ID: 961804535

View in Genome Browser
Species Human (GRCh38)
Location 3:129479813-129479835
Sequence GCGGAGTGAAGGAGCGGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 567}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961804528_961804535 10 Left 961804528 3:129479780-129479802 CCTAGGAGAAACGGCTGCAGTGC 0: 1
1: 0
2: 2
3: 22
4: 259
Right 961804535 3:129479813-129479835 GCGGAGTGAAGGAGCGGGAGTGG 0: 1
1: 0
2: 0
3: 36
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961804535 Original CRISPR GCGGAGTGAAGGAGCGGGAG TGG Exonic
900113686 1:1019950-1019972 GAGGAGGGAGGGGGCGGGAGGGG + Intergenic
900805312 1:4763721-4763743 GCGTAGAGAAAGAGAGGGAGAGG - Intronic
900918564 1:5656195-5656217 GAGGAGAGAAGGAGGGAGAGAGG + Intergenic
901560423 1:10066032-10066054 GGGGAGGGAAGGAGGGGGGGAGG - Intronic
902325902 1:15700575-15700597 TTGGAGTTAAGGAGAGGGAGAGG - Intronic
902610732 1:17595722-17595744 GCGGAGGGAAGGAGGGGGCGGGG + Intronic
902667970 1:17952750-17952772 GGGGAGAGGAGGAGAGGGAGAGG + Intergenic
903040228 1:20524039-20524061 GCAGAGTGAAGATGCGGGAGAGG + Intergenic
903808391 1:26021283-26021305 GAGGAGTTAAGGGGCGGGGGTGG - Intronic
903939807 1:26921853-26921875 GCGGAGAGCAGGAGGAGGAGCGG + Exonic
904260740 1:29286161-29286183 GCGGAGTGGAGGAGATGGGGGGG + Intronic
904348718 1:29891138-29891160 AAGGAGTGAAGGAGAGAGAGAGG + Intergenic
904422408 1:30402695-30402717 GCAGAGTGTAGCAGGGGGAGAGG + Intergenic
904639413 1:31912630-31912652 GGGGAGTGGAGGAGGGGGACTGG + Intronic
904751055 1:32741746-32741768 GGGGAGGGAAGGAGCGGGGCGGG - Intergenic
905404061 1:37721553-37721575 GCTGAGGGAAGGACCTGGAGAGG + Intronic
906141179 1:43534495-43534517 TGGGAGTGAAGGAGAGGAAGAGG + Intronic
906427024 1:45723977-45723999 GTGGAGAGAGGGAGAGGGAGGGG - Intronic
906939102 1:50240103-50240125 GCGGTGTGAAGCAGGGGGAGTGG + Intergenic
907048942 1:51316791-51316813 GAGGAGTGAAGGAGGTGGAAAGG - Intronic
907255143 1:53173438-53173460 GGGGAGAGGAGGAGAGGGAGGGG - Intergenic
907255150 1:53173457-53173479 GGGGAGAGGAGGAGAGGGAGGGG - Intergenic
907255157 1:53173476-53173498 GGGGAGAGGAGGAGAGGGAGGGG - Intergenic
907255164 1:53173495-53173517 GGGGAGAGGAGGAGAGGGAGGGG - Intergenic
907440713 1:54476530-54476552 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
907505881 1:54918059-54918081 GAGGAGGGAGGGAGAGGGAGGGG - Intergenic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
908389930 1:63675245-63675267 GCGCAGTGTGGGAGGGGGAGAGG - Intergenic
908445978 1:64200460-64200482 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
908829297 1:68163566-68163588 GCGGAGGGAGGGAGGGGGAGTGG - Intronic
909352678 1:74673397-74673419 GCGGAGGGAAGGGGCGAGAGGGG - Intronic
909973406 1:82018213-82018235 GCGGAATGAAGGGGAGGAAGGGG - Intergenic
910881483 1:91925699-91925721 GAGGGGAGAAGGAGAGGGAGGGG + Intergenic
910881489 1:91925716-91925738 GAGGGGAGAAGGAGAGGGAGGGG + Intergenic
910881495 1:91925733-91925755 GAGGGGAGAAGGAGAGGGAGGGG + Intergenic
910881501 1:91925750-91925772 GAGGGGAGAAGGAGAGGGAGGGG + Intergenic
912413700 1:109494319-109494341 GCGGAGTGGAGATGCTGGAGGGG + Intronic
912459492 1:109821499-109821521 GGGGTGTGAGGGAGCAGGAGGGG + Intergenic
912687769 1:111780362-111780384 GAGAAATGAAGGAGCTGGAGAGG - Intronic
912696945 1:111848982-111849004 GAGGAGGAAAGGAGAGGGAGGGG - Intronic
913195438 1:116452606-116452628 GTCAAGTGAAGGAGTGGGAGTGG - Intergenic
913450297 1:118988320-118988342 GAGGGGTGAGGGAGAGGGAGGGG + Intronic
913603231 1:120441812-120441834 GAGGAGTGAACGAGCGTGGGAGG - Intergenic
913603978 1:120448164-120448186 GAGGAGTGAACGAGCGTGGGAGG - Intergenic
914428810 1:147601035-147601057 CCAGAGGGAAGGAGAGGGAGGGG + Intronic
914887832 1:151599584-151599606 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
914889833 1:151612552-151612574 GAGGAGTGCAGGGGCAGGAGGGG - Intronic
914950679 1:152110878-152110900 GCGGAGGAAAAGAGCGAGAGGGG - Exonic
915032735 1:152897375-152897397 AAGGGGAGAAGGAGCGGGAGAGG + Intergenic
915243597 1:154541271-154541293 GGGGAGGGCAGGAGCGGGAGAGG + Intronic
915597682 1:156904772-156904794 GCAGGCTGAAGGGGCGGGAGTGG - Exonic
915601019 1:156923512-156923534 GTGTAGGGAAGGAGTGGGAGTGG + Intronic
916773572 1:167936849-167936871 GGGGAGGGGAGGAGGGGGAGGGG - Exonic
916990893 1:170243645-170243667 GGGGAGTGGAGGACAGGGAGAGG - Intergenic
917345270 1:174022448-174022470 GCGGAGGGGAGGGGCGGGCGCGG + Intergenic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
918192380 1:182188224-182188246 GCAGAGGGAGGGAGAGGGAGAGG - Intergenic
919788638 1:201275997-201276019 GGGGAGTGAATGAGAGGCAGGGG + Intergenic
922196529 1:223364336-223364358 GCGGAGAGAGGGAGTGGGTGGGG + Intergenic
922804499 1:228378433-228378455 GCGGGGAGAAGGAGGAGGAGAGG - Intronic
922937239 1:229432188-229432210 GCGGAGGGCAGAAGCAGGAGAGG + Intronic
923468415 1:234268454-234268476 GTGGAGAGAGGGAGAGGGAGAGG + Intronic
923664768 1:235990379-235990401 GAGGAGTGAAGGAGAGGGGAGGG - Intronic
924038301 1:239957869-239957891 GCTGAGTTATGGAGCAGGAGGGG - Intergenic
924452010 1:244187055-244187077 TCGGAGAGAAGGAGAGGGACTGG - Intergenic
1064003502 10:11682597-11682619 GAGGAGAGGAGGAGGGGGAGGGG - Intergenic
1065055173 10:21836894-21836916 GTGGAGAGACGGAGAGGGAGAGG - Intronic
1065099684 10:22321140-22321162 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1067256745 10:44649263-44649285 GGGGAGTTGGGGAGCGGGAGTGG - Intergenic
1067807896 10:49405858-49405880 GAGGAGAGAGGGAGAGGGAGTGG - Intergenic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1069176084 10:65290165-65290187 GAGGAGTGAAGGAGGGAGGGAGG - Intergenic
1069657161 10:70098380-70098402 AGGGAGGGAAGGAGGGGGAGGGG + Intronic
1069721878 10:70554960-70554982 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1070328671 10:75403416-75403438 GCCGAGGGAAGGAGCGAGAGAGG + Intergenic
1071753539 10:88509482-88509504 GAGGAGAGGAGGAGGGGGAGGGG + Intronic
1072282642 10:93881948-93881970 GAGGAGTGAAGGGGTGGGAGCGG + Intergenic
1073041999 10:100614315-100614337 GGAGGGTGAAGGAGTGGGAGCGG - Intergenic
1073097312 10:100987660-100987682 GCGGAGTGAAGACACGGGGGAGG + Intronic
1073399008 10:103241659-103241681 GGGGAGAGAAGGAAAGGGAGGGG - Intergenic
1075370093 10:121928198-121928220 GCGGAGAGACAGAGCGGGAAGGG + Intronic
1075592054 10:123699048-123699070 GGGAAGTGAAGGAGTGGCAGGGG + Intergenic
1076007978 10:126963564-126963586 AGGGAGGGAAGGAGAGGGAGAGG - Intronic
1076527415 10:131120824-131120846 AAGGAGTGAAGGAGCAGGAGGGG - Intronic
1076721646 10:132395913-132395935 GCGGAGTGAGGGAGCCCGCGGGG - Intergenic
1076989940 11:267547-267569 GAGGAGGGGAGGAGGGGGAGGGG + Intergenic
1077232801 11:1465683-1465705 TGGGTGTGAAGCAGCGGGAGTGG - Intergenic
1080660062 11:34288618-34288640 GAGGAGGGTAGGGGCGGGAGGGG + Intronic
1081288489 11:41303106-41303128 GTGGGGTGAGGGAGAGGGAGAGG - Intronic
1082816129 11:57510613-57510635 GCCAAGTGAAGCAGTGGGAGTGG - Intronic
1083114815 11:60450704-60450726 GCGGGGAGAGGGAGAGGGAGAGG - Intronic
1083141851 11:60728715-60728737 GAGGAGAGAAGGAGAGAGAGAGG - Intergenic
1083235864 11:61350385-61350407 GGGGAGTGAAGCAGCAGGAAGGG - Exonic
1083276019 11:61597617-61597639 GCGGAGGTGAGGAGTGGGAGTGG - Intergenic
1084187960 11:67485090-67485112 GCAGAGTGAAGGAGGGGGTGGGG - Intronic
1084362510 11:68677909-68677931 GGGCAGTGAAGGAGCGGGCCGGG + Intergenic
1084624655 11:70296762-70296784 GGGGAGGGAGGGAGAGGGAGAGG + Intronic
1084654061 11:70505169-70505191 GCGGAGTCATGGAGTGGGAATGG + Intronic
1084661964 11:70551312-70551334 GCGGTGGGAGGGAGGGGGAGGGG - Intronic
1085312952 11:75526693-75526715 GGGGTGGGAAGGGGCGGGAGCGG - Intergenic
1085561250 11:77474184-77474206 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1085592591 11:77778106-77778128 GGGGAGGGGAGGAGGGGGAGAGG + Intronic
1085736770 11:79045845-79045867 CAGGAGTGAAGGAGTGGGTGGGG - Intronic
1086518821 11:87646237-87646259 GCGGAGGGGAGGAGGGGGAGGGG - Intergenic
1087117099 11:94537248-94537270 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1089735834 11:120549708-120549730 GTGCAGAGAAGGAGTGGGAGAGG + Intronic
1089944734 11:122457219-122457241 AGGGAGGGAAGGAGGGGGAGAGG + Intergenic
1089983335 11:122790335-122790357 GCAGAGTGAGGGAGAGGGGGAGG - Intronic
1090238257 11:125165052-125165074 GCGGAGCGGAGCAGCGCGAGGGG + Intronic
1090385430 11:126355558-126355580 GCGGGGTGGAGGAGGGGGAAGGG - Intergenic
1090580400 11:128152877-128152899 GGGGAGGGAAGGAGGGAGAGAGG + Intergenic
1090580417 11:128152921-128152943 GGGGAGGGAAGGAGGGAGAGAGG + Intergenic
1090615126 11:128507268-128507290 GGAGAGGGAAGGAGAGGGAGCGG + Intronic
1091710525 12:2737162-2737184 GAGGATTGAATGAGAGGGAGGGG - Intergenic
1091915905 12:4271850-4271872 GGGGAGGGAAGGGGCGGGCGAGG - Intergenic
1091916329 12:4273656-4273678 GAGGAGGGGAGGACCGGGAGGGG + Intergenic
1091968674 12:4767102-4767124 GCCTGGTGAAGAAGCGGGAGGGG - Intronic
1092103185 12:5902701-5902723 GGGGAGGGGAGGAGGGGGAGGGG + Intronic
1092204614 12:6607345-6607367 GCGGCGAGGAGGAGCCGGAGCGG - Exonic
1092341525 12:7680653-7680675 GTCGAGTGAAGCAGTGGGAGTGG + Intergenic
1092902968 12:13076896-13076918 AGGGAGTGCAGGAGTGGGAGAGG + Intronic
1092927014 12:13280457-13280479 GGGGAGTGATGGAGGGGCAGAGG - Intergenic
1093038333 12:14354034-14354056 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1094166882 12:27452339-27452361 GGAGGGTGAAGGAGTGGGAGGGG - Intergenic
1096039592 12:48501515-48501537 GTGGGGAGAAGGAGAGGGAGAGG + Intergenic
1096489870 12:52007496-52007518 GAGGAGTCAAGGAGGGAGAGAGG - Intronic
1096609217 12:52789997-52790019 GCGGAGGGGAGGCGCTGGAGTGG + Exonic
1096668118 12:53180662-53180684 GCGGAGAGGACGAGGGGGAGGGG + Intronic
1096745169 12:53722076-53722098 GCCGAGTGCAGGAGCTCGAGAGG - Exonic
1096780954 12:53991857-53991879 GGGGAGGGTAGGAGTGGGAGAGG - Intronic
1097713095 12:62935771-62935793 GTCAAGTGAAGCAGCGGGAGTGG - Intergenic
1098333295 12:69375889-69375911 GCGCAGAGAGGGAGGGGGAGGGG + Intronic
1100317707 12:93460734-93460756 GTCAAGTGAAGCAGCGGGAGTGG + Intergenic
1101332507 12:103768556-103768578 GCGGAGGGAGAGAGAGGGAGGGG + Intergenic
1101868138 12:108538356-108538378 GGGGAGTGGAGGAGAAGGAGAGG + Intronic
1102167878 12:110820793-110820815 GGGGAGAGAAGGAGGGGGTGAGG - Intergenic
1102781625 12:115570552-115570574 GGGGAGGGACGGAGGGGGAGAGG + Intergenic
1102976045 12:117207820-117207842 GACCAGGGAAGGAGCGGGAGCGG - Intergenic
1103341779 12:120224740-120224762 GCGGAGAGAATGGGCGGGAGGGG + Intronic
1104341953 12:127958622-127958644 GTCAAGTGAAGCAGCGGGAGTGG + Intergenic
1104749900 12:131231764-131231786 GCGGAGGGGAGGAGGAGGAGGGG - Intergenic
1105235752 13:18551677-18551699 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1107851642 13:44577345-44577367 GCGGAGCGCAGGAGGAGGAGGGG + Intergenic
1108350212 13:49585196-49585218 GAGGAGGGAAGGATGGGGAGAGG - Intronic
1108535393 13:51371345-51371367 GCTGAGTTAAGGAGCAGTAGCGG - Intronic
1108960247 13:56217789-56217811 GCAGAGTTTAGGAGCAGGAGAGG + Intergenic
1110306016 13:73987682-73987704 GAGGAGAGAAGAAGTGGGAGAGG + Intronic
1110306038 13:73987774-73987796 GGGGAGAGAAGAAGTGGGAGAGG + Intronic
1111230806 13:85341559-85341581 GAGGGGTGGAGGAGGGGGAGGGG + Intergenic
1112181974 13:97091929-97091951 GGGGAGGGAAGGAGGAGGAGAGG + Intergenic
1113049651 13:106196267-106196289 AAGGAGGGAAGGAGAGGGAGAGG + Intergenic
1113654210 13:112057956-112057978 GCGGAAAGAGGGAGCGGAAGCGG - Intergenic
1113655839 13:112067518-112067540 GCGGAGAGAAGAATGGGGAGGGG - Intergenic
1113909932 13:113836870-113836892 GGGGAGAGGAGGAGGGGGAGTGG + Intronic
1114265687 14:21071361-21071383 GCAGAGTGGAGGAGGGGGAGAGG + Intronic
1115259255 14:31436857-31436879 GTGGAGTGGAGGGGGGGGAGAGG - Intronic
1115761220 14:36580690-36580712 GTGGAGGGAAGGTGAGGGAGGGG + Exonic
1115790027 14:36868092-36868114 GCGGAGAAAAGGAGGGAGAGAGG + Intronic
1116342541 14:43743258-43743280 GAGAAGAGAAGGAGGGGGAGAGG - Intergenic
1116408956 14:44600799-44600821 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
1116731371 14:48626273-48626295 GGGGAGAGCAGAAGCGGGAGAGG + Intergenic
1117334223 14:54743143-54743165 TCTGAGTGATGGAGTGGGAGTGG + Intronic
1117548859 14:56814029-56814051 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1118565034 14:67130260-67130282 GAGGAGGGAAGGAGGGAGAGGGG - Intronic
1118797060 14:69153156-69153178 TCGGGGGGAAGGAGAGGGAGGGG - Intergenic
1119003863 14:70907400-70907422 GCGGAGAGGAGGAGCTGGAGGGG + Exonic
1119033432 14:71210376-71210398 GAGGAGTGAGGCAGCAGGAGGGG - Intergenic
1119052004 14:71377998-71378020 GTGGAAAGAAGGAGAGGGAGAGG + Intronic
1119762038 14:77158397-77158419 AGGGAGTGAAGGAGTGAGAGAGG + Intronic
1119862805 14:77948790-77948812 GGGGAGGGAAGGAGGGGGTGGGG - Intergenic
1120223105 14:81757909-81757931 AAGGAGAGAAGGAGCAGGAGAGG - Intergenic
1120525578 14:85573235-85573257 TAGGAGTGAAGGGGTGGGAGAGG - Intronic
1120610573 14:86636446-86636468 GTGGAGGGAAGGAGAGGGAGAGG + Intergenic
1120811712 14:88810582-88810604 GGGGAGGGAAGGAGAGGGAGAGG - Intergenic
1121620242 14:95341749-95341771 GTGGAGTGAATGAGGCGGAGAGG + Intergenic
1122268109 14:100556175-100556197 GGCCAGTGAAGGAGGGGGAGGGG - Intronic
1122447840 14:101782065-101782087 GGGGAGAGAGGGAGTGGGAGAGG - Intronic
1122447893 14:101782204-101782226 GAGGAGAGAGGGAGGGGGAGGGG - Intronic
1122448012 14:101782522-101782544 GAGGAGAGAGGGAGGGGGAGGGG - Intronic
1122448231 14:101783151-101783173 GGGGAGAGAGGGAGGGGGAGGGG - Intronic
1122629247 14:103099740-103099762 GGGCAGTGAAGGAGCTGGTGGGG + Intergenic
1123820836 15:24028883-24028905 GCCAAGTGAAGCAGTGGGAGTGG + Intergenic
1124295604 15:28500410-28500432 GAGGAGAGAAGGAAGGGGAGGGG + Intergenic
1124439165 15:29674711-29674733 GCGGAGGGAAGGAGGGGGTGTGG + Intergenic
1124696860 15:31870702-31870724 GCGGAGCGGAGGGGCGCGAGGGG - Intronic
1125397108 15:39261033-39261055 GAGGAGAGAAGAAGGGGGAGGGG + Intergenic
1125462883 15:39922791-39922813 GCCAAGTGAAGCAGTGGGAGTGG + Intergenic
1125725906 15:41868040-41868062 GCGGAGTGTGAGGGCGGGAGGGG + Intronic
1125868316 15:43075970-43075992 GTGGAGAGAGGGAGAGGGAGAGG - Intronic
1126183302 15:45806988-45807010 GCTGAGTGAAGGATGGAGAGTGG + Intergenic
1126725199 15:51624262-51624284 GGGGAGGGAAGGGGAGGGAGGGG - Intergenic
1126752104 15:51886710-51886732 GTGGAGAGAGGGAGAGGGAGAGG + Intronic
1127165648 15:56243370-56243392 GGGGAGAGGAGGAGGGGGAGGGG + Intergenic
1128146271 15:65334093-65334115 GCTGAGTGATGGGGAGGGAGGGG - Intronic
1128264338 15:66253826-66253848 TGGGAGGGAAGGAGAGGGAGGGG - Intergenic
1128750303 15:70143975-70143997 GGGGAGTGAAGTAGTGGGAAAGG + Intergenic
1128930186 15:71697334-71697356 GGGGAGTGAAGGAGCCGGCTGGG + Intronic
1132045236 15:98557918-98557940 GCGGAAGGAAGGAGTGGGATTGG + Intergenic
1132105292 15:99058955-99058977 GCGGAGGGAGGGCGGGGGAGGGG - Intergenic
1132169929 15:99640508-99640530 AGGGAGTGAAGGAGGGAGAGAGG - Intronic
1132618216 16:852669-852691 GCGGGGTGAAGGAGCCCGGGAGG + Intergenic
1132773976 16:1581723-1581745 GGGGAGGGGAGGAGCGGGGGAGG + Intronic
1133013068 16:2925489-2925511 TCAGAGCGAGGGAGCGGGAGGGG + Intronic
1133064674 16:3197672-3197694 GGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1133485465 16:6214873-6214895 GAGGGGAGAAGGAGAGGGAGTGG + Intronic
1133485514 16:6215042-6215064 GAGGGGAGAAGGAGAGGGAGAGG + Intronic
1133520218 16:6549352-6549374 GAGGAGGGAAGGAGGAGGAGGGG + Intronic
1133624464 16:7557783-7557805 GGTGGGGGAAGGAGCGGGAGAGG + Intronic
1135158770 16:20075132-20075154 GCGTTGGGAAGCAGCGGGAGTGG - Intergenic
1135302838 16:21345769-21345791 GCGGAGAGGGGGAGGGGGAGGGG - Intergenic
1135405520 16:22194895-22194917 GCCAAGTGAAGGCGTGGGAGGGG - Intergenic
1135724053 16:24840936-24840958 GAGGAGGGGAGGAGGGGGAGGGG + Intergenic
1135861400 16:26059161-26059183 GCAGAGTGGAGGCGAGGGAGAGG + Intronic
1135927693 16:26709840-26709862 GGGGAGGGAGGGAGGGGGAGGGG + Intergenic
1136187672 16:28597580-28597602 GCAGAGTGAAGGGGCAGGGGTGG + Intergenic
1136190151 16:28610560-28610582 GCAGAGTGAAGGGGCAGGGGTGG + Intronic
1136299586 16:29324963-29324985 GCGGAGAGGGGGAGGGGGAGGGG - Intergenic
1136316755 16:29459055-29459077 GCAGAGTGAAGGGGCAGAAGTGG - Intergenic
1136344692 16:29667059-29667081 ACGGAGGGAGGGAGCGGGAAGGG + Exonic
1136431330 16:30198397-30198419 GCAGAGTGAAGGGGCAGAAGTGG - Intronic
1136532856 16:30881670-30881692 GCGGAGGGAGGGAGGGGCAGGGG - Intronic
1137244594 16:46692000-46692022 AAGGAGAGAAGTAGCGGGAGTGG - Intronic
1137673186 16:50291264-50291286 GTGGACTGAAGGGGAGGGAGAGG + Intronic
1138306582 16:55982172-55982194 GGGGAGTGAAGGTGGGGGAAGGG - Intergenic
1138740697 16:59306052-59306074 GAAGATTGAAGGAGCAGGAGAGG - Intergenic
1139136081 16:64206225-64206247 GCGGAGTGGTGGAGGGGGTGGGG + Intergenic
1139390561 16:66604637-66604659 GCGGGCTGGAGGAGCGGGTGGGG + Intronic
1139864014 16:70050322-70050344 GTGGAGAGAGGGAGGGGGAGGGG - Intergenic
1140205277 16:72928119-72928141 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205286 16:72928138-72928160 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205295 16:72928157-72928179 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205304 16:72928176-72928198 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140393216 16:74606465-74606487 GGGGAAAGAAGGAGTGGGAGTGG + Intronic
1140579042 16:76206924-76206946 GCTCAGTGAAGGAGAGGGACAGG + Intergenic
1140661751 16:77195558-77195580 GCAGAGAGGAGGAGCGGCAGCGG + Exonic
1141469507 16:84228875-84228897 CCGGAGGGCAGCAGCGGGAGAGG - Intronic
1141728914 16:85809015-85809037 GGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1141897933 16:86970569-86970591 GCTGAGTGAAGCTGCGGCAGGGG + Intergenic
1141999903 16:87658341-87658363 GCGGGGAGAAGGAGAGAGAGAGG - Intronic
1142221323 16:88856590-88856612 GCGGGGAGGAGGAGGGGGAGGGG - Intronic
1142762151 17:2049050-2049072 GGGGAGTGAAGGAGGGGGTGGGG + Intergenic
1142863875 17:2778806-2778828 GGGGTTTGAAGGAGAGGGAGGGG + Intronic
1143009868 17:3860157-3860179 GCGGAGGGAGGGAGAGGGAAGGG - Intergenic
1143262042 17:5606728-5606750 TGGCAGTGAAGGAGGGGGAGGGG + Intronic
1143342619 17:6225637-6225659 GTGGGGAGAAGGAGAGGGAGCGG - Intergenic
1143485553 17:7251812-7251834 GAGCAGGGAAGGAGGGGGAGGGG + Intronic
1143563806 17:7709679-7709701 GAGGAGTGAAGGGGCTGGGGGGG - Exonic
1143872319 17:9965851-9965873 GCTGAGTGAAGGAGCGGGGCAGG + Intronic
1144604382 17:16652013-16652035 GAAGGGTGAAGGAGTGGGAGGGG + Intronic
1144693902 17:17288251-17288273 GAGGAGTGGGGGAGGGGGAGGGG + Intergenic
1145741131 17:27275609-27275631 GTGGAGTCCAGGAGCGGAAGTGG + Intergenic
1146496340 17:33325761-33325783 GTGGATTGAAGGAGGGGCAGTGG + Intronic
1146569499 17:33940501-33940523 GTGGAGTGAAGGAGGGAGGGAGG - Intronic
1147200668 17:38799513-38799535 GCGCGGTGAGGGAGCGGGGGTGG - Exonic
1147258987 17:39197712-39197734 GCGGAGGGAGGGAGCGAGGGAGG - Intergenic
1147261725 17:39212940-39212962 GCGGAGGGAGGGAGTGGGCGGGG - Intronic
1147364867 17:39953014-39953036 GCGGAGTGAAGGCGGGGCTGGGG + Intergenic
1147466782 17:40616693-40616715 TCGGAGTGCATGAGGGGGAGAGG - Intergenic
1147738884 17:42659239-42659261 GCGGTGGGCAGGAGCGGGCGTGG + Intergenic
1148348114 17:46917636-46917658 GCCTAGTGAAGCAGCGGGAATGG - Intergenic
1148559202 17:48596399-48596421 GCCGAGTGAAGGTGCTGGAAAGG - Exonic
1148638064 17:49164382-49164404 GCAGAGTCCAGGAGTGGGAGTGG + Intronic
1150438590 17:65173340-65173362 GCTGAGAGAAGGAGGGGCAGGGG + Intronic
1150477942 17:65488460-65488482 GGAGAGAGAAGGAGGGGGAGGGG + Intergenic
1150477951 17:65488482-65488504 GGAGAGAGAAGGAGGGGGAGGGG + Intergenic
1150586708 17:66525120-66525142 TCTGAGTGAAGAAGCAGGAGTGG - Intronic
1150947609 17:69765398-69765420 GGGGAGGGAAGAAGGGGGAGGGG - Intergenic
1151000352 17:70368911-70368933 GCAGAGTGAAGGTGGGGGGGTGG + Intergenic
1151445602 17:74161472-74161494 GCGGGTGCAAGGAGCGGGAGAGG - Intergenic
1152479088 17:80538041-80538063 GTGGGGAGAGGGAGCGGGAGCGG + Intergenic
1152559569 17:81071212-81071234 GCAGAGAGAAGGGGCGGGATTGG + Intronic
1152778342 17:82215676-82215698 GGGCAGGGAAGGAGGGGGAGGGG - Intergenic
1152778359 17:82215715-82215737 GGGCAGGGAAGGAGGGGGAGGGG - Intergenic
1152884922 17:82844175-82844197 GGGGAGTGGAGGAGTGGGGGTGG + Intronic
1153193906 18:2571918-2571940 GAGGAGTGGAGGCTCGGGAGAGG + Intronic
1153636312 18:7116979-7117001 GCGCAGTGAATGAGCGGGTTTGG + Intronic
1154513788 18:15138321-15138343 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
1156076731 18:33288218-33288240 GCGGAGGGGAGGAGGAGGAGAGG - Intronic
1156776210 18:40792422-40792444 GGGAAGTGAAGGAAGGGGAGGGG - Intergenic
1157214697 18:45773168-45773190 GGAGAGGGAAGGAGGGGGAGAGG - Intergenic
1157239682 18:45997647-45997669 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1157392516 18:47314683-47314705 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1157570199 18:48707105-48707127 GGGGAGTGCAGGAGGTGGAGGGG + Intronic
1158259033 18:55587874-55587896 GGGGAGGGAAGCGGCGGGAGGGG + Intronic
1158413548 18:57229851-57229873 GGGGAGTGGGGGAGCTGGAGAGG + Intergenic
1158531487 18:58266548-58266570 ATGGAGTGAAAGAGCTGGAGTGG - Intronic
1158649435 18:59273012-59273034 GGGGCGCGAAGGAGCGGGATAGG - Exonic
1159351839 18:67285478-67285500 GCGGAGTATAAGAGGGGGAGAGG - Intergenic
1159468837 18:68822976-68822998 GGGGAGTGTGGGGGCGGGAGGGG - Intronic
1159550890 18:69894611-69894633 GGGGAGGGAAGGAAGGGGAGGGG + Intronic
1160158251 18:76450334-76450356 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1160204385 18:76821690-76821712 GAGGAGGGAAGGAGGGAGAGAGG + Intronic
1160295018 18:77630000-77630022 AAGGAGGGAAGGAGGGGGAGAGG - Intergenic
1160736152 19:663244-663266 GCGGAGCGGGGGCGCGGGAGCGG + Exonic
1160789513 19:917154-917176 TCGGAGTGAGAGCGCGGGAGGGG - Intergenic
1160970662 19:1766441-1766463 GGGGAGAGAAGGAGGAGGAGGGG + Intronic
1160994405 19:1876025-1876047 GCCGAGGGAAGGAGTGAGAGCGG + Intergenic
1161195587 19:2984375-2984397 GCGGAGGGAGGGGCCGGGAGGGG - Intronic
1161470871 19:4456282-4456304 GCTGAGTGAGGGAGGGAGAGGGG - Intronic
1161718368 19:5890103-5890125 GGGGAGGGGAGGAGAGGGAGGGG + Intronic
1161809522 19:6464144-6464166 GCGGAGTCAAGAAGGGGGCGGGG - Intronic
1161812765 19:6479950-6479972 TGGGAGTGAGGGAGTGGGAGGGG - Intronic
1161894999 19:7073725-7073747 GGGGAGAGAAGGATTGGGAGAGG - Intronic
1161988424 19:7670155-7670177 GCTGAGGGTGGGAGCGGGAGGGG - Intronic
1162024277 19:7884704-7884726 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1162038177 19:7953562-7953584 GAGGAGAGAAGGAGGAGGAGGGG - Intergenic
1162313293 19:9920460-9920482 GAGGAGTGATGGAGAAGGAGGGG - Intronic
1162751707 19:12833720-12833742 GCGGGGGGAAGGGGCGGGCGGGG - Intronic
1162795124 19:13083037-13083059 GAGGAGGAAAGGAGCAGGAGGGG - Intronic
1162962565 19:14136555-14136577 TCGGAGAGAAGAGGCGGGAGTGG - Exonic
1163061244 19:14763822-14763844 GAGGAGAGAAGGAGGAGGAGAGG - Intronic
1163138860 19:15332687-15332709 GCAGAGCGAAGGAGCGGGCTGGG + Intergenic
1163297160 19:16419859-16419881 GAGCAGAGAAGGGGCGGGAGTGG - Intronic
1163351136 19:16777383-16777405 GGGGAGGGAAGGAGAGGGAAAGG + Intronic
1163527669 19:17831134-17831156 GGGGAGCAAAGCAGCGGGAGGGG + Intronic
1163720624 19:18896522-18896544 CCGGGGCGATGGAGCGGGAGCGG - Intronic
1164234892 19:23323344-23323366 GAGGAGGAAAGGAGGGGGAGAGG - Intronic
1164444422 19:28305113-28305135 GCTGAGTGAGGGAGAGAGAGAGG - Intergenic
1164549304 19:29195042-29195064 GCAGAGTGAAGAAGGGGGCGGGG + Intergenic
1164572197 19:29382638-29382660 GGGCAGGGAAGGAGCGTGAGGGG - Intergenic
1164730991 19:30504393-30504415 GAGGAGAGAAGGAGGGAGAGAGG - Intronic
1165063580 19:33216640-33216662 GCGGAGGGAAGGAAAGGGAAGGG - Intronic
1165358316 19:35317851-35317873 GTGGAGTGATGGAGCCAGAGTGG + Intergenic
1165482079 19:36070033-36070055 GTGGGGAGAAGGAGAGGGAGAGG + Intronic
1165796477 19:38522996-38523018 GCGGAGGGGAGGTGAGGGAGGGG - Intronic
1165889342 19:39101123-39101145 GCAGGGTGAATGAGCGGGTGAGG - Intronic
1166297834 19:41897403-41897425 AGGGAGTGAAGGGGAGGGAGTGG - Intronic
1166347877 19:42177435-42177457 GGGGAGAGAGGGAGAGGGAGAGG + Intronic
1166976709 19:46609100-46609122 GTGGAGTGAAGCAGAGAGAGAGG - Intronic
1167249771 19:48393719-48393741 GCGGCTTGGAGGAGCTGGAGCGG - Intergenic
1167698784 19:51030243-51030265 GGGGAATGGAGGAGGGGGAGGGG - Intronic
1168349904 19:55669778-55669800 GCGGAGAAGAGGAGGGGGAGAGG - Intronic
925082747 2:1082647-1082669 CCGGAGTGCAGGAGCAGGGGTGG - Intronic
927714247 2:25342025-25342047 GCGGAGAGAAGGGGTGGGAGGGG - Intronic
927997363 2:27495285-27495307 CGGGAGTGAGGGGGCGGGAGGGG - Intergenic
928899641 2:36303407-36303429 GCGAAATGAAGTAGGGGGAGGGG + Intergenic
930462992 2:51707838-51707860 GGGGAGGGAAGGAAAGGGAGGGG - Intergenic
930667741 2:54115962-54115984 GGGAAGTGGGGGAGCGGGAGAGG + Intronic
933708469 2:85308470-85308492 AGGGAGGGAAGGAGGGGGAGAGG - Intronic
935230283 2:101090034-101090056 GAGGAGGGAAGGAGAGGGAAGGG + Intronic
935626320 2:105175027-105175049 GCTGAATGATGGAGAGGGAGAGG - Intergenic
935673601 2:105575883-105575905 GCGGAGAGAAGGAAAGGGAGAGG + Intergenic
936520599 2:113210035-113210057 GAGGAGTGGAGGCGGGGGAGGGG - Intergenic
937128644 2:119490414-119490436 GGAGAGTGCAGGAGCGGGAAGGG - Intronic
937595268 2:123664597-123664619 GTGGAGTGAAGGAGGGGTAGTGG + Intergenic
938514031 2:131982932-131982954 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
938612891 2:132967581-132967603 GGGGAGAAAAGGAGGGGGAGAGG + Intronic
939110358 2:137999395-137999417 GTGGAGGGAAGGAGGGAGAGTGG - Intronic
939480587 2:142742813-142742835 GGGGAGAGAAGGAGAGGGTGGGG - Intergenic
939767366 2:146267407-146267429 GGGGGGTGAAGGAGGGTGAGAGG + Intergenic
940228091 2:151421461-151421483 GTGGAGTGAATGAGAGTGAGAGG + Intronic
940322226 2:152389681-152389703 GCGGAGAGCAGGAGGAGGAGCGG + Intronic
941350347 2:164425178-164425200 GGAGAGAGAGGGAGCGGGAGAGG - Intergenic
941772576 2:169361103-169361125 CGGGAGGGAAGGAGCAGGAGGGG + Intronic
942246460 2:174013078-174013100 GAGGAGAGAGGGCGCGGGAGGGG - Intergenic
942249546 2:174036069-174036091 GTGGAGTGGAGGAGGGGGAACGG - Intergenic
943278278 2:185896900-185896922 GAGGAGGGAGGGAGGGGGAGAGG + Intergenic
944403955 2:199361041-199361063 GAGGAGAGCAAGAGCGGGAGAGG - Intronic
944613635 2:201437325-201437347 GAGGAGAGAAGGAGAGAGAGAGG - Intronic
945190306 2:207180768-207180790 GCAGAGAGAAGGAGGGGCAGTGG - Intergenic
945235030 2:207625470-207625492 GAGGAGTGACGTTGCGGGAGGGG + Intronic
946305515 2:218855004-218855026 GGGGAGTGATGGAGGGAGAGTGG - Intergenic
947159110 2:227193973-227193995 GGGGAGAGAAGGAGAAGGAGAGG + Intronic
947987149 2:234458472-234458494 GCGGGGGGAAGGAGAGAGAGGGG - Intergenic
948190159 2:236052027-236052049 GCGGAGTGGGGCAGAGGGAGCGG - Intronic
948266359 2:236637931-236637953 GAGGAGGGAAGGAGGTGGAGAGG - Intergenic
1168889418 20:1284743-1284765 GCAGAGTGAATGAGGGGGAGAGG + Intronic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1169370657 20:5026904-5026926 GTGGGGTGAGGGAGAGGGAGAGG - Intergenic
1170545972 20:17436213-17436235 GGGCAGTGCAGGAGCGGGTGGGG - Intronic
1171861053 20:30404161-30404183 GAGGGGAGAAGGAGAGGGAGAGG - Intergenic
1171900063 20:30847952-30847974 GGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1174298970 20:49568356-49568378 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1175356831 20:58375295-58375317 GAGGAGAGAAAGAGAGGGAGGGG - Intergenic
1175394810 20:58650878-58650900 GCGGGGAGTTGGAGCGGGAGAGG - Intergenic
1175774986 20:61647558-61647580 GGGGAGGGAGGGAGAGGGAGAGG - Intronic
1175881414 20:62261581-62261603 GGGGAATGCAGGAGCGGGGGTGG - Intronic
1175891635 20:62318368-62318390 GGGGAGGGGAGGAGCCGGAGAGG + Intronic
1176047804 20:63101700-63101722 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1176107313 20:63395552-63395574 CTGGAGGGAAGGAGGGGGAGCGG + Intergenic
1176125539 20:63472996-63473018 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1176231650 20:64036115-64036137 GCTGAGGGAGGGAGCAGGAGAGG - Intronic
1176779753 21:13179963-13179985 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1177977398 21:27868998-27869020 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1178100343 21:29261468-29261490 GAGGAGGGAAGGAGAGAGAGAGG + Intronic
1179084891 21:38207709-38207731 GGGGAGAGAAGGAGGAGGAGGGG - Intronic
1180156701 21:45981686-45981708 GGGGAGGGGAGGGGCGGGAGGGG - Intergenic
1181528293 22:23502332-23502354 GGGGATGGAAGGAGGGGGAGGGG - Intergenic
1181552032 22:23645357-23645379 GGGGAGGGAAGGAGGGGGAAGGG - Intergenic
1181924721 22:26348873-26348895 GGGGAGTGAAGGGGAGGGAGGGG + Intronic
1182469923 22:30542304-30542326 GGGGAGTGGAGGCGCGGGGGTGG - Intronic
1182671275 22:31997939-31997961 TAGGAGTGAAGCAGGGGGAGAGG + Intergenic
1183108338 22:35630299-35630321 GAGGAGGGAAGGAGGCGGAGGGG + Intronic
1183264478 22:36816879-36816901 GCGGAGTGCAGGGGCGCGGGCGG + Intronic
1183466925 22:37984580-37984602 GGGGAAGGAAGGAGGGGGAGAGG + Intronic
1183472429 22:38016730-38016752 GCGGGGGGAGGGGGCGGGAGGGG + Intronic
1183650860 22:39152589-39152611 GCGGCGTGAGGGAGCGCGAGGGG - Exonic
1183706978 22:39480272-39480294 GTGGTGGGAAGGAGCTGGAGAGG + Intronic
1184004314 22:41697361-41697383 GCGGAGTCCAGGAGCTGGTGTGG + Exonic
1184179114 22:42807414-42807436 TCGGAGTGAGGGAGGGAGAGCGG + Intronic
1184436875 22:44484597-44484619 GCGGCTTGGAGGAGCGGGAAAGG + Intergenic
1184858498 22:47160137-47160159 GCTGTGTGAAGGAGAAGGAGCGG - Intronic
1185244315 22:49765194-49765216 GATGAGTGAAGGAGGAGGAGAGG + Intergenic
950215215 3:11154306-11154328 GCGGAGAGAGGGGGCGCGAGGGG - Intronic
950675333 3:14551009-14551031 GGGGAGTGAGTGAGCGGGAGGGG + Intergenic
952651783 3:35736293-35736315 GTGCAGTCAAGGAGCGGGTGTGG - Intronic
953536858 3:43783213-43783235 GCTGAGTCAAGGAGTGGGAGGGG + Intergenic
954593088 3:51800931-51800953 GCAGAGTAAGGGAGGGGGAGAGG + Intergenic
957078773 3:75620301-75620323 GGGGAGGGAGGGAGGGGGAGCGG - Intergenic
957485401 3:80855322-80855344 TCAGAGTGAAGGAAGGGGAGTGG - Intergenic
958431197 3:94043610-94043632 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
958431209 3:94043630-94043652 GGGGAGGGAAGGAGAGGGAGGGG - Intronic
958641892 3:96815016-96815038 ACGGGGCGGAGGAGCGGGAGTGG + Intronic
958814473 3:98901212-98901234 AGGGAGGGAGGGAGCGGGAGAGG + Exonic
961517380 3:127446365-127446387 CCAGAGTGAAGGAGCAGAAGTGG + Intergenic
961804535 3:129479813-129479835 GCGGAGTGAAGGAGCGGGAGTGG + Exonic
962002896 3:131317789-131317811 GAGGAGAGAAGGAGGAGGAGAGG + Intronic
962002904 3:131317803-131317825 GAGGAGAGGAGGAGGGGGAGGGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966904785 3:184514127-184514149 GAGGAGTGAAGGACGGGGAGGGG - Intronic
967033636 3:185631459-185631481 GGGGAGGGAGGGAGGGGGAGGGG - Exonic
968132988 3:196202870-196202892 GCAGAGTAGAGCAGCGGGAGTGG + Intronic
968299713 3:197603206-197603228 GTGGGGAGAGGGAGCGGGAGAGG + Intergenic
968944647 4:3657277-3657299 GCAGAGAGGGGGAGCGGGAGAGG - Intergenic
969543956 4:7811681-7811703 GCCGTGTGAAGGCGCGGGAGGGG + Intronic
969647771 4:8442825-8442847 GAGGAGAGAAGCAGCAGGAGAGG - Intronic
969979005 4:11135049-11135071 GGGGAATGGAGGAGGGGGAGAGG - Intergenic
971111672 4:23592358-23592380 GGGGAGGGAGGGAGGGGGAGGGG - Intergenic
971251428 4:24976020-24976042 AGGGAGGGAAGGAGAGGGAGGGG + Intronic
971406103 4:26321534-26321556 GCGGAGGGGAGGAGATGGAGAGG - Intronic
972437095 4:39044901-39044923 GCCGCCTGACGGAGCGGGAGTGG + Intergenic
972709978 4:41586069-41586091 GGGGAGGGGAGGAGAGGGAGCGG - Intronic
973551261 4:52038182-52038204 GCGGGCTGGAGGAGCGGGGGAGG - Intronic
973711101 4:53631202-53631224 TGAGAGTGAAGGATCGGGAGTGG + Intronic
974849273 4:67385621-67385643 GAGGGGGGAAGGAGGGGGAGGGG + Intergenic
976266165 4:83186987-83187009 GAGGGGAGAAGGAGAGGGAGGGG + Intergenic
977204942 4:94157266-94157288 GCGGAGAGGGGGAGGGGGAGGGG - Intergenic
977730415 4:100344455-100344477 GTGGAGAAAAGGGGCGGGAGAGG + Intergenic
979301454 4:119092213-119092235 GAGGAGTGAAGGTGTGGGGGTGG - Intergenic
983155055 4:164336998-164337020 GAGGAGGGAAGGAGGGAGAGGGG + Intronic
983252726 4:165363126-165363148 AGGGAGTGAAGGAGAGGGACAGG - Intronic
984703439 4:182833035-182833057 GGGGAGAGGAGGAGGGGGAGAGG - Intergenic
984863168 4:184257547-184257569 AAGGAGGGAAGGAGTGGGAGTGG + Intergenic
985129069 4:186723797-186723819 GCGGGGAGAGGGCGCGGGAGCGG - Exonic
985140979 4:186840523-186840545 GAGGAGAGAAGGAGAGGGAGTGG - Intergenic
985836701 5:2277157-2277179 GAGGAGTGAAGGAGCTGGCAGGG - Intergenic
985927789 5:3031123-3031145 CAGGAGTGGAGGGGCGGGAGTGG - Intergenic
985957829 5:3277588-3277610 GGGGAGGGAAGGGGAGGGAGGGG + Intergenic
986588261 5:9341464-9341486 GGAGAGTGAGGGAGCAGGAGGGG + Intronic
986995405 5:13601859-13601881 GGGGAGTGAAGAAGCAGGATAGG - Intergenic
988440464 5:31227269-31227291 GTGGAGTGGAGGAGAGGGTGAGG - Intronic
988578070 5:32445174-32445196 GCGGAGGGAGGGAGAAGGAGAGG + Intergenic
988680673 5:33481144-33481166 GGGGAGGGGAGGAGCTGGAGGGG - Intergenic
989648945 5:43666603-43666625 AGGGAGAGAAGGAGAGGGAGAGG + Intronic
990043301 5:51398247-51398269 AGGGAGCGAAGGAGGGGGAGGGG + Intergenic
990148356 5:52788204-52788226 GCGGCGCCCAGGAGCGGGAGAGG - Exonic
990485901 5:56258846-56258868 GGGGAGAGAGGGAGGGGGAGGGG + Intergenic
990871197 5:60432084-60432106 GTGGGGAGAAGGAGAGGGAGAGG + Intronic
990955578 5:61334914-61334936 GCGGAGTCAAGCACAGGGAGAGG - Intronic
991187639 5:63828895-63828917 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
991597032 5:68316315-68316337 GAGAAGTGAAAGAGAGGGAGAGG + Intergenic
992151571 5:73909659-73909681 GCTGGCTGCAGGAGCGGGAGCGG + Exonic
993496440 5:88615219-88615241 GTGGGGAGAGGGAGCGGGAGAGG - Intergenic
993503258 5:88684856-88684878 GAGGAGAGAGGGAGGGGGAGAGG + Intergenic
995123785 5:108560124-108560146 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
996053948 5:118964394-118964416 GTGGGGAGAAGGAGAGGGAGAGG - Intronic
998010408 5:138690573-138690595 GGGGAGGGGAGGAGAGGGAGAGG - Intronic
999157843 5:149471341-149471363 GGGGAGTGACGGAGCGCTAGAGG + Intergenic
999240336 5:150124107-150124129 GCGCAGTGAGGGCGCTGGAGCGG + Intronic
999397341 5:151238450-151238472 GAGGAGCCAGGGAGCGGGAGGGG + Intronic
1002917667 6:1542046-1542068 GGGGAGGGAAGGAGGGAGAGAGG + Intergenic
1003427505 6:6007394-6007416 GGGGTTTAAAGGAGCGGGAGAGG + Intronic
1003778774 6:9399023-9399045 TCGGAGGGAAGGAGGAGGAGAGG - Intergenic
1004233325 6:13852033-13852055 GAGGAGGGGAGGAGAGGGAGAGG - Intergenic
1004932586 6:20476498-20476520 GTGGAGAGAAGGAGAGAGAGGGG - Intronic
1005595502 6:27375042-27375064 GCGGCCAGAAGGAGCGGGTGGGG - Intronic
1005607227 6:27486426-27486448 GTGGGGTGAGGGAGAGGGAGAGG + Intergenic
1006014350 6:31068088-31068110 GCGGGGAGAGGGAGAGGGAGAGG + Intergenic
1006203738 6:32320823-32320845 GTGGAGGGTGGGAGCGGGAGAGG - Intronic
1007413516 6:41678813-41678835 GCGCATGGAAGGAGAGGGAGGGG - Intergenic
1007759855 6:44127519-44127541 GCGGGGGGAGGGAGGGGGAGGGG - Intronic
1008869931 6:56261156-56261178 GCAGAGTGAGGGAGAGGGAGAGG - Intronic
1008966674 6:57319696-57319718 GAGGAGTGAGGGAGCAGGTGTGG + Intronic
1009940379 6:70282486-70282508 GCGGGCTGGAGGAGCGGGAGAGG + Intronic
1010062874 6:71645457-71645479 GGGGAGAGAAGGAGCGAGAAAGG + Intergenic
1011632376 6:89339627-89339649 GAGGAGGGAAGGAGTGGGGGAGG + Intronic
1011714159 6:90086758-90086780 GCGGAGTGGCAGAGCAGGAGAGG + Intronic
1012137481 6:95577455-95577477 GCGGGGTCACGGAGCGGGCGGGG - Intergenic
1013239400 6:108229422-108229444 GGGGAGGGAGGGAGGGGGAGAGG - Intronic
1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG + Intronic
1014226607 6:118855518-118855540 GAGGAGTGAGGTAGAGGGAGGGG - Intronic
1015222771 6:130824004-130824026 GAGGATTGAGGGAGTGGGAGGGG + Intergenic
1016312703 6:142751634-142751656 GAAGAGTGAAAGAGAGGGAGGGG - Exonic
1017637453 6:156456376-156456398 GAGGAGGGGAGGAGGGGGAGGGG - Intergenic
1018095859 6:160386577-160386599 GCAGAGTGAGGGAAGGGGAGTGG + Intronic
1018346494 6:162904451-162904473 GTGGAGTGAGGGAGCGAGGGAGG + Intronic
1018707166 6:166471321-166471343 GCGGAATGGAGGGGTGGGAGGGG - Intronic
1018818700 6:167356110-167356132 CAGGAGAGAAGGGGCGGGAGGGG + Intronic
1019183015 6:170204093-170204115 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
1019219593 6:170463451-170463473 GCGGAGGGAAGAAGCGGCTGCGG + Intergenic
1019668839 7:2267331-2267353 GTGGGGTGAGGGAGAGGGAGAGG - Intronic
1019815646 7:3197848-3197870 GGGGAGGGGAGAAGCGGGAGCGG - Intergenic
1020240393 7:6389999-6390021 GAGGAGGGAAGGAGGGAGAGAGG - Intronic
1021450918 7:20783822-20783844 GCGGAGCGGTGGAGAGGGAGAGG - Intronic
1022230909 7:28410922-28410944 GGGGAGTGGTGGAGAGGGAGGGG - Intronic
1022723162 7:32958171-32958193 GCGGAGGGAAGGAACAGGAAAGG - Intronic
1023409471 7:39875146-39875168 GGGGAGTGGAGGATGGGGAGAGG - Intergenic
1023699377 7:42877627-42877649 GGGGAGTGCAGGAGGGGGACTGG - Intergenic
1023732715 7:43207612-43207634 GGGGAGGGAAGGATAGGGAGAGG - Intronic
1024270162 7:47635858-47635880 GAGGAGTGAAGGAGGGAGAAAGG + Intergenic
1024304975 7:47921914-47921936 GGGGAGAGAGGGAGAGGGAGAGG - Intronic
1025043460 7:55668875-55668897 GGGGAGTGGAGGATGGGGAGAGG + Intergenic
1025136380 7:56417389-56417411 GGGGAGTGGAGGATGGGGAGAGG + Intergenic
1025139454 7:56450064-56450086 GGGGAGGGAAGGGGGGGGAGGGG - Intergenic
1026238022 7:68545753-68545775 AGGGAGAGAAGGAGGGGGAGGGG - Intergenic
1026308798 7:69166196-69166218 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1027851044 7:83452411-83452433 AGGGAATGAGGGAGCGGGAGAGG - Intronic
1028477587 7:91267402-91267424 GGGGACAGAAGGAGGGGGAGGGG - Exonic
1028862973 7:95675402-95675424 GCAGAGTCAAGGAGCTTGAGTGG - Intergenic
1029141670 7:98415166-98415188 AAGGAATGAAGGAGAGGGAGGGG + Intergenic
1029194245 7:98793612-98793634 GAGGAGGGAGGGAGCTGGAGGGG - Intergenic
1029249189 7:99223813-99223835 GGGGAGGGAGGGAGCGGGGGAGG + Intergenic
1029579312 7:101424884-101424906 GTGGAGAGAAGGAGCTAGAGCGG - Intronic
1030045250 7:105489452-105489474 TCAGAGTGAAGGGGCAGGAGTGG - Intronic
1030706522 7:112698077-112698099 GGGGGGTGAGGGAGAGGGAGAGG + Intergenic
1031623218 7:123961301-123961323 GAGGAGAGAAGGATAGGGAGAGG - Intronic
1033116899 7:138633438-138633460 GGTGAGAGAAGGAGCGAGAGAGG - Intronic
1033969835 7:147025441-147025463 GGGGAGGGGAGGAGGGGGAGGGG + Intronic
1033969843 7:147025455-147025477 GGGGAGGGGAGGAGGGGGAGGGG + Intronic
1034551049 7:151820893-151820915 GCCGAGAGAGAGAGCGGGAGTGG - Intronic
1035004544 7:155645090-155645112 GCGGAGAGGAGGAGCGAGAAAGG - Intronic
1035237627 7:157509062-157509084 GGGGAGAGAAGGAGAGAGAGGGG + Intergenic
1035776250 8:2191137-2191159 GAGGAGAGAAGGAGGGAGAGAGG - Intergenic
1035992722 8:4510628-4510650 GAGGAGGGAAGGAAGGGGAGAGG - Intronic
1036539828 8:9695432-9695454 GTGGAGTGAAGAAAGGGGAGAGG + Intronic
1037390619 8:18387677-18387699 GACGAGAGAAGGAGCGGGACCGG - Intergenic
1037608739 8:20458886-20458908 GCGGAGTGGGGGAGTGGGTGTGG - Intergenic
1038040326 8:23718665-23718687 GTGGAGTGAATGAGGGGAAGAGG + Intergenic
1038166261 8:25087976-25087998 GCGGAGGGAAGGGGCAGGGGAGG + Intergenic
1038319420 8:26513920-26513942 GGGGAGGGAAGGAGAGAGAGAGG - Exonic
1039395823 8:37224366-37224388 GAGGAGTGTTGGAGTGGGAGGGG - Intergenic
1039453565 8:37694498-37694520 CCGGAGTGATGGATCGGGACTGG + Intergenic
1039467544 8:37795400-37795422 GTAGAGTGAAGGAGGGGGAACGG + Intronic
1039877023 8:41595763-41595785 ACGGAGTCAAGGAGGGAGAGAGG - Intronic
1040069086 8:43174895-43174917 GGGGAGGGAAGGAGGGGGCGTGG - Intronic
1040917213 8:52574557-52574579 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1041045025 8:53880534-53880556 GCGGGAGGAAGGAGCGGGGGTGG - Intronic
1041208302 8:55521104-55521126 CCGGCGTGAAGGAAGGGGAGGGG + Intronic
1041667024 8:60455745-60455767 GAAGAGGGAAGGAGAGGGAGAGG + Intergenic
1041698137 8:60759386-60759408 GCGGAGAGAGAGAGAGGGAGAGG - Intronic
1042481313 8:69306818-69306840 GGGGAGTGATGGGGTGGGAGAGG + Intergenic
1043417249 8:80063912-80063934 GCAGAGGGAGGGAGGGGGAGGGG + Intronic
1044708566 8:95032710-95032732 TGGGAGTGAGGGAGCAGGAGAGG + Intronic
1044767975 8:95597180-95597202 GAGGAGGGGAGGAGGGGGAGGGG - Intergenic
1044983261 8:97736404-97736426 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1045417059 8:101977975-101977997 GCGGAGAGAAGGAAGAGGAGAGG - Intronic
1045541915 8:103094527-103094549 GTGAAGTGAAGCAGTGGGAGTGG + Intergenic
1048431490 8:134375682-134375704 GAGGAGGGAAGGAAGGGGAGGGG - Intergenic
1049177590 8:141203162-141203184 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049177600 8:141203197-141203219 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049547981 8:143243396-143243418 GGGGAGGGGAGGAGGGGGAGGGG + Intergenic
1050357764 9:4799063-4799085 AAGGAGAGAAGGAGGGGGAGAGG - Intronic
1050523876 9:6528645-6528667 GTCAAGTGAAGCAGCGGGAGTGG - Intergenic
1050985489 9:12076709-12076731 GGAGAGAGAAGGAGGGGGAGGGG - Intergenic
1051642743 9:19238582-19238604 GGGGAGGGGAGGAGGGGGAGGGG - Intronic
1051980148 9:23004520-23004542 GTGGAGTGATGGAGTGGGAGGGG + Intergenic
1052436012 9:28430064-28430086 GGGGAGTCAGGGAGAGGGAGAGG + Intronic
1052493016 9:29190026-29190048 GGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1052930060 9:34048791-34048813 GAAGAGGGAAGGAGAGGGAGAGG + Intronic
1053054712 9:34987789-34987811 GAGGAGTGAGGAAGGGGGAGGGG - Intergenic
1055580731 9:77703833-77703855 GCAAAGTGAGGGAGAGGGAGAGG + Intergenic
1056282772 9:85058140-85058162 GGGGAAGGAAGGAGGGGGAGAGG + Intergenic
1056833407 9:89934553-89934575 AGGGAGGGAAGGAGAGGGAGAGG + Intergenic
1057064326 9:92034406-92034428 GCTGACTGAAGGAGCAGCAGAGG + Intronic
1057553242 9:96067330-96067352 GTGGTGGGAAGGAGCAGGAGGGG - Intergenic
1057842598 9:98498222-98498244 GCTGAGGGAAGGAGGGGGTGGGG + Intronic
1058876782 9:109251682-109251704 GCTGAGTGAATCAGAGGGAGGGG - Intronic
1060528148 9:124332083-124332105 GGGGAGGGAAGGAGAGGGAAGGG + Intronic
1061096161 9:128457620-128457642 GGGGAGGGAAGGAGCGAGGGAGG - Intronic
1061207889 9:129174964-129174986 TGGGAGGGAAGGAGAGGGAGAGG + Intergenic
1061280918 9:129597357-129597379 GAGGAGGGGAGGGGCGGGAGGGG - Intergenic
1061853530 9:133429369-133429391 GTGGAGTCAAGGGGCGGGATGGG - Intronic
1061953232 9:133948149-133948171 GAGCAGTGAATGAGCTGGAGTGG - Intronic
1062074746 9:134579788-134579810 AGGGGGAGAAGGAGCGGGAGGGG + Intergenic
1062074781 9:134579873-134579895 AGGGGGAGAAGGAGCGGGAGGGG + Intergenic
1062321079 9:135990815-135990837 GGGGAGGGAAAGGGCGGGAGGGG - Intergenic
1062321094 9:135990846-135990868 GGGGAGGGAAAGGGCGGGAGGGG - Intergenic
1062329456 9:136031298-136031320 GTGGAGTAAAGGAGAGGGAAGGG - Intronic
1062437208 9:136551568-136551590 GAGGAAGGAAGGAGAGGGAGGGG - Intergenic
1062443062 9:136579647-136579669 ACTGAGTGAAGGAGAGGTAGGGG - Intergenic
1185610796 X:1392718-1392740 GCGGAGTCACGGATCGGCAGCGG - Exonic
1185662042 X:1735632-1735654 GAGGGGGGAAGGAGGGGGAGGGG - Intergenic
1186082353 X:5946818-5946840 GTGGAGGGTAGGAGAGGGAGAGG - Intronic
1186245319 X:7610308-7610330 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1186518498 X:10185384-10185406 GTGGTGTGGAGGAGAGGGAGGGG + Intronic
1188307047 X:28571505-28571527 GAGGAATGAGGGAGCAGGAGGGG + Intergenic
1189146344 X:38658921-38658943 GGGAAGTTAAGAAGCGGGAGAGG - Intronic
1189575798 X:42351921-42351943 GAAGAGTGAGGGAGTGGGAGAGG - Intergenic
1190118933 X:47644750-47644772 GAGGAGGGAGGCAGCGGGAGAGG + Intronic
1190214008 X:48468351-48468373 GTGGAGGGAAGGAGAGGGGGTGG - Intronic
1191721406 X:64231578-64231600 GAGCAGTGAAGGAAGGGGAGGGG - Intergenic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1195803674 X:108737978-108738000 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1201146500 Y:11067777-11067799 GGGGAGGGAGGGAGAGGGAGAGG + Intergenic