCCTCAGGTGTGGACGG + Intergenic
1001568505 5:172715447-172715469 AAGCCTGCCCAGGCTGTGGTGGG + Intergenic
1002028448 5:176411508-176411530 AGGGGTGCCCAAGGGGTGGATGG - Intronic
1003168642 6:3703033-3703055 CAGAGTGCACAGGGTTTGCAGGG + Intergenic
1003967181 6:11264077-11264099 CAGAGTTCCCCGGATGTGGAAGG + Intronic
1004014552 6:11720161-11720183 AAGGGGGCTCAGGCTGTGGAAGG + Intronic
1005496869 6:26395424-26395446 GTGAGAGTCCAGGGTGTGGATGG - Intergenic
1005879469 6:30044350-30044372 AACAGTGCCTAGGGTGGGAAAGG + Intergenic
1005906498 6:30265517-30265539 GAGAATGCCCAGGATGGGGAGGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007377854 6:41468691-41468713 CAGAGTCCCCAGGAAGTGGAGGG - Intergenic
1007480384 6:42145799-42145821 AAGGTTGGCCAAGGTGTGGAAGG + Intergenic
1007840031 6:44708587-44708609 AAGAGGGCGGAGGGTGTGGGTGG - Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1009701326 6:67185732-67185754 AAGAGAACCCAGGGTTTTGAAGG + Intergenic
1014744469 6:125183550-125183572 AAGAGTGCCCAGTCCGTGAAGGG + Intronic
1014947301 6:127514619-127514641 AAGAGTGCAGAGTGTGTGGAGGG - Intronic
1016367727 6:143337411-143337433 GAGAATGCCAAGGGTGTGGCTGG - Intronic
1018302509 6:162418764-162418786 AGGAGTGCCCTGGGTGTGCTTGG - Intronic
1021783552 7:24130273-24130295 AAGAGTGCCCATGGTGGGAGAGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022729673 7:33010536-33010558 GAGAGGGAACAGGGTGTGGAAGG - Intergenic
1023394880 7:39743518-39743540 AATACTGCCCAGTGTGGGGAAGG + Intergenic
1024253702 7:47524316-47524338 AAAACTGCCCAGGGTGTGAGTGG + Intronic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1026914441 7:74111613-74111635 AAGAATGGCCAGGGTGGGGCCGG - Intronic
1028830287 7:95320369-95320391 AAGGGAGCCCAGGGTGGGCAAGG + Intronic
1028918546 7:96286406-96286428 CAGAGTGCCACAGGTGTGGAGGG - Intronic
1031266977 7:119593307-119593329 AAGGGTGTCCAGTGTGTGGGAGG + Intergenic
1031992681 7:128208288-128208310 AGAAGTGTCCATGGTGTGGAAGG - Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032258786 7:130317937-130317959 AGGAGGGCCCGGGGGGTGGATGG - Intronic
1033119952 7:138658927-138658949 TAGAGTGCCCTGGCTGAGGAGGG - Intronic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1033464289 7:141577107-141577129 TAGAGTGCCCTGGCTGAGGAGGG - Intronic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1035129951 7:156642388-156642410 ATGAGTGACCGGGTTGTGGAGGG + Intronic
1035329033 7:158084627-158084649 ATGAGTGTCGTGGGTGTGGATGG - Intronic
1035329051 7:158084703-158084725 ATGAGTGTCGTGGGTGTGGATGG - Intronic
1035908203 8:3536750-3536772 AAAAGTGTCCATTGTGTGGAAGG + Intronic
1037539346 8:19856300-19856322 GAGAGTGCCCAGCGTGTGCCTGG - Intergenic
1037808034 8:22069287-22069309 AACATTGCCCTGGGTTTGGAGGG + Intronic
1038306908 8:26413245-26413267 AACAGTGCTCAGGGTGTGAACGG + Intronic
1038443129 8:27585472-27585494 AAGGCTTCCCAAGGTGTGGAAGG + Intergenic
1040676660 8:49758061-49758083 GAGAGTCCCCAGTGTGGGGAGGG - Intergenic
1040699144 8:50039869-50039891 TTGACTGCCCGGGGTGTGGAGGG + Intronic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1041711023 8:60894691-60894713 AAGAGTCCCAAGGCTGTGCAGGG - Intergenic
1043772208 8:84218810-84218832 GATAGTGCCCAGCGTGTGGTTGG + Intronic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1047725429 8:127679950-127679972 AAGAGGACTCAGGGTGGGGAAGG + Intergenic
1049000596 8:139823418-139823440 CAAGGTGCCCAGGGTGTGGGTGG + Intronic
1049250368 8:141585373-141585395 AAGAGGAGCCAAGGTGTGGATGG + Intergenic
1049408160 8:142460803-142460825 GAGAGTGCTCAGGAGGTGGAAGG - Intronic
1049658486 8:143809288-143809310 AAGAGAGTCCAGGGTGGGGGTGG + Intronic
1049742373 8:144247311-144247333 GAGAAGGCCCAGGTTGTGGAAGG - Exonic
1050457402 9:5847074-5847096 AAGAATGCCCAGGGGATGGAGGG + Intergenic
1051818165 9:21133939-21133961 GAGTGTGCTCTGGGTGTGGAAGG - Intergenic
1055429107 9:76226124-76226146 AACAGAGCCCGGGGTGTGCAGGG + Intronic
1055629787 9:78212018-78212040 AAGAGTGCCGAGGTTACGGAAGG + Intergenic
1056606693 9:88091499-88091521 AAGAGTGCCCAGGGTATATCAGG + Intergenic
1056680178 9:88710574-88710596 AAGGGAGTACAGGGTGTGGAGGG + Intergenic
1056834805 9:89945619-89945641 ATGAGTGCACAGGAAGTGGAGGG + Intergenic
1057177973 9:93013160-93013182 AAGTGGGCACAGGGTGTGGGGGG - Intronic
1060197438 9:121632683-121632705 AGGAGTTCCCAGGGTCGGGAAGG + Intronic
1060279404 9:122205941-122205963 AGCAGTGGCCAGGGTGGGGAAGG - Intronic
1060860885 9:126954019-126954041 AAGTGTGGGCAGTGTGTGGAGGG - Intronic
1061941591 9:133887007-133887029 AGGAGGGCCCGGGGTGGGGAGGG - Intronic
1061999886 9:134210647-134210669 AACAGAGCCCAGGCTGGGGAGGG + Intergenic
1062070494 9:134552775-134552797 GATGGTGCCCAGGGTGTGGCTGG - Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1190258967 X:48786376-48786398 AAGAATCCCCAGGGTGGGCAGGG + Intergenic
1190268070 X:48840915-48840937 AAGTGTGCGCAGGGTGCGGCTGG - Intergenic
1194138234 X:90174671-90174693 CACAGTGCCAAGAGTGTGGAGGG + Intergenic
1194601174 X:95923631-95923653 GAGAGTGCCCAAAGTGTGTAAGG + Intergenic
1195942654 X:110178523-110178545 AAGACTGCCCAGGGTAGGGATGG - Intronic
1200484031 Y:3744911-3744933 CACAGTGCCAAGAGTGTGGAGGG + Intergenic
1200637139 Y:5669965-5669987 ATGATTACCCAGGGTGGGGAAGG - Intronic
1202025475 Y:20518303-20518325 AAGAGTGCTCTGGCTGTAGAGGG - Intergenic