ID: 961799950

View in Genome Browser
Species Human (GRCh38)
Location 3:129439868-129439890
Sequence GCCCCACACCCTGGGCGTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961799950_961799957 16 Left 961799950 3:129439868-129439890 CCGCAACGCCCAGGGTGTGGGGC 0: 1
1: 0
2: 0
3: 18
4: 199
Right 961799957 3:129439907-129439929 CCTCTTCAGCTCACGGCACCGGG 0: 1
1: 1
2: 0
3: 12
4: 141
961799950_961799958 28 Left 961799950 3:129439868-129439890 CCGCAACGCCCAGGGTGTGGGGC 0: 1
1: 0
2: 0
3: 18
4: 199
Right 961799958 3:129439919-129439941 ACGGCACCGGGCTGCAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 48
961799950_961799955 15 Left 961799950 3:129439868-129439890 CCGCAACGCCCAGGGTGTGGGGC 0: 1
1: 0
2: 0
3: 18
4: 199
Right 961799955 3:129439906-129439928 ACCTCTTCAGCTCACGGCACCGG 0: 1
1: 0
2: 0
3: 6
4: 102
961799950_961799954 9 Left 961799950 3:129439868-129439890 CCGCAACGCCCAGGGTGTGGGGC 0: 1
1: 0
2: 0
3: 18
4: 199
Right 961799954 3:129439900-129439922 TGTGAAACCTCTTCAGCTCACGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961799950 Original CRISPR GCCCCACACCCTGGGCGTTG CGG (reversed) Exonic
900405325 1:2490418-2490440 GCCCCCCACCCTGGCCCTGGCGG - Intronic
900731327 1:4262988-4263010 GACACACACCCTGGGAGTTGTGG + Intergenic
901031889 1:6311892-6311914 GACCCAGACCCTGGGAGTCGGGG - Intronic
901154436 1:7125872-7125894 GACTAACACACTGGGCGTTGGGG - Intronic
901876532 1:12169916-12169938 GCCCCAGGCCCTGGGTGATGAGG - Intronic
902205867 1:14867729-14867751 CCCCCCCACCCTGGGCATGGAGG + Intronic
902224071 1:14985412-14985434 GTCCCACACTCTGGGGGCTGAGG + Intronic
902450156 1:16491527-16491549 ACCCCACCCCCTGGGCTTGGAGG - Intergenic
902502686 1:16921621-16921643 ACCCCACCCCCTGGGCTTGGAGG + Intronic
903703820 1:25270316-25270338 GGGCCACAGCCTGGGGGTTGGGG - Intronic
903723423 1:25423008-25423030 GGGCCACAGCCTGGGGGTTGGGG + Intronic
903884106 1:26531111-26531133 GCAGCACACCCTGGGGGCTGGGG - Intronic
903887828 1:26551260-26551282 CCCCCTCACCCAGGGCTTTGGGG - Intronic
905852871 1:41286912-41286934 TCCCCAGACCCTGGGAGTGGAGG - Intergenic
910853429 1:91670617-91670639 GCGCCACACCCTGGGCCTGGTGG - Intergenic
912798446 1:112706723-112706745 GCCGCCCACCCTGGGGGCTGGGG + Intronic
913112333 1:115667553-115667575 GTCCCTTACCCTGGGGGTTGGGG - Intronic
913539567 1:119805844-119805866 GCCCCACACTCTGCAAGTTGCGG + Intronic
915930099 1:160054983-160055005 GCCCCACCCCCTGATGGTTGGGG - Intronic
916577479 1:166080678-166080700 ACACCACACCCTGAGCATTGAGG + Intronic
917609030 1:176667544-176667566 GGCCCACACCTTGGGACTTGTGG - Intronic
918260331 1:182789854-182789876 GCCCGACGACCTGGGCGTTCGGG + Intronic
919804844 1:201375451-201375473 TCACCCCACCCTGGGGGTTGGGG - Intronic
919863259 1:201757733-201757755 GCCCCACAGCTTAGGCTTTGGGG - Intronic
920383526 1:205550158-205550180 GCCCAACAAGCTGGGCGTGGTGG + Intergenic
922472809 1:225887406-225887428 GCTGCACACCCTGGACCTTGGGG - Exonic
922781380 1:228255796-228255818 GGTCCACAGCCTGGGGGTTGGGG - Intronic
924710712 1:246528030-246528052 GCCCCACACCCCTGACCTTGAGG + Intergenic
1062932254 10:1361073-1361095 GCCCCAGACCATGGGTGGTGGGG + Intronic
1064969443 10:21049322-21049344 GCCCCAGACCCTGGGTGTGGTGG - Intronic
1067525494 10:47036003-47036025 GCCCCACACCTGGGACCTTGGGG - Intergenic
1070718720 10:78741525-78741547 GTCACACACCCTGGGCATAGTGG + Intergenic
1070764513 10:79048666-79048688 GCCCCCCACCCTGGATGGTGGGG + Intergenic
1072438799 10:95436361-95436383 GCCCCACACCGTGGGTGCAGAGG + Intronic
1074538491 10:114345773-114345795 TCCCCACACCCTTTGCCTTGTGG - Intronic
1075141547 10:119841923-119841945 GGTCCACGGCCTGGGCGTTGGGG - Intronic
1075988972 10:126816598-126816620 CCCCCACAACCTGGGCTATGAGG - Intergenic
1076812896 10:132898483-132898505 GCCCCATCCCCTGGGCCTTGGGG + Intronic
1077198424 11:1293169-1293191 GCCCCACACTCTGGAAGCTGAGG - Intronic
1077236860 11:1486071-1486093 GAACCACACCCTGTGGGTTGCGG + Intronic
1077332072 11:1988188-1988210 GCCCCACTCCCAGGCCTTTGCGG - Intergenic
1078563619 11:12394802-12394824 GCCCTACAGGCTGGGCGTGGTGG + Intronic
1080040428 11:27754173-27754195 CCCCCACACCGTGAGAGTTGAGG + Intergenic
1080609652 11:33892902-33892924 GCCTCTGACCCTGGGCTTTGGGG + Intergenic
1081765772 11:45609071-45609093 GCCCCACACCGTGGGAGCTCTGG + Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1087047503 11:93855160-93855182 GCAATACACCCTGGGCCTTGAGG + Intergenic
1089896314 11:121933531-121933553 AGCCCACAGCCTGGGGGTTGGGG + Intergenic
1091251932 11:134151382-134151404 GCTCCCCACCCTCAGCGTTGGGG + Exonic
1202815053 11_KI270721v1_random:43364-43386 GCCCCACTCCCAGGCCTTTGCGG - Intergenic
1091587190 12:1822954-1822976 GGCCCACACCCTGGGCCTGCAGG - Intronic
1093125407 12:15322621-15322643 GCCTCAGACCCTGGGCGCCGAGG - Exonic
1093713102 12:22350362-22350384 GGTCCACAACCTGGGGGTTGGGG - Intronic
1096104202 12:48986971-48986993 GCCGCACAACCTGGGCGTGAAGG - Intergenic
1096546162 12:52341538-52341560 GCTTCACACACTGGGCATTGGGG - Intergenic
1097248220 12:57618293-57618315 ACCCCACCCCCCGGGCTTTGGGG + Intronic
1101830925 12:108255912-108255934 GCACCACACCATTGGCTTTGGGG - Intergenic
1103927267 12:124429838-124429860 GCCCCACACCCGGGGTCCTGGGG + Intronic
1104946436 12:132416875-132416897 GCCCCACACCCCGGGGGTCAAGG + Intergenic
1105545244 13:21346464-21346486 GCCCCACACCCAGGGCCTCATGG + Intergenic
1107276624 13:38687044-38687066 TCCCCGGACCCTGGGCTTTGAGG - Intergenic
1111624412 13:90765547-90765569 GCTCTACAACCTGGCCGTTGTGG - Intergenic
1112103615 13:96217026-96217048 GACCCACACCCTGGGGGTGCAGG - Intronic
1113389415 13:109881147-109881169 CCACCACACCGTGTGCGTTGCGG + Intergenic
1113737617 13:112689857-112689879 GCCCCAGACCCTGGGGGCAGAGG - Intergenic
1113868849 13:113546021-113546043 GCTCCCCACCTTGGGCGTTCCGG - Intronic
1117088836 14:52228970-52228992 GGTCCACAGCCTGGGTGTTGGGG + Intergenic
1118372820 14:65152271-65152293 GGCCCTCACCCTGGGCGGGGTGG - Intergenic
1118729144 14:68654561-68654583 GCACCACATCCTGGGAGATGGGG - Intronic
1119692888 14:76690799-76690821 GCCCCCCAGCCTTGGAGTTGAGG + Intergenic
1120988590 14:90355245-90355267 GGTCCACAGCCTGGGGGTTGGGG + Intergenic
1122080087 14:99261073-99261095 GCGCCACAGCCTGGGTGGTGGGG - Intronic
1122885445 14:104708467-104708489 GCTCCACAGCCTCGGCGTCGGGG - Exonic
1124604611 15:31161090-31161112 GCCCCACGCACTGGGCGAGGGGG + Exonic
1125883114 15:43210206-43210228 TCCCCACACCCTGGGAGGAGGGG + Intronic
1130540472 15:84817714-84817736 TCCCCAGGCCCTGGGCCTTGGGG - Intronic
1132806213 16:1776282-1776304 ACCAGACACCCTGGGCGGTGGGG + Exonic
1133233402 16:4376824-4376846 GCCCTTCACCCTGGGGGCTGGGG - Intronic
1135170808 16:20181664-20181686 GCCCCACACCCTTGGCCTGGGGG - Intergenic
1136183285 16:28569815-28569837 CCCCAACACCCTGGGCCTTCTGG - Intronic
1136418618 16:30118303-30118325 GCCCCAGACCCTGGGGGAGGAGG + Intronic
1136568267 16:31082567-31082589 GCCCCACTCCCTGGCAGCTGCGG - Intronic
1137717296 16:50606018-50606040 GCCACAGACCCTGGGCCGTGTGG + Intronic
1139413548 16:66786880-66786902 ACCCAACACCCTGGGGGTTTGGG + Intronic
1139473916 16:67192989-67193011 GCCCCACTCCCTGGGCTCAGGGG + Exonic
1141159835 16:81621830-81621852 GCCCCCAACCCTGGCCGTTGGGG - Intronic
1141839821 16:86567362-86567384 GCACCACTCCCAGGGCGTTGGGG - Exonic
1142801340 17:2347924-2347946 GCCCCAATCCCTGGGGGGTGGGG - Intronic
1143012365 17:3872914-3872936 GCCCCAGGCCCTGGGAGTGGAGG - Intronic
1145062134 17:19740005-19740027 GACCCACAGCCTGGGCACTGGGG + Intronic
1145815077 17:27789458-27789480 GTCCCAGACCCGGGGTGTTGGGG - Intronic
1147184523 17:38706012-38706034 GCCCCACACCGCGGGTGTCGGGG + Intronic
1147720359 17:42536231-42536253 GCCCCACCCCCTGGCCGTCGCGG + Exonic
1148463547 17:47851359-47851381 GCCCCTCTCCCTGGGAGTGGAGG - Intronic
1148851077 17:50555666-50555688 GCCCCACCCCAAGGGGGTTGGGG - Exonic
1150007425 17:61478505-61478527 GCCCCGGATCCTGGGCTTTGAGG + Intronic
1150307246 17:64096096-64096118 GGTCCACAACCTGGGGGTTGGGG - Intronic
1151591365 17:75047003-75047025 GGCCCACCCCCTTGGCTTTGGGG - Intronic
1151984924 17:77536070-77536092 GCCCCACACCCTGGTCTTGTCGG + Intergenic
1152686095 17:81694499-81694521 GCCCCACACGCTGGACCGTGGGG + Intronic
1152895892 17:82911056-82911078 ACCCCACACACTGGGCCTGGAGG + Intronic
1153282629 18:3428152-3428174 GCCACACACTCTGGGGGCTGGGG + Intronic
1153973771 18:10248811-10248833 GCCCCACAGCCTGGGTTTTTAGG + Intergenic
1156464480 18:37340104-37340126 GCCCCCCAGGCTGGGCATTGTGG - Intronic
1158788968 18:60751596-60751618 ACCCCACACCCAAGGCGATGTGG + Intergenic
1160193492 18:76734525-76734547 GCCTCAGAACCTGGGTGTTGTGG + Intergenic
1160520112 18:79503062-79503084 TCCCCACATGCTGGGCATTGTGG - Intronic
1160662266 19:306584-306606 TCCCCACCCCCCGGGCCTTGGGG - Exonic
1161267327 19:3370279-3370301 GCCCCCCACCCGGGGCCTGGTGG + Intronic
1162779824 19:13001135-13001157 CCCCCACATCCAGGGCTTTGGGG - Intronic
1162790210 19:13058881-13058903 CCCCCACACCCTGGGGATTGGGG - Intronic
1162819974 19:13216896-13216918 GCCCCCCACCCCAGGCATTGAGG - Intronic
1163296312 19:16415117-16415139 GCACTAAACCCTGGGCCTTGTGG - Intronic
1163681297 19:18683984-18684006 TCCCCACGCCCCGGGCGTCGTGG + Intronic
1163701580 19:18789186-18789208 GCCCCACGCCCTGGTGGGTGGGG + Exonic
1163957981 19:20661510-20661532 GCCACACAGCCTGGGCCTTTAGG + Exonic
1165071702 19:33259570-33259592 GCCCCCAACCCTGGGCCTTGTGG + Intergenic
1165772147 19:38386099-38386121 GCCGCACTCTCTGGGCCTTGGGG - Exonic
1166707091 19:44914079-44914101 GCGCCACACCCTGGGCCTGGTGG + Intergenic
1167043988 19:47039433-47039455 GGCCCACGCCCTGGGCCTTGTGG + Exonic
1167423817 19:49419223-49419245 GCCCAACCCCCTGGGAGCTGGGG - Intergenic
1167661070 19:50796471-50796493 GCCCCACACCCATGGCTGTGTGG + Intergenic
1168180830 19:54662177-54662199 GGCCCAGACCCTGTGAGTTGGGG + Exonic
925856328 2:8133107-8133129 GCCCCACATCCTGGGCGAGGGGG - Intergenic
925942990 2:8837654-8837676 GCCACGCCCCCTGGGCGTGGAGG + Intergenic
927200913 2:20577576-20577598 GCCCCTCACCTTGGGCCTGGAGG - Intronic
932054334 2:68429580-68429602 GGTCCACAGCCTGGGGGTTGGGG - Intergenic
934188605 2:89766159-89766181 GCCACAGACCCTGGGCATTCAGG + Intergenic
936077834 2:109413009-109413031 GCCCCACACCCTGGAACTTCAGG + Intronic
937412047 2:121685191-121685213 GGCCCACATCCGGGGGGTTGGGG - Intergenic
938791974 2:134684595-134684617 GCCCCACACCCTCAGTGTTTTGG + Intronic
946469584 2:219946156-219946178 CCTACACACCCTGGGGGTTGTGG + Intergenic
947102021 2:226631036-226631058 AGCCCACACCCTGGGCATGGCGG + Intergenic
1172511673 20:35505070-35505092 GCCCACCACCCTGGGCCCTGTGG + Intronic
1173221960 20:41138159-41138181 CCCCCAGACCCTGGGAGTGGTGG + Intronic
1173374292 20:42469710-42469732 ACCCCACACACTGGTCTTTGGGG - Intronic
1175211679 20:57361844-57361866 GGTCCACAGCCTGGGGGTTGGGG - Intronic
1175488448 20:59362647-59362669 GCCCCCCACCCTGTACGTGGTGG - Intergenic
1175875564 20:62227761-62227783 GCTCCACACACAGGCCGTTGGGG + Intergenic
1176232791 20:64040597-64040619 GCCCCAACCCCTGGGCCATGGGG + Intronic
1176233864 20:64045235-64045257 GCCCCCCACCCTGGCACTTGGGG + Intronic
1178759317 21:35385662-35385684 ACCCCACAGGCTGGGCGTGGTGG + Intronic
1179656089 21:42845679-42845701 GCCGCAAACACTAGGCGTTGAGG + Intronic
1179988713 21:44934774-44934796 GCCCAGCTCCCTGGGGGTTGGGG - Exonic
1180958683 22:19752382-19752404 GCCCCACACCCTGTGCCTCTCGG - Intergenic
1181057404 22:20266686-20266708 CCCTCACACCCTGGGCTTTGCGG + Intronic
1181509997 22:23384886-23384908 GCTGCAGACCCTGGGCTTTGGGG - Intergenic
1181567333 22:23747182-23747204 GTCCCCCACTCTGGGGGTTGGGG - Intronic
1181590579 22:23882663-23882685 GCCGCACACCCTGGGCCCCGGGG + Intronic
1181968209 22:26671334-26671356 GCCCCACTCCCTGGCTGGTGGGG + Intergenic
1182283848 22:29232610-29232632 GTCCCACAGCCTGGGCGTAGGGG + Intronic
1183404601 22:37624210-37624232 GCCCCACACCCTGGCACCTGGGG + Intronic
1183665536 22:39244018-39244040 GCCCCCCACCCTGGCCGCGGGGG - Exonic
950628910 3:14268250-14268272 GCCCCAGGCCCTGGACGCTGAGG - Intergenic
951334699 3:21406411-21406433 GCACCACTTCCTGGGCGTGGGGG - Intergenic
952015980 3:28958544-28958566 GCCCCACCCCTTCGGAGTTGGGG + Intergenic
953393120 3:42545341-42545363 GGCCCACACTCTGGGCTCTGTGG + Intergenic
954368985 3:50160547-50160569 GCCCCTCACCCTGGGCCCAGGGG - Intronic
958693512 3:97498672-97498694 AGCCCACAGCCTGGGGGTTGAGG - Intronic
959889120 3:111534247-111534269 GCCCCACACCCTGACCTCTGAGG + Intronic
961799950 3:129439868-129439890 GCCCCACACCCTGGGCGTTGCGG - Exonic
962210382 3:133472398-133472420 GCTCCAGAACCTGGGCGCTGTGG + Exonic
963305556 3:143648547-143648569 GGTCCACAGCCTGGGGGTTGAGG + Intronic
964088926 3:152850354-152850376 GAGCCACACCCTGGGCTATGGGG - Intergenic
964182696 3:153907254-153907276 GCCACACACCCTGGCCTCTGTGG + Intergenic
964827947 3:160850503-160850525 GCCCCTCTCCCTGGACTTTGGGG + Intronic
967078628 3:186028034-186028056 GCCCCACGCACTGGGGGTTAGGG - Intergenic
968519801 4:1030184-1030206 GCCCCACACACTTGGCCCTGTGG - Intergenic
968650943 4:1760051-1760073 GCCCCACCTCCTGGGAGTGGAGG - Intergenic
969637838 4:8379592-8379614 GCCACACACTCGGGGTGTTGTGG + Intronic
969653143 4:8479428-8479450 GCCCCACACCCAGGCTGTGGGGG + Intronic
969886159 4:10217420-10217442 ACCTCAGACCCTGGGAGTTGTGG - Intergenic
971316507 4:25572352-25572374 GCCCAACACCCTAGGCACTGAGG - Intergenic
973209475 4:47599758-47599780 GTCTCACACCCTGGAAGTTGGGG + Intronic
973239525 4:47942579-47942601 GGCCCACAGCCCGGGGGTTGGGG - Intronic
973773394 4:54226172-54226194 GCGCCACACCTTTGGCTTTGAGG - Intronic
978170079 4:105659224-105659246 CCTCCACAAGCTGGGCGTTGAGG - Exonic
984122434 4:175762776-175762798 GACACTCACCCTGGGGGTTGTGG - Intronic
984466716 4:180109192-180109214 GGTCCACAGCCTGGGAGTTGAGG - Intergenic
985813191 5:2105565-2105587 GCCACAAAGCCTGGGCTTTGAGG + Intergenic
992090365 5:73311406-73311428 GCCGCTCACCCTGGGGGCTGAGG - Intergenic
994227109 5:97265399-97265421 GCCCCACCCCCTGAGCTCTGGGG - Intergenic
1001420927 5:171586660-171586682 TGCCCAGACCCTGGGCCTTGGGG + Intergenic
1002926984 6:1610472-1610494 GCACCACTCCCAGGGAGTTGGGG - Exonic
1006359365 6:33578881-33578903 TCCCCAGGCCCTGGGCGGTGGGG - Intronic
1006779754 6:36624334-36624356 GCCCCAGACCCTGGGCCCAGCGG + Intergenic
1017793533 6:157822740-157822762 GCCCCACGCCTGGGGTGTTGCGG - Intronic
1019275653 7:174126-174148 GCCCCATTCCCTGGGCCTCGAGG + Intergenic
1019459542 7:1149649-1149671 GCCCTACAGCCTGGGTGTGGAGG - Intergenic
1019594583 7:1852482-1852504 GCCCCGCTCCCTGGGCGGAGAGG + Intronic
1022407853 7:30108835-30108857 GCCCCACACCTGGGGTGCTGTGG - Intronic
1024236347 7:47401920-47401942 ACCCCACAGCCTCGGGGTTGGGG - Intronic
1026620440 7:71945453-71945475 GGTCCACAGCCTGGGCGATGAGG - Intronic
1026878808 7:73895082-73895104 GCCCCCCTCCCTGGGGGTTGTGG - Intergenic
1032086331 7:128885747-128885769 GTCCCACACCCTGCGCAGTGTGG - Intronic
1033342212 7:140500923-140500945 GGCTCACACGCTGGGCGTGGTGG - Intergenic
1033809991 7:145001551-145001573 GCACCACACCCAGGGTGCTGAGG - Intergenic
1035160108 7:156943978-156944000 ACCCAACACACTGGGTGTTGGGG + Intergenic
1035171478 7:157019614-157019636 GCCCCTGAGCCAGGGCGTTGGGG - Intergenic
1049267235 8:141674769-141674791 GCCCCACACCATGAGTGTTCAGG - Intergenic
1049389565 8:142360855-142360877 GCCCCACAGCCCAGGAGTTGGGG - Intronic
1053412240 9:37923285-37923307 GCCCTGCACCATGGGCGCTGTGG - Intronic
1054285447 9:63163835-63163857 GCCACAGACCCTGGGCAGTGAGG - Intergenic
1054389375 9:64601188-64601210 GCCACAGACCCTGGGCAGTGAGG + Intergenic
1054796014 9:69302570-69302592 GCCTCAGCCCCTGGGCTTTGAGG + Intergenic
1057762883 9:97890710-97890732 CTCCCACACCATGGGCATTGTGG - Intergenic
1057972856 9:99574030-99574052 GCACCAAAGCCTGGGCATTGTGG + Intergenic
1059399306 9:114058994-114059016 GCCCCACACTTTGGATGTTGGGG + Intergenic
1061087577 9:128408281-128408303 GCCACACAGCCTGGAGGTTGTGG - Intergenic
1061089987 9:128421015-128421037 GCCCCACTACCTGGGCGCTCTGG + Exonic
1061788281 9:133043990-133044012 GGCTCACACACTGGGCGTGGTGG + Intronic
1062173732 9:135149325-135149347 GCCCCACTGCCTGGACGGTGTGG + Intergenic
1062359788 9:136182276-136182298 ACCCCGCATCCTGGGGGTTGTGG - Intergenic
1062390895 9:136333460-136333482 GACCCCCACCCTGGGCCTTGGGG - Intronic
1191638880 X:63409142-63409164 GCGCCACACCCTGGGCCTGGTGG + Intergenic
1192361844 X:70445429-70445451 GCCCCACATCCCGGCCGGTGGGG - Exonic
1198438835 X:136641921-136641943 GCCCCACCCCCTGGGTGTGTAGG + Intergenic
1199389650 X:147264141-147264163 GGTCCACAGCCTGGGGGTTGGGG - Intergenic