ID: 961797882

View in Genome Browser
Species Human (GRCh38)
Location 3:129422805-129422827
Sequence CTGTGAGACAAAAAGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961797882_961797887 6 Left 961797882 3:129422805-129422827 CCCCATTCCTTTTTGTCTCACAG 0: 1
1: 0
2: 2
3: 47
4: 389
Right 961797887 3:129422834-129422856 CATTTTCTTTATTAAGTCCTCGG 0: 1
1: 0
2: 9
3: 114
4: 1127
961797882_961797889 12 Left 961797882 3:129422805-129422827 CCCCATTCCTTTTTGTCTCACAG 0: 1
1: 0
2: 2
3: 47
4: 389
Right 961797889 3:129422840-129422862 CTTTATTAAGTCCTCGGTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 163
961797882_961797888 11 Left 961797882 3:129422805-129422827 CCCCATTCCTTTTTGTCTCACAG 0: 1
1: 0
2: 2
3: 47
4: 389
Right 961797888 3:129422839-129422861 TCTTTATTAAGTCCTCGGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961797882 Original CRISPR CTGTGAGACAAAAAGGAATG GGG (reversed) Intronic
900634962 1:3658439-3658461 CTCTGTGACAGAAAGGAAAGGGG + Intronic
901533260 1:9866818-9866840 CTGTGAGACAAGAGTGAATATGG + Intronic
901657080 1:10775563-10775585 CTTTGAGCCAAAAAGGAACCAGG - Intronic
903666626 1:25011939-25011961 GTGTGAGACAAGAAGGAGGGGGG - Intergenic
904419825 1:30384418-30384440 CTGTGAGTCAGCAAGGATTGTGG - Intergenic
905299342 1:36975865-36975887 CTGGGATACAGAAAGGAATGGGG - Intronic
906800136 1:48729895-48729917 CTGAGAGACAAGAAGGTAGGAGG + Intronic
907653634 1:56320554-56320576 CTGAGGGAGAAAAAGGAGTGGGG - Intergenic
908313333 1:62907542-62907564 TTATGAGAGAAAAAGGAAAGGGG + Intergenic
909257588 1:73444200-73444222 CTGTGAGACTTAAAAGTATGAGG - Intergenic
909748112 1:79124846-79124868 CAGTGAGGCAAAATGGAATGAGG + Intergenic
910428190 1:87136274-87136296 CTGTGAGACAACACGTTATGGGG + Intronic
911215239 1:95185926-95185948 TTGAGAGACAAAAGTGAATGAGG + Intronic
911745759 1:101440227-101440249 CTATAAGGCAAAATGGAATGTGG - Intergenic
912379914 1:109241756-109241778 CTCTGAGACAAGATGGAAGGAGG - Intergenic
913586099 1:120277367-120277389 CTATAAGACCAAAAGGAGTGTGG - Intergenic
913622087 1:120621002-120621024 CTATAAGACCAAAAGGAGTGTGG + Intergenic
914568108 1:148889225-148889247 CTATAAGACCAAAAGGAGTGTGG - Intronic
914604716 1:149241024-149241046 CTATAAGACCAAAAGGAGTGTGG + Intergenic
914920630 1:151844944-151844966 CTCTGAGACTGAAAGGAAGGAGG - Intergenic
915484845 1:156213051-156213073 CTGTGAGGAAAAAAGGCATGAGG + Exonic
915691193 1:157692582-157692604 ATGTGATACAAAAAGGTTTGAGG - Intronic
915743120 1:158134896-158134918 CTGAGATAGAAAAAGGAAAGAGG - Intergenic
917158872 1:172034969-172034991 CCGTGAGTGAAAAAAGAATGTGG + Intronic
918511596 1:185318579-185318601 CTGTGAGAAAAAAAGGGGCGGGG - Intergenic
918556182 1:185802039-185802061 CTGAGAGATAAAAAGGACTAAGG + Intronic
918686061 1:187417364-187417386 CTCTGGGAAAAACAGGAATGGGG + Intergenic
919293638 1:195666273-195666295 CAGAGAGACAAAGAGGAAGGTGG + Intergenic
920501992 1:206491293-206491315 GTGTGAGACAAAAAGGGGTCGGG - Exonic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
921134822 1:212250624-212250646 CTGTGAGACAAAGAGAAAGATGG - Intergenic
921398168 1:214691084-214691106 CTCTGAGACAATAAGTAATTAGG - Intergenic
921812545 1:219531032-219531054 CTGGGAGATAAAAACGAATGAGG + Intergenic
922100968 1:222476593-222476615 CTGGGAGACAAGCAGGAATCTGG + Intergenic
922391774 1:225151007-225151029 CAGTGAGATAAAAAGCAAAGTGG + Intronic
923496741 1:234531956-234531978 ATGTGAGCCAAATAGAAATGAGG + Intergenic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063152460 10:3349611-3349633 CTGGAAGAAAAAAAGGAATGCGG + Intergenic
1063212090 10:3890077-3890099 CTGTGACAAAAAAAGGATTGAGG - Intergenic
1063759093 10:9051871-9051893 CTGTGAGAGAGAAAGCCATGGGG - Intergenic
1063825300 10:9890724-9890746 CTGTGAGAGAAAAAGGAGAGAGG - Intergenic
1063852755 10:10211702-10211724 CTGTGAGACAAAAATCTATCTGG - Intergenic
1063938382 10:11102809-11102831 ATGAGAGAGAAAAAGGAGTGAGG - Intronic
1064308768 10:14192501-14192523 CTGCAAGAATAAAAGGAATGTGG - Intronic
1064382419 10:14858279-14858301 CTGTGAGAGATAATGAAATGAGG - Intronic
1064795436 10:19006815-19006837 CTCTTAGACAAAAAGGAAGAAGG + Intergenic
1066329180 10:34399414-34399436 CTGTGAGACAATGATGAATGAGG + Intronic
1066512020 10:36111005-36111027 ATGGAAGACAAATAGGAATGAGG - Intergenic
1066680961 10:37936760-37936782 CTATAAGTCAAAAAGGAAGGGGG + Intergenic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1069177300 10:65308776-65308798 CTTTCAGACTAAAAGGAAGGAGG - Intergenic
1069290883 10:66778335-66778357 CTTTGAAAAAAGAAGGAATGAGG - Intronic
1069830330 10:71278966-71278988 AGGTGAGACAAACAGGAAGGGGG - Intronic
1070573393 10:77658671-77658693 CTGTGAGAAAAAAAGCTCTGTGG + Intergenic
1070787478 10:79170386-79170408 CTCTGTGGCTAAAAGGAATGGGG - Intronic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071853604 10:89600624-89600646 CTGTGAGACAAAAATGTACAGGG + Intronic
1072767298 10:98105862-98105884 CTCTCAGACTACAAGGAATGAGG + Intergenic
1073122048 10:101127982-101128004 TGGTGAGACTAAAAGGAGTGAGG + Intronic
1073144975 10:101274533-101274555 CTGAGAGAAGAAAAGGGATGGGG + Intergenic
1078310573 11:10237059-10237081 CTGACAGGCACAAAGGAATGTGG + Intronic
1079692593 11:23438508-23438530 CTGAAAGACCAAAAGGAAAGTGG + Intergenic
1079743356 11:24093093-24093115 CTGTGACACAAAAGTGAAAGCGG + Intergenic
1080153747 11:29083586-29083608 TTGTGACAGAAAAAGTAATGGGG + Intergenic
1081343244 11:41952977-41952999 CTCAGAGGGAAAAAGGAATGAGG + Intergenic
1083059620 11:59856325-59856347 CTGGGATACAGAAATGAATGTGG - Intronic
1084576788 11:69993803-69993825 CTGGGGGAGAAAAAGGAATCTGG - Intergenic
1085291879 11:75406621-75406643 TTATGAGTCAAAAAGGAAGGGGG - Intronic
1086570242 11:88275360-88275382 CTGTGATACTGAAAAGAATGAGG + Intergenic
1086658841 11:89389874-89389896 CGGTGACACAGAAAAGAATGTGG - Intronic
1086815597 11:91366776-91366798 CAGTGACAGAGAAAGGAATGTGG - Intergenic
1086990309 11:93295734-93295756 TTGTGGGAGAAAGAGGAATGTGG - Intergenic
1087111778 11:94477754-94477776 GTCTGAGAGAAAAAGCAATGCGG + Intronic
1088083103 11:105944386-105944408 CTGTGAGACATGAAGGAGAGTGG - Intronic
1089365717 11:117919815-117919837 CTCAGAGACAAATAGGCATGGGG - Intronic
1089645780 11:119877852-119877874 CTCAGAGGCAAAAAGCAATGAGG - Intergenic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1090979684 11:131708450-131708472 ATGTAAGACAAAAAGCAATTTGG + Intronic
1091142780 11:133250363-133250385 CTTTCAGCCAAAAAGAAATGAGG + Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1093011478 12:14111748-14111770 TTGTGAGACATAAAGGTAAGTGG - Intergenic
1093448157 12:19283821-19283843 ATGTGAGAGACAAAAGAATGGGG + Intronic
1093960077 12:25262649-25262671 CTCTGAGACACAAATGATTGAGG - Intergenic
1095295433 12:40521954-40521976 CTGTGAGTGAAAAAGCAATGTGG - Intronic
1095297359 12:40542251-40542273 CTGTGAGATAGAAAGGAGGGGGG - Intronic
1095349830 12:41196210-41196232 CTGTAAGATAAAAAGTAAGGAGG + Intronic
1095924101 12:47561335-47561357 CTCTAAGACAAAAACAAATGAGG + Intergenic
1096092800 12:48914559-48914581 GTTTGAGACAGAAAGGTATGGGG + Exonic
1096770604 12:53933805-53933827 CTGTGAAAGAAAGAGGACTGGGG + Intergenic
1096841951 12:54385214-54385236 TGGTGAGACAAAAGGGCATGGGG - Intronic
1096928231 12:55173222-55173244 CTGAGAAACAAAAGGGAAAGAGG - Intergenic
1098984492 12:76997074-76997096 GTGTGAGACAGAGAGAAATGAGG - Intergenic
1099602584 12:84760477-84760499 CTCTGATACATAGAGGAATGAGG - Intergenic
1099791917 12:87346609-87346631 CTTGGAGACAAAATAGAATGAGG + Intergenic
1099902775 12:88733360-88733382 CTTTGAGATAGAAAGGAAAGAGG - Intergenic
1100262359 12:92944769-92944791 CTGTGAGGTAAAAAGTAATGAGG + Intergenic
1100932580 12:99626986-99627008 TTGTGAGAGAAAAGGGAAAGTGG - Intronic
1100939766 12:99713396-99713418 CTGTTAAACAAAAAGGAACTAGG - Intronic
1101294150 12:103403416-103403438 CTGTCATCCCAAAAGGAATGTGG + Intronic
1101492742 12:105224329-105224351 CTGGGATACAAAAAGGAACTGGG + Intronic
1101576472 12:106001799-106001821 CTGTGAAAAGAAAAGGAGTGGGG + Intergenic
1101787703 12:107899982-107900004 CTGCTAGAGAAAAACGAATGGGG - Intergenic
1102630321 12:114272738-114272760 CTGAGAGAATAAAAGGAATTTGG - Intergenic
1103298697 12:119910121-119910143 CTGTGACACAAAGAATAATGAGG + Intergenic
1103408823 12:120695954-120695976 GTGTGAATCAAAAGGGAATGTGG + Intronic
1103680307 12:122688692-122688714 CTGTGAGACAAAAGAGACAGGGG - Intergenic
1104104519 12:125646317-125646339 CTATGAGACAAAAAGAAACAGGG + Intronic
1104647939 12:130510218-130510240 CTGTGGGACAAATAGGATTTAGG - Intronic
1104668885 12:130667096-130667118 ATGGGAGAAAAAAAGGAATGAGG + Intronic
1104870726 12:131993530-131993552 ATGTGAGAAAATAAGGAAAGCGG - Intronic
1105631961 13:22178255-22178277 CCGTGAGACAAAAGAGAGTGAGG + Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1107024700 13:35788029-35788051 ATGGGTGAAAAAAAGGAATGAGG + Intronic
1107347806 13:39481669-39481691 CTGTAACACAAAAAGGAAGGGGG + Intronic
1107573003 13:41683452-41683474 CACTGACACAAAATGGAATGGGG + Intronic
1108231187 13:48343873-48343895 CTATGATACAGAAAGGAATGGGG - Intronic
1108238869 13:48440340-48440362 CTGTGAGGCAAAGAGGAGGGAGG + Intronic
1109008100 13:56904015-56904037 CTGTGTGACAATATGTAATGTGG + Intergenic
1109951678 13:69508690-69508712 CTGTGAGACAGAAAAGTATATGG + Intergenic
1110012522 13:70355668-70355690 TAGTGTGACAAAAATGAATGGGG + Intergenic
1110184866 13:72661566-72661588 CTGTGACATTAAAAGGAATCAGG + Intergenic
1110568657 13:76980865-76980887 TTGTGAGACAAAATGTCATGAGG - Intergenic
1111488290 13:88934031-88934053 AAGTGAGAAAAAAAGAAATGTGG + Intergenic
1112569295 13:100579515-100579537 CTGTTATACAGAAAGGCATGGGG - Intronic
1114349368 14:21834029-21834051 CTCTGAGACAAAGAGCAATTTGG - Intergenic
1114455597 14:22851342-22851364 CTGTAAGTCACAAAGGAATAAGG - Intergenic
1115085301 14:29508140-29508162 CTGTGATTCTACAAGGAATGAGG + Intergenic
1115091102 14:29576769-29576791 ATGTGGGAAAAAAATGAATGAGG - Exonic
1115198208 14:30824998-30825020 CTGTGAGACAAAGAGATATGAGG + Intergenic
1115652495 14:35413034-35413056 GTGTGAGAAAAGAGGGAATGGGG + Intergenic
1116914130 14:50505639-50505661 TTGTGAGACCAAAAGGTATGTGG + Intronic
1117210671 14:53495651-53495673 AAGTGAGAAAAAAAGGGATGTGG + Intergenic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1118102764 14:62624994-62625016 CTGTGAGAGAAAAAAGGAAGAGG - Intergenic
1118475831 14:66116046-66116068 CTGTGGGACAAAAATTGATGAGG - Intergenic
1118518566 14:66554259-66554281 CAGTGAGACAAGTAGGACTGTGG + Intronic
1119598999 14:75962020-75962042 ATTTAAGACAAGAAGGAATGAGG - Intronic
1120021083 14:79530994-79531016 CTGGGAGATAAAAGGAAATGGGG - Intronic
1122830695 14:104394206-104394228 CTCTGAGACACAGAGGCATGGGG - Intergenic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1125544678 15:40494395-40494417 CTGTAAGAGAAAGAGGACTGGGG - Intergenic
1126123328 15:45272798-45272820 GTGTGTGAGAGAAAGGAATGGGG - Intronic
1127879634 15:63145408-63145430 CTGTGAGACAATAAGCTTTGGGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128131672 15:65231834-65231856 ATGAGAGACAAGAAGGAATATGG - Intergenic
1128595260 15:68940248-68940270 AAGTGAGAGGAAAAGGAATGTGG - Intronic
1129624922 15:77187116-77187138 CTTTGAGATTATAAGGAATGTGG - Intronic
1130809850 15:87365384-87365406 CTGTGGTACAAAAGGGATTGGGG + Intergenic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1134054484 16:11160948-11160970 CAGTGAGATAGAAATGAATGTGG - Intronic
1135596713 16:23749821-23749843 CTCTGGGACGAAAAGTAATGAGG - Intergenic
1137724558 16:50648215-50648237 CTGTGAGAAGGACAGGAATGAGG - Intergenic
1138484107 16:57325052-57325074 ATGTGAGAGAAAAGGGAAGGAGG + Intergenic
1144009234 17:11130226-11130248 CTGTGAGACAAAATAGGAAGGGG + Intergenic
1146128545 17:30249639-30249661 GTGTGTGATAGAAAGGAATGGGG - Intronic
1146238401 17:31189310-31189332 CTAGGAGACAAAAAGGAACAAGG - Intronic
1146297664 17:31662256-31662278 CTGTGAACAAAAAAGGACTGAGG - Intergenic
1146601922 17:34224743-34224765 TTGTGCCACAAACAGGAATGAGG - Intergenic
1147180728 17:38683908-38683930 CTTTGAGAGACAAAGGAAAGAGG + Intergenic
1149643446 17:58220371-58220393 CTGTGAGGCAAACTGGAAGGTGG - Intronic
1150159522 17:62883992-62884014 CTGTGAGAAATAAAGGTCTGTGG + Intergenic
1150306405 17:64089016-64089038 CTCTGAGAAAAAGAGGAATGTGG + Intronic
1150430351 17:65110693-65110715 CTGCAAGACAAAAAAGAAGGAGG - Intergenic
1151744133 17:76002422-76002444 TTGTGAGACAAAGAGGAGAGAGG + Intronic
1152332594 17:79681723-79681745 ATGTGAGCCAGAAAGGAGTGGGG + Intergenic
1153550838 18:6260053-6260075 CTGACAGAAAAAAAGCAATGGGG - Intronic
1153693474 18:7616651-7616673 ATGGGAGACAAAGAGGAAAGAGG - Intronic
1155422310 18:25668448-25668470 CTATGAGAGAAAAAGGAAAGGGG + Intergenic
1155553322 18:26990676-26990698 GAATGAGACACAAAGGAATGAGG - Intronic
1156695612 18:39762597-39762619 ATGTGGCATAAAAAGGAATGAGG + Intergenic
1157402061 18:47396827-47396849 CTGTCAAATAAAAGGGAATGGGG - Intergenic
1158533454 18:58284499-58284521 TTGTGAGACAAAAAGCTTTGTGG + Intronic
1158572099 18:58605049-58605071 CTGTGAGACTAAAATTAATCAGG + Intronic
1159688674 18:71457912-71457934 CTGTGAGAATAAATGGAGTGGGG - Intergenic
1159951834 18:74489800-74489822 CTGTGAGAAAAAAATGCCTGTGG - Intergenic
1160129539 18:76212521-76212543 CTGTGAAGCATAAAGGGATGAGG - Intergenic
1160273147 18:77406101-77406123 CTCTTAGACAAAGAGGAAAGAGG - Intergenic
1160388893 18:78515436-78515458 CTCTGAGCCAGAAGGGAATGTGG - Intergenic
1160888043 19:1361172-1361194 GAGACAGACAAAAAGGAATGAGG - Intronic
1160961343 19:1722613-1722635 CTCAGCCACAAAAAGGAATGAGG + Intergenic
1161235272 19:3194712-3194734 CTGTTAGAGAAGAAGGAAAGAGG + Intronic
1163285984 19:16348214-16348236 CTGGGAGACAAAACGCAATGGGG + Intergenic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1165786335 19:38463969-38463991 TTGTGAGACATAAACAAATGGGG + Intronic
1166922792 19:46242049-46242071 CTCTCAGAAAAATAGGAATGGGG - Intergenic
1168169469 19:54576175-54576197 CTCTGGGACAATAATGAATGAGG + Intronic
1168364082 19:55769934-55769956 CTGTGAGAGAAAAATAGATGAGG - Intronic
1168547040 19:57261494-57261516 CTACGGAACAAAAAGGAATGGGG - Intergenic
1168589576 19:57621691-57621713 CTGTCATACAGAAGGGAATGAGG - Exonic
926042724 2:9687422-9687444 CTGTGGTACAAAAGGAAATGAGG + Intergenic
926832425 2:16978280-16978302 CTGTGAGAAAGAAATGACTGTGG - Intergenic
927855998 2:26528299-26528321 CAGGGAGACAGCAAGGAATGTGG + Intronic
928737511 2:34309292-34309314 CTGAGAAAAAAAAAGCAATGGGG - Intergenic
929162168 2:38843211-38843233 CTGAGAAAGACAAAGGAATGTGG + Intronic
929197820 2:39204707-39204729 CTATGAGATAAAAACAAATGTGG + Intronic
931128295 2:59302311-59302333 CTGTTAGCAAAAGAGGAATGGGG + Intergenic
931207634 2:60163581-60163603 CTGTGATACAAAAAGAAAGGAGG - Intergenic
931243973 2:60477701-60477723 CTGTGAGAGACAAGGGAGTGGGG + Intronic
931452381 2:62379147-62379169 CTGAGATACAGAAAGCAATGGGG + Intergenic
931571937 2:63678460-63678482 CAGGAAGACAAAAGGGAATGGGG + Intronic
932642961 2:73468574-73468596 ATATGAGACAAAAAGGAAAATGG - Intronic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
936341759 2:111639971-111639993 TTATGTGACAAAAAGGAATAAGG + Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
937648630 2:124295519-124295541 CTGGGAGACAAAATTGAGTGTGG + Intronic
938509372 2:131924888-131924910 CTGATAGAAATAAAGGAATGTGG + Intergenic
938909549 2:135874007-135874029 TTGTAAGACAAACAGGAAAGAGG + Intronic
939833434 2:147100003-147100025 CTGTGACACAGAGATGAATGTGG - Intergenic
941925045 2:170885963-170885985 CTGAGAGTGAAAAAAGAATGTGG - Intergenic
942585808 2:177475632-177475654 CAGTTATAAAAAAAGGAATGAGG - Intronic
942612654 2:177757915-177757937 CATTGAGACTAAAAGGAATTAGG - Intronic
942825286 2:180168392-180168414 CTGTGCCACAAAAAGTAGTGCGG - Intergenic
942848950 2:180459900-180459922 ATGTGAGAAAAATAGAAATGTGG + Intergenic
947532375 2:230919766-230919788 CTATTAGAAAAAAAGTAATGTGG - Intronic
947697750 2:232206495-232206517 TTGTGACACAAAAATGATTGTGG - Intronic
1168777352 20:459037-459059 CTGTGACATAAAAAGGGAAGAGG + Intronic
1169722542 20:8694440-8694462 TTGTGAGATGCAAAGGAATGTGG - Intronic
1170981183 20:21214466-21214488 CTTTGAGACCAAGAGGAATGTGG + Intronic
1171983911 20:31646069-31646091 CTGTGAGAGATAAAGGAGAGAGG + Intergenic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1172994445 20:39059629-39059651 CTGGGAGAAAAAAACCAATGGGG + Intergenic
1173431453 20:42990934-42990956 TTGTTATACAAAAAGGAAAGAGG + Intronic
1173801207 20:45895629-45895651 CTGTGAAACAACAACCAATGTGG - Intronic
1174185993 20:48706789-48706811 CTTTTAAGCAAAAAGGAATGAGG + Intronic
1174701024 20:52609575-52609597 GTGGGAAACAAAAATGAATGAGG - Intergenic
1174804022 20:53591732-53591754 TTTTCAGACAAAAAGCAATGAGG + Intronic
1174842613 20:53914455-53914477 TTGTGAGGCACTAAGGAATGGGG - Intergenic
1176784113 21:13233672-13233694 CTGATAGAAATAAAGGAATGTGG - Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177086154 21:16707248-16707270 GTGTGAGAAAAAAAGCAATAGGG + Intergenic
1177474924 21:21607617-21607639 CTGTGAGAAAAAAGTGCATGAGG - Intergenic
1178026522 21:28474601-28474623 CTGAGATACCAAAAGGAATGGGG - Intergenic
1178363922 21:31972750-31972772 TTTTGTGACAAACAGGAATGAGG + Intronic
1179027754 21:37694007-37694029 CTGTTAGACAAAAAGGCTAGGGG - Intronic
1179071886 21:38079135-38079157 CACTGAGACTAAAGGGAATGGGG + Intronic
1179457530 21:41509209-41509231 CTGAGTGACAGAAAGAAATGGGG - Intronic
1179459069 21:41521423-41521445 CTGGGTGACAGAAAGGAATGGGG + Intronic
1180904178 22:19396948-19396970 CTGTGAAGAAAAAAGGAATGTGG + Intronic
1182034415 22:27186437-27186459 CTGTTGGAAAAAAAGAAATGTGG + Intergenic
1183089974 22:35515486-35515508 GTGTGAGAAAAAAAGGGAGGGGG + Intergenic
1183534999 22:38396080-38396102 TTTTCAGACAAAAAGCAATGAGG + Intronic
1184262964 22:43329773-43329795 CTTTGAGACAAAGAGGACTCGGG - Intronic
949868006 3:8562592-8562614 CTGTGAGATAAATAGGAATGTGG + Intronic
950562448 3:13742114-13742136 CTGTGAGAGGAAAACAAATGAGG - Intergenic
950939779 3:16882119-16882141 CAGAGAGACAAGCAGGAATGAGG + Intronic
952489381 3:33851796-33851818 CTGGGAGAGGAAAAGGAAAGAGG - Intronic
952526845 3:34219686-34219708 CTCAGAGACAAAATGAAATGAGG - Intergenic
954203151 3:49037402-49037424 CTGTAAGACAAAAGGGAGGGGGG + Intronic
955937469 3:64115014-64115036 CTGTAAGCCAGAAAAGAATGGGG + Intronic
956193619 3:66630822-66630844 ATGTAAGACAGAAAGGTATGAGG - Intergenic
956335293 3:68156293-68156315 CTGGGAAATAAGAAGGAATGAGG + Intronic
956380844 3:68662887-68662909 CTGTGAGACATAAATGTGTGTGG + Intergenic
957420813 3:79967476-79967498 ATGTAAAACTAAAAGGAATGTGG + Intergenic
958001973 3:87761929-87761951 CTGTGGGACAACATGGAATTCGG - Intergenic
958505291 3:94968963-94968985 ATGGGAGATAAAAAGGAAGGGGG - Intergenic
958696945 3:97539715-97539737 CTGTGATATGAAAAGGATTGTGG + Intronic
960520323 3:118647179-118647201 CTGTCAGAAAACAAAGAATGAGG - Intergenic
961486238 3:127218702-127218724 CTGTGAAACAAAGAGTAAGGAGG - Intergenic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
962723940 3:138203556-138203578 CTGTTAGAGAAAAAGGGAGGGGG + Intronic
962789860 3:138801485-138801507 CTTTGAGACACTAAGGAAGGAGG + Intronic
963391699 3:144673235-144673257 CTGGGAGACAATGAGGGATGGGG - Intergenic
963578877 3:147099216-147099238 TTGGGAGAAAAAAATGAATGTGG + Intergenic
963920552 3:150900946-150900968 CAGAGAGACAAAAAGGTATGTGG + Intronic
964540352 3:157772776-157772798 CTGTAAGACAAAATGAACTGTGG + Intergenic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
964595829 3:158426823-158426845 AAGGGAGCCAAAAAGGAATGGGG + Intronic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
967398028 3:189028471-189028493 GTGGGAGACAAAGAGGAATTAGG + Intronic
970153302 4:13114459-13114481 TTGTGAAACAAAAATGAAAGTGG + Intergenic
970169900 4:13278980-13279002 CTGTGAGGCAAAAGGAAATGAGG - Intergenic
970736489 4:19175578-19175600 CTGTGACATAAACAAGAATGAGG - Intergenic
971460450 4:26890256-26890278 CTGGGAGAGAGAAGGGAATGTGG + Intronic
972385586 4:38562643-38562665 ATTTGAAACAAAAATGAATGGGG - Intergenic
973258325 4:48135750-48135772 CAGGTAGACAAGAAGGAATGTGG + Intergenic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
974170688 4:58263277-58263299 CTGAGATACACAAAGGAATAGGG + Intergenic
974216046 4:58848922-58848944 CTGTGACACAACAAAAAATGGGG + Intergenic
974437224 4:61871428-61871450 TTGTGCGATCAAAAGGAATGAGG + Intronic
975510370 4:75188274-75188296 CTGTGAGCCATAAAGGCAAGAGG + Intergenic
975541468 4:75516539-75516561 ATGTGAGAAAAAATGAAATGAGG + Intronic
976564123 4:86533926-86533948 CTGTGAGATAAACAGGAAAATGG - Intronic
976809473 4:89085375-89085397 CTGCCAAAAAAAAAGGAATGGGG - Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
977676535 4:99754615-99754637 CTGAGAGCCAAAAAGGAAAATGG + Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978542595 4:109834643-109834665 CTGTGACAGAAAAAAAAATGGGG - Intronic
979113062 4:116783091-116783113 CTGTGGGACAGAAAGGAAAGAGG - Intergenic
979459016 4:120959103-120959125 CTTTGAGAAAAAAAGCGATGTGG + Intergenic
981114796 4:140976962-140976984 CGGAGAGACATAAAGGTATGAGG - Intronic
983000072 4:162403295-162403317 CTGGGAGACAATAATAAATGAGG - Intergenic
984051172 4:174867129-174867151 CTGTGAAGCAAAAAGGAACGAGG + Intronic
984073840 4:175150595-175150617 ATGTGAGACAGAAAGGGAAGGGG - Intergenic
984164333 4:176289258-176289280 GTGTGACACAAGAGGGAATGAGG - Intergenic
984409160 4:179372708-179372730 CTGTTAAACAAAAAGGAATCAGG - Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
986084090 5:4425670-4425692 CTGTGTAACACAAAGGAATGAGG + Intergenic
988090927 5:26540765-26540787 CTGTGAGTTTAAAAGGAATAAGG + Intergenic
988385008 5:30551619-30551641 CAGAGAGAGAAAAAGGAATGGGG + Intergenic
989176948 5:38537278-38537300 CCTTGAGACCAAAGGGAATGTGG - Intronic
990833512 5:59987436-59987458 CTGTGTTAGAAAAAGGTATGAGG - Intronic
990915638 5:60901631-60901653 CTGTGAGACTAAATGGAAAGAGG - Intronic
991059003 5:62351350-62351372 TTATGAGAAAGAAAGGAATGGGG + Intronic
991503181 5:67297909-67297931 CTGTGAGAGGGACAGGAATGTGG - Intergenic
992534349 5:77683507-77683529 CTGGCAGACGAAAGGGAATGAGG + Intergenic
992564118 5:77981184-77981206 CGGTGAGACAGAAAGGAAGGTGG + Intergenic
993228934 5:85206014-85206036 CTGTGAGTCTAAAAGAAAAGAGG - Intergenic
993697343 5:91077503-91077525 CAGTGAAACCCAAAGGAATGGGG + Intronic
995354634 5:111224135-111224157 CTGGGAGAGAGAAAGGAAAGAGG + Exonic
995630716 5:114129150-114129172 GTGGGATACAGAAAGGAATGAGG + Intergenic
996293522 5:121883666-121883688 CTGGGGGACAAAAACCAATGTGG + Intergenic
996616823 5:125452210-125452232 CTGTGTGAAGAAAAGAAATGTGG + Intergenic
996985954 5:129564725-129564747 CTGTGGTACAGAAAGGAAAGGGG + Intronic
997575407 5:134972057-134972079 CTGTAAGAAAAAAGAGAATGAGG + Intronic
1002117670 5:176976591-176976613 CTGTGGAAAAAAAAGAAATGAGG + Intronic
1002157500 5:177294596-177294618 CTCTGGGACAAAGAGGCATGGGG - Exonic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1003796195 6:9607799-9607821 ATGTGAAACAAAAATGAATGAGG - Intronic
1004079440 6:12376876-12376898 TCCTGAAACAAAAAGGAATGAGG + Intergenic
1004463748 6:15863550-15863572 CTGTAAGCCATAAAGTAATGGGG + Intergenic
1005433046 6:25778825-25778847 ATGTGAGACAAATAGGTATCTGG + Intronic
1005869626 6:29965120-29965142 GTGTGAGACAGAAAGGAAATGGG + Intergenic
1006395789 6:33786733-33786755 CTGTGAGAGAAAAACAGATGAGG - Exonic
1006621197 6:35365440-35365462 CTGTTAAAAAAAAAAGAATGAGG - Intronic
1008180269 6:48319667-48319689 CTGTGAGACAGAGAGAAAAGGGG + Intergenic
1008191876 6:48468791-48468813 CTGTGGGACACAAAGGGTTGGGG - Intergenic
1009270992 6:61613554-61613576 GTGTAAGAAAAAAAGAAATGTGG - Intergenic
1009274664 6:61660312-61660334 CTCTGAGACAAAATGGAAGGAGG + Intergenic
1011285213 6:85715549-85715571 TCCTGAGACCAAAAGGAATGAGG + Intergenic
1012001023 6:93655379-93655401 GTGTGTGACATAATGGAATGAGG + Intergenic
1012094012 6:94934680-94934702 CAGTGAGACAAAAAGAGATATGG + Intergenic
1012338741 6:98092001-98092023 CTGTGAGACAAAATGGAGAGGGG + Intergenic
1012741686 6:103023498-103023520 CTGAGAGACAGAAGGGTATGAGG + Intergenic
1014212742 6:118723327-118723349 CTGTGATACAACAAGGACTTAGG - Intergenic
1014399888 6:120975291-120975313 ATTTGAGAGAAAAAGAAATGAGG - Intergenic
1014476755 6:121882771-121882793 CTGAGACACAAAAAGAGATGTGG - Intergenic
1014830221 6:126094575-126094597 CTCTGAGACTAAAGGAAATGTGG - Intergenic
1015744546 6:136496331-136496353 TTGTATGACATAAAGGAATGAGG - Intronic
1015757788 6:136625485-136625507 CTGTGAAACAAAAAGAAAGCTGG + Intronic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1018746019 6:166762760-166762782 CTGGGAGCCAACAAGGAAAGCGG + Intronic
1019868717 7:3737728-3737750 CTGTGAGACAAGACAGAAGGAGG + Intronic
1020175683 7:5880367-5880389 CTCTGAGACAAAAAAGGCTGGGG + Intronic
1020455040 7:8362857-8362879 CTGTGACACAAAGAAGAATGAGG + Intergenic
1020992939 7:15224412-15224434 CAGAGAGACAAAAAGGGGTGGGG - Intronic
1021815490 7:24443448-24443470 CTGAGAGAGAAAAAGGAATTTGG - Intergenic
1022170699 7:27826590-27826612 CTGAGAGATAAAAAGGAAATAGG + Intronic
1022326978 7:29341288-29341310 CTGTAAGACAAACAAGGATGTGG + Intronic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1022891848 7:34709052-34709074 CTGTGAGGGAAAAAGGAATAAGG + Intronic
1022948800 7:35316035-35316057 CTTTAGGACGAAAAGGAATGTGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023654776 7:42408248-42408270 CTCTCAGACTAAAAGGAGTGAGG - Intergenic
1024073729 7:45808028-45808050 CTGGGAGACAGGCAGGAATGTGG - Intergenic
1028132226 7:87188914-87188936 TAGTGACAAAAAAAGGAATGAGG + Intronic
1029083146 7:97990606-97990628 CTCTGAGACAAAAAGGGCTGGGG - Intronic
1029491225 7:100871333-100871355 CTATGAGAAAAACAGGAATCAGG - Intronic
1030969598 7:116038952-116038974 CTGAGAGACGAAACGGGATGTGG + Intronic
1031479594 7:122262309-122262331 CTGTGAAAAAAAAAAAAATGTGG + Intergenic
1031745330 7:125489026-125489048 CTGTGAGACAAAATATAATATGG + Intergenic
1032297110 7:130649341-130649363 CTGTTAAACAAAAAGGAACCAGG - Intronic
1032307535 7:130750393-130750415 CTGTGAGACACACAGCAGTGTGG + Intergenic
1032316573 7:130843757-130843779 CTGAGGGACAAAGAGGAAGGAGG - Intergenic
1032335970 7:131024910-131024932 TTGTGAGATAAAAACTAATGGGG - Intergenic
1033935140 7:146574992-146575014 CTCTGACACAAAAATGTATGAGG - Intronic
1034336243 7:150325266-150325288 CTGGGAGGCAAAAGGGAAAGCGG - Intronic
1034739498 7:153460758-153460780 CTGTGATCCAAAAATAAATGAGG + Intergenic
1035537082 8:400245-400267 CCATGAGACAACAATGAATGAGG - Intergenic
1036178779 8:6565642-6565664 CTGGTAGACAAAAAGTACTGTGG - Intronic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037445714 8:18963650-18963672 CTGGGAGAAAATAAGAAATGGGG + Intronic
1037478751 8:19284621-19284643 CAGTGAGACAAAAAAGCATCAGG - Intergenic
1037756693 8:21714829-21714851 CTGCCTGACACAAAGGAATGGGG + Intronic
1038329151 8:26593910-26593932 CTGTGAGACAAAAATCAAAAGGG + Intronic
1038809579 8:30826705-30826727 CACAGAGACAAAAAAGAATGGGG - Intergenic
1038892551 8:31742794-31742816 CTGTGAGAGGAGAAAGAATGGGG + Intronic
1039853517 8:41392967-41392989 ATGTGAAACAAGAAGAAATGGGG + Intergenic
1039984515 8:42436426-42436448 ATGTGAGAGAAGAAGGAAAGAGG - Intronic
1041213054 8:55572065-55572087 CTGTGAGCAAACAAGGAAGGGGG - Intergenic
1042058561 8:64792290-64792312 CTGTTAGGCAAAAAGGAACCAGG + Intronic
1043058021 8:75464918-75464940 TTGGGAGAGGAAAAGGAATGAGG + Intronic
1043404659 8:79918035-79918057 ATGTGAGACAGAAAGGAGTGAGG - Intergenic
1043683477 8:83060672-83060694 CTGTAAGACAAAAAGGGTTATGG - Intergenic
1044089929 8:87987457-87987479 CTGTTAGCAAAAAAGCAATGTGG + Intergenic
1044413539 8:91910887-91910909 CTGTGATTCAGAAAGGAGTGGGG + Intergenic
1044715568 8:95096445-95096467 CTAAGTGACAAAAATGAATGGGG + Intronic
1046068842 8:109225953-109225975 ATGAGAGAGAAAAAGGTATGGGG - Intergenic
1046189393 8:110772272-110772294 CTGTTAAACAAAAAGCAACGAGG - Intergenic
1046371727 8:113317701-113317723 CTGTGAAGCATAAATGAATGAGG - Intronic
1046427811 8:114078107-114078129 ATGAGAAAAAAAAAGGAATGAGG + Intergenic
1047298756 8:123594585-123594607 CTGGGAGACATGAAGGCATGAGG + Intergenic
1047347255 8:124040244-124040266 CTGGGAGAAAAAGAGGAATGAGG + Intronic
1047635273 8:126754978-126755000 CTGTGAGACAAAAAGATACCAGG + Intergenic
1047711298 8:127555178-127555200 GTGAGAGACAAGGAGGAATGGGG + Intergenic
1049715577 8:144088839-144088861 CTGTTAGATATAAAGGAATAAGG - Intergenic
1050382516 9:5044244-5044266 ATGTGAGACAAAAGGATATGTGG - Intronic
1050449328 9:5763305-5763327 CGCTGGGACAAGAAGGAATGGGG - Exonic
1050635257 9:7605617-7605639 CTGTGAGGAAATATGGAATGAGG + Intergenic
1051878244 9:21813078-21813100 CTTAGAGACTCAAAGGAATGTGG + Intronic
1053385387 9:37683224-37683246 TTCTGCCACAAAAAGGAATGAGG - Intronic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056193569 9:84207598-84207620 CTGTCAGACGAATGGGAATGAGG + Intergenic
1056811839 9:89771147-89771169 CTGTGAGAATAAAGGGAGTGAGG + Intergenic
1058428399 9:104896557-104896579 CTGAGAGGCAAAAAGGTAAGTGG + Intronic
1058592222 9:106576926-106576948 ATTTTAGACAAAAGGGAATGGGG + Intergenic
1058645984 9:107131747-107131769 CTGTGGGGCAAAAAGGACAGTGG + Intergenic
1060378954 9:123147055-123147077 CTGTTAAAGAAAGAGGAATGAGG + Intronic
1061433347 9:130545024-130545046 CTAGGAGACAAAAAGGCAGGCGG + Intergenic
1186105576 X:6202202-6202224 CTGTCAGAAAAAAAGGTATAAGG + Intronic
1186507776 X:10107608-10107630 CTGTCAGGAAAAAAAGAATGAGG - Intronic
1186815984 X:13238557-13238579 ATGTGATACAGAAAGAAATGTGG - Intergenic
1187307934 X:18113988-18114010 CTGTGACTCATAAAGGACTGTGG - Intergenic
1187550425 X:20297436-20297458 TTGTGGGAGAAACAGGAATGAGG + Intergenic
1188918546 X:35942737-35942759 CTGTAAGTAAAAAAGGAATATGG + Intronic
1189408669 X:40749615-40749637 CTGTTAAACACAAAGGAATTGGG + Intergenic
1189789135 X:44586728-44586750 CTGCTAAACAAAAAGGAATCAGG + Intergenic
1190043078 X:47087641-47087663 CTGTGAGACAAAAATAAAGATGG + Intronic
1191839189 X:65498492-65498514 CTAGGAGACCAAAAGGAAAGGGG + Intronic
1192046877 X:67685027-67685049 CTTAGAGACAGAAAGGAGTGAGG + Intronic
1192335896 X:70219315-70219337 ATGAGATACATAAAGGAATGTGG + Intergenic
1193611624 X:83638867-83638889 CTGTGAGACAGAAAACCATGAGG - Intergenic
1193823000 X:86189297-86189319 CAGTGATACAAACAGTAATGTGG - Intronic
1196163467 X:112512130-112512152 ATGGGAGCCAAAAAGGCATGAGG - Intergenic
1196247989 X:113423488-113423510 CTGAGCTACAAAAAGGAATAGGG - Intergenic
1197868627 X:131044888-131044910 CAGTGAAAGAAAAAGGGATGAGG - Intergenic
1199155766 X:144547216-144547238 CTCTGAGATAAATAGGAATCTGG + Intergenic
1199312894 X:146342381-146342403 CTTTGAGGCAAATAGGAAAGTGG + Intergenic
1199870292 X:151892375-151892397 CTGTCAGACATGAAGGACTGGGG - Intergenic
1199903388 X:152199817-152199839 ATGTGAGACAGAAAGGAGGGAGG - Intronic
1200354467 X:155533897-155533919 CTGTTAAACAAAAAGGAACCAGG + Intronic
1201585798 Y:15559777-15559799 GTGTAAGCCAGAAAGGAATGGGG + Intergenic
1201643039 Y:16199398-16199420 CTATAAGTCAAAAAGGAAGGAGG + Intergenic
1201652640 Y:16307321-16307343 CTGTGAGAGGAAGAGGTATGAGG - Intergenic
1201659776 Y:16385923-16385945 CTATAAGTCAAAAAGGAAGGAGG - Intergenic