ID: 961805221

View in Genome Browser
Species Human (GRCh38)
Location 3:129484276-129484298
Sequence CCTGGGGTGCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 486}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961805221 Original CRISPR CCTGGGGTGCAGAAGGTGGA GGG (reversed) Intronic
900161714 1:1227192-1227214 CCTGGGGTGCAGGAGCAGGTAGG - Intronic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
900623132 1:3596499-3596521 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623151 1:3596543-3596565 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623170 1:3596587-3596609 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623188 1:3596631-3596653 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
901024817 1:6273620-6273642 ACTGGAGTGCAGAAGGTTGACGG - Intronic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
901129419 1:6952980-6953002 CCTGGGGTTCGGAAGGCGGCGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901758527 1:11455914-11455936 CCTGGGGTGCCGAGGATGGCTGG + Intergenic
902701968 1:18178753-18178775 CCTGGGGTGGGGTAGGGGGAAGG - Intronic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
903084548 1:20843801-20843823 ACTGGAGGACAGAAGGTGGAAGG - Intronic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904470429 1:30732395-30732417 CCTGGGGTGATGGAGGTAGAAGG + Intergenic
904851975 1:33466447-33466469 ACTGTGCTGCAGAACGTGGAGGG + Intergenic
905264303 1:36740384-36740406 CCTGGAGAGCAAGAGGTGGATGG + Intergenic
905450698 1:38054199-38054221 CTTGGGGGGTAGCAGGTGGAGGG + Intergenic
905721757 1:40209456-40209478 CCTGGGGTGCAGAACTAGGGAGG + Intronic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
907377472 1:54055618-54055640 CCTAGGTTTCAGAAGGTGGGAGG + Intronic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
908137951 1:61152332-61152354 CCTGGGGTGCAGGAGGCCCAGGG - Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
909255455 1:73415035-73415057 CCTGGAGTCCAGAAGCGGGAGGG - Intergenic
909649269 1:77955394-77955416 CCTTGGGTGCAGGAGCTGGCAGG + Intronic
911529635 1:99029369-99029391 CCAGGTGTGGAGAAGGTGGGAGG - Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
912460129 1:109824899-109824921 CCCTGGGTGCATGAGGTGGAAGG - Intergenic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
914846744 1:151287669-151287691 ACTGGGGGACAGAAGGTGAATGG + Exonic
915042651 1:152981861-152981883 CCTGGCGTGCAGAAGCTGCTTGG - Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
916075987 1:161200232-161200254 CCTGGGGTGGGGAAAGTGGCTGG + Intronic
916563705 1:165955117-165955139 CCTGGGCTCCAGAAGTGGGAGGG - Intergenic
916817467 1:168367706-168367728 CCTGGGGAGCCCAAGGTGGGAGG - Intergenic
916857239 1:168762646-168762668 CGTTGGTTGCAGAAGCTGGAAGG + Intergenic
918708624 1:187700192-187700214 CCAGGGCTGAAGAAAGTGGAGGG + Intergenic
918747307 1:188221143-188221165 TATGGGGTGAATAAGGTGGAGGG + Intergenic
919811620 1:201412375-201412397 CCTGGTGGGCAGAAGTGGGAAGG + Intronic
919860520 1:201736919-201736941 CCTGGGGTGCAGGGAGTGGGGGG - Intronic
920012376 1:202878190-202878212 CCTGGGGTGCAAAAGACTGAGGG + Intergenic
920086655 1:203422398-203422420 CCTGGGGTGAGGACGGAGGAGGG - Intergenic
920184682 1:204152298-204152320 CCTGGGGTGGAGGCGGGGGAGGG + Intergenic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
920609561 1:207423683-207423705 CTTGGGGAGCAGAAGGCGGTCGG - Intergenic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923739930 1:236645910-236645932 CCTGGGGTGCAGCAGGTGACTGG + Intergenic
1062797392 10:354753-354775 TCTGGGGTGCCGAAGGAGGCTGG + Intronic
1063503822 10:6579287-6579309 ACTAGGCTGGAGAAGGTGGAGGG - Intronic
1065971847 10:30812012-30812034 ACCGGGGAGCAGAAGGTGGGGGG - Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067435404 10:46273164-46273186 CCTGGGGTGCAGGGGCTGGCAGG - Intergenic
1067479506 10:46585750-46585772 ACTGTGGTGCAGAACATGGAAGG + Exonic
1067566973 10:47346431-47346453 CCTGGGGTGCCTGAGTTGGATGG - Intergenic
1067615232 10:47756048-47756070 ACTGTGGTGCAGAACATGGAAGG - Intergenic
1068650751 10:59519895-59519917 TCTGGGGTGGAGAAGCTGCAAGG + Intergenic
1068736148 10:60415456-60415478 CTCGGGTTGCAGCAGGTGGAGGG - Intronic
1069800352 10:71078071-71078093 CCTAGGGTGCAGAAGCTGTGGGG - Intergenic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070673042 10:78391560-78391582 CCTGGCCTGCAGGAGGTGGTGGG + Intergenic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070805877 10:79270414-79270436 CCTTGGGTGCAGCTGGTGCAGGG + Intronic
1070812590 10:79305838-79305860 CGTGGGGAGCAGCAGGTGGAGGG - Intronic
1071519286 10:86319107-86319129 CCTGGGGTGCTGCAGGAGCAAGG + Intronic
1072349200 10:94541317-94541339 CCTGTGGAGCAGAAGGTCCAAGG + Intronic
1072928562 10:99639649-99639671 CCTGGGGCGGAGTAGGGGGATGG - Intergenic
1073692449 10:105825159-105825181 CCTTGGGTTAAGAAGGAGGAGGG + Intergenic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1075067586 10:119299953-119299975 CGTGGGGTGGGGAAGGGGGAGGG - Intronic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1076021852 10:127080416-127080438 CCTGGGGTACAGGAGGGGGTCGG - Intronic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076352425 10:129826152-129826174 CCTGGGGAGCAGGTGGTGGTGGG + Intergenic
1076591851 10:131588899-131588921 CCTGGGAGGCACCAGGTGGATGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077214231 11:1388728-1388750 CCCGTGCTGCAGAAGGTGGTGGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1078133182 11:8630308-8630330 CCTGGGGTCTAGAGGGTGGGTGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1082097040 11:48139386-48139408 CCTGGGGATGAGAAGGTGGGTGG - Intronic
1082811476 11:57481631-57481653 CCAGGCGTGGAGAAGATGGAGGG - Intergenic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083262639 11:61531455-61531477 CCTGGGGGGGGGAAGATGGAAGG + Intronic
1083271521 11:61575243-61575265 CCTGGAGTGCAGAAGGCTGGTGG - Intronic
1083890456 11:65593210-65593232 CCTGGGGAGGAGAAGGTGCTGGG + Exonic
1084278304 11:68068213-68068235 TGTGTGGTGCAGAAGGGGGAAGG + Intronic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086171001 11:83836424-83836446 CATGGGGTGAGGAATGTGGATGG - Intronic
1088105310 11:106200722-106200744 CTTGGGGTGAAAAAGGTAGAAGG + Intergenic
1088831929 11:113544162-113544184 CCTGGGGTGATGAGGGTGGGTGG + Intergenic
1088915865 11:114227286-114227308 CATGGGGCCCAGGAGGTGGATGG - Intronic
1089504346 11:118953610-118953632 GCTGGGGTGGGGAAGGTGGGGGG + Intronic
1089642952 11:119859620-119859642 CCTGGGGTGCTGAGGCTGGCTGG + Intergenic
1089692174 11:120193641-120193663 CCTGGGGTGCAAATGGGGGGAGG - Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091328078 11:134707114-134707136 TCTGGGCTGCAGTAGGTGTAGGG + Intergenic
1091590835 12:1842202-1842224 CGTGGAGTGCAGAAGGGGGCGGG + Intronic
1091772421 12:3161537-3161559 CCTGGGGAGCAGGAGGTAGGTGG + Intronic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1093203178 12:16214514-16214536 TCTGGGGAGCAGAAGGAGGGTGG + Intronic
1095195930 12:39317501-39317523 GCAGGGGTGGAGAAGTTGGAGGG - Intronic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1097262675 12:57728264-57728286 GCTGGGGTGCAGAAGGGTGGGGG - Intronic
1098223259 12:68292717-68292739 CCTGGGGTGAAGATGGGGGAGGG + Intronic
1101259447 12:103013550-103013572 GCAGGGGTGCAGCAGGTGGTGGG + Intergenic
1102666632 12:114579655-114579677 CCTGGGGTGGAGAATGGGAAAGG + Intergenic
1102793929 12:115672419-115672441 CCTGTGGTTCTGAAGGTGGGTGG + Intergenic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104481380 12:129111027-129111049 CCAGGGGTCCTGAAGGTGGCAGG - Intronic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1105862540 13:24428923-24428945 CCAGGGTTTCAGAAGGTGAAAGG - Intronic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107217186 13:37935082-37935104 GTTGGGGTGCAGGCGGTGGATGG + Intergenic
1108957235 13:56175146-56175168 CATAGGGTGCAGAAGATGGAAGG + Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1110870930 13:80451970-80451992 CCTGGGTCCCAGAGGGTGGAGGG - Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1111949956 13:94702475-94702497 CCTGGGGTGCGGGAGGTTGCGGG - Intergenic
1113286214 13:108851939-108851961 CCTGGCGTGGAGGAGGTGGGAGG - Intronic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117516028 14:56502140-56502162 GCTGGGGTGTGGAGGGTGGAGGG - Intronic
1118123117 14:62868215-62868237 CCTGGTGGGAAGAATGTGGAAGG - Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1118758506 14:68863261-68863283 CCTGGGGTGCTGAAGGGGCTTGG - Intergenic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1118920525 14:70145776-70145798 GCTGGGGTGCAGCAGCTGGAGGG - Intronic
1119702221 14:76762825-76762847 CCAGGGGGGAAGAAGGTGGCTGG + Exonic
1122602291 14:102927917-102927939 CCAGGGGTGCAGGAGGAGGCAGG - Intronic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125931342 15:43602261-43602283 CCATGAGTGCAGGAGGTGGAGGG - Intronic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1126773683 15:52081669-52081691 CCTGGGGTGGCCAAGGTGGGCGG - Intergenic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128323689 15:66709445-66709467 CCTGGGACTCAAAAGGTGGAAGG - Intronic
1128609878 15:69064995-69065017 CCTGGGCTGCAAGAGGTGGGTGG + Intergenic
1129312904 15:74725039-74725061 CCTTGGGTGGACAGGGTGGATGG - Intronic
1130101793 15:80900073-80900095 CCTGGGGTGCAGATGGGGACTGG - Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1131075857 15:89494499-89494521 CCTGGGGTGTGAAAGGTGGGTGG + Intronic
1131175122 15:90204437-90204459 CCTGGGGTGCTTAAGATGCAGGG + Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131407219 15:92175343-92175365 CATGGGATGCAGGAAGTGGAGGG - Intergenic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1132027697 15:98417166-98417188 CCTGGGGTGATCAGGGTGGATGG - Intergenic
1132462046 16:60363-60385 GCTGTGGTGCAGAGGGTGTAGGG - Intronic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1133041057 16:3059870-3059892 CCTGGGGAGGAGGAGGTGGGTGG - Exonic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133338248 16:5020586-5020608 GCTGGGGAGCAGAAGCTGGGTGG - Intergenic
1133607948 16:7406453-7406475 CCTGTGGCCCAGAGGGTGGATGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1135109258 16:19677973-19677995 ACTGGGGTGCAGAAAGATGAAGG + Intronic
1135537096 16:23302655-23302677 CCCAGGGTGCAGAAGGCAGACGG + Intronic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1137670667 16:50276370-50276392 CATGGGGTGCAGAAGTGAGAGGG - Intronic
1137702640 16:50507930-50507952 CCTGGGGCGCAGCAGGGTGAAGG + Intergenic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1138513484 16:57522397-57522419 CCTGGGGTACAGCAGGAGGGAGG - Intronic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139949044 16:70660400-70660422 CCTGGGGACCTGAAGGTGGATGG + Exonic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141200178 16:81891678-81891700 CCTGTTGTGAAGCAGGTGGAGGG + Intronic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141597676 16:85107313-85107335 CGTGGGGCACAGCAGGTGGAAGG - Intronic
1141678308 16:85529318-85529340 TCTGGGTTGCAGCTGGTGGAAGG + Intergenic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141768545 16:86074710-86074732 CCTGGGGTGCTGGAGGTGACTGG + Intergenic
1142184390 16:88687447-88687469 CCGGGGGTGGAGAAGGTGGGGGG + Intergenic
1142237146 16:88927704-88927726 CCTGGGGAGGAGGAGGCGGAAGG - Intronic
1142375973 16:89707344-89707366 CCTGGGGTGCAGCTGGTGTCAGG - Exonic
1142787206 17:2233651-2233673 CCGGGGGTGGAGAAGGAGGGGGG - Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143115803 17:4581398-4581420 CCTGGGGTGCAGAGGGCTGGAGG + Intergenic
1143595547 17:7911665-7911687 CAAGGGGTGGGGAAGGTGGAGGG - Exonic
1144347173 17:14359758-14359780 CCTGGGCTGCAAAAGGAGGGAGG - Intergenic
1144675031 17:17156572-17156594 CCTGGGGTGGGGAAGTTGCAGGG + Intronic
1144816871 17:18040614-18040636 CTGGGGGTGGAGAAGCTGGAAGG - Intronic
1144834206 17:18148474-18148496 CCTGGGGCGCAGCAGGTGCCGGG - Exonic
1144872612 17:18380432-18380454 CCTGGGGTGGAGGAGGTATAGGG + Intronic
1144971224 17:19111068-19111090 CCTGGAGCGCAGGAGGCGGAGGG + Intergenic
1144991526 17:19237231-19237253 CCTGGAGCGCAGGAGGCGGAGGG + Intronic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1145904095 17:28506971-28506993 CCTGGGTTGCAGAAAGGAGATGG + Intronic
1146056774 17:29585263-29585285 CCTGGGCTGCTGGAGGTGGCTGG - Intronic
1146169035 17:30618692-30618714 CCTGGGGGGCTGAATTTGGAGGG - Intergenic
1146170527 17:30628757-30628779 CCTGGGGGGCTGAATTTGGAGGG + Intergenic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147580627 17:41625430-41625452 CTTGGGGTACAGAAGGGTGAGGG - Intergenic
1147776808 17:42907642-42907664 ACTGGGGTGTAGGTGGTGGAGGG + Intronic
1147998914 17:44376277-44376299 CCAGGGGTGGAGAAGGGAGATGG - Intronic
1148194767 17:45705458-45705480 CCTGTGTTGCTGCAGGTGGAGGG - Intergenic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG + Intergenic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151560115 17:74865516-74865538 GCTGGAGTGCAGAAAGTGAAGGG + Intronic
1151579787 17:74971580-74971602 CCTGGAGAGCAGGAGGTGGGGGG + Intronic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1151669484 17:75564206-75564228 CCTGGGCTGTAGCAGTTGGAAGG + Intronic
1151748640 17:76024590-76024612 CCTGGGGTGGAGGAGGTATAGGG - Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152361592 17:79835497-79835519 CATGGGGGGCAGGAGGTGGGAGG + Intronic
1152638377 17:81439447-81439469 CCTGGGGAGCAGCAGTTGGACGG + Intronic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1153219340 18:2847787-2847809 CCTGGGGTGCAGGAGAGAGAGGG - Exonic
1153360496 18:4190347-4190369 CCAGGGGTTCAGAAGGTTCAGGG + Intronic
1154033346 18:10773516-10773538 CCTGGGGAGGAGAAGCTTGAGGG - Exonic
1155165738 18:23230973-23230995 CTTGGGGTGCTGATGGTGCAAGG + Intronic
1155517393 18:26637266-26637288 CCCGGGGTTCAGAAGGAGCATGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1157097564 18:44700185-44700207 CGTGGGGTGAAGAAGGGTGAAGG + Intronic
1157196670 18:45625479-45625501 CCTGCTGTGAAGAAGGTGCATGG + Intronic
1157724620 18:49954488-49954510 CCTGGGTTGCAGCAGAGGGATGG + Intronic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160625531 18:80201783-80201805 GCTGGGGTGAAGGAGGCGGAGGG + Intronic
1160867061 19:1260663-1260685 CCAGGGGTGCAGCGGGCGGAGGG + Intronic
1160963930 19:1737351-1737373 CCTGGGGCACAGCAGGTGCATGG - Intergenic
1161537969 19:4831565-4831587 CCTGAGGTGGAGAAGGTGTCGGG - Intronic
1161573847 19:5044759-5044781 CCTGGGGCGCAGGAGAGGGATGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161697424 19:5777263-5777285 CCGGGGTGGCAGCAGGTGGAAGG + Intronic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162932453 19:13963746-13963768 CCTGGGGCACAGAGGGTGGGCGG + Exonic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163178669 19:15583653-15583675 CCCGGGATGGAGAAGGCGGAAGG - Intergenic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163321763 19:16578669-16578691 CCTGGGTTTCAGCAGGTGGGTGG - Intronic
1163760779 19:19135301-19135323 TGTGGGGTGCAGAAGGCGGTGGG - Intronic
1163799695 19:19356959-19356981 CCTGGGCCCCAGAAGCTGGAGGG - Exonic
1165224092 19:34342025-34342047 CCTGGGGTGCCCGTGGTGGAGGG - Exonic
1165404241 19:35620041-35620063 CGCGGGGTGCAGCTGGTGGATGG - Exonic
1165504552 19:36217136-36217158 CCTGGGGGGCAGAGGTTGCAGGG - Intronic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1166443607 19:42838639-42838661 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166463300 19:43009301-43009323 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166480574 19:43169397-43169419 TCTGCAGTGCAGATGGTGGAGGG + Intronic
1166937654 19:46344273-46344295 CCTGTGTTGCAGCAGGTGGGTGG + Intergenic
1167006963 19:46782524-46782546 CCCGTGGGGCAGGAGGTGGAGGG - Exonic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167687353 19:50964847-50964869 ACTGGGGGGCAGAAGGTGCTGGG - Intronic
1168121458 19:54254517-54254539 CCTGGGATGCAAATGGTGAAAGG - Intronic
1168133011 19:54332685-54332707 CCTGGAGTCCAGAAGGTGCTAGG - Intergenic
1168181347 19:54664660-54664682 CCTAGGGTCCAGAAGGTGCCAGG + Intronic
1168377460 19:55892502-55892524 GCTGGGGCCCAGGAGGTGGAGGG - Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925063374 2:910517-910539 CCTGGGGTGCAGAGGCTGTTGGG - Intergenic
925611567 2:5706368-5706390 ACTGGGGTGGAGAAGCTGGGAGG + Intergenic
925611596 2:5706456-5706478 GCTGGGGTGGAGAAGCTGGGAGG + Intergenic
926380450 2:12281991-12282013 CCTGGAGTAGAGAAGTTGGAAGG + Intergenic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
927194294 2:20537211-20537233 CCTGGGGTGCAGGGTCTGGATGG - Intergenic
927243082 2:20935681-20935703 TCTGGGTTGCAAAAGGTGAAGGG - Intergenic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927427306 2:22995579-22995601 CCTGGGCTGCAGGAGGTGCCAGG - Intergenic
927501843 2:23588390-23588412 CCTGGGAGGCTGAAGGTGGGTGG - Intronic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
932220360 2:69994498-69994520 CCCGGGGTGCAGCATGTGGGCGG + Intergenic
933508875 2:83214563-83214585 CCTGGGGGGCAGAGGTTGCAGGG - Intergenic
933737334 2:85505681-85505703 GCTGGAGAGCAGGAGGTGGAAGG - Intergenic
934752067 2:96799840-96799862 GATGGGGTCCAGAAGCTGGAGGG + Intronic
934854224 2:97718911-97718933 GCTGGGTTGGAGAAGATGGAGGG + Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
937122267 2:119448998-119449020 CCTGGGCTGCAGAAGCTCTAAGG + Intronic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
937870029 2:126780086-126780108 CCTGGGGTGCTGAACTTGGAGGG - Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938184780 2:129220767-129220789 CCTAGGATGCAGAAGTTTGAGGG + Intergenic
938970040 2:136423616-136423638 CCTGGTGTCCACAAGGTGGCAGG + Intergenic
939733264 2:145811610-145811632 CCTGGGGTTCACTAGCTGGATGG - Intergenic
941494202 2:166180859-166180881 CCTGGGGCGGTGAAGGAGGAAGG + Intergenic
943506576 2:188768270-188768292 CATGGGGTGGGGAAGGGGGAGGG - Intronic
947019900 2:225663502-225663524 CCTGAGGTGTAGCAGGTGAATGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
948298702 2:236885616-236885638 CCATGGGTGAAGAGGGTGGATGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948839680 2:240642794-240642816 CCTGGGGGGCGGCAGGTGGGAGG - Intergenic
948861726 2:240755830-240755852 CCTGGGGCCCAGGAGGTGCAGGG + Intronic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
1169149441 20:3277687-3277709 CCTGGGGTGGATACTGTGGATGG + Intronic
1171493349 20:25537696-25537718 CCTGGGCTGCTGCAGGTGGAGGG + Intronic
1172121066 20:32598965-32598987 CCAGGGGTGATGAAGCTGGAAGG + Intronic
1172414973 20:34757751-34757773 CCTGGGCTGGAGGAGGTTGAAGG + Exonic
1172764780 20:37345796-37345818 TCTGGGGCGTAGAAGGTGGGTGG + Intronic
1172778423 20:37421530-37421552 CCTGGGGTGCATATGGGGGGCGG + Intergenic
1172961671 20:38804865-38804887 CCTGGGGTGGTGATGGTGGGGGG + Intergenic
1173363936 20:42368405-42368427 CCTGGGATGCTAAAGCTGGAGGG - Intronic
1173495527 20:43514871-43514893 CCTGGGGTGGAGAAGGCTGGAGG + Intronic
1173868441 20:46327651-46327673 CCTGGGGTGGAGGAGAAGGAAGG + Intergenic
1174279255 20:49426978-49427000 CCTGGGGATCAGAAGAGGGATGG - Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1175939815 20:62532767-62532789 GCTGGGGGGCTGAAGGTGCAAGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176233539 20:64043449-64043471 CCAGGCGTGCAGAAGGCGCAGGG - Intronic
1176274478 20:64255945-64255967 CCGGGGGTGGGGAAGGAGGAGGG - Intronic
1176786248 21:13259828-13259850 ACTGGGGTGGCCAAGGTGGAAGG - Intergenic
1178431536 21:32522387-32522409 CCTGGGGTGCAGATGGCTGCAGG - Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179583245 21:42358353-42358375 GCTGGGGACCAGGAGGTGGAGGG + Intergenic
1180785352 22:18544007-18544029 CCTGGGTGGCAGCAGGTGGCAGG - Intergenic
1181018917 22:20088066-20088088 GCTGGGGTGCACAAGGTGGCAGG + Intronic
1181128934 22:20718048-20718070 CCTGGGTGGCAGCAGGTGGCAGG - Intronic
1181242256 22:21483360-21483382 CCTGGGTGGCAGCAGGTGGCAGG - Intergenic
1181284011 22:21739282-21739304 CCGGAGGTGCAGCAGGCGGAGGG - Intergenic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183747125 22:39698375-39698397 CCTGTGGTGCATGGGGTGGAGGG + Intergenic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184232997 22:43168591-43168613 CCTGCGGTGCAGAGTCTGGAGGG - Intronic
1184422324 22:44389353-44389375 CCTGGGGTACAGAAGGGAGGTGG + Intergenic
1184642119 22:45878329-45878351 CCTGGCGCTCAGAAGGGGGAAGG - Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1185101536 22:48843381-48843403 TGTGGGGTGCAGAATGTGGGGGG + Intronic
1185241303 22:49749007-49749029 CCCTGAGTACAGAAGGTGGAGGG - Intergenic
1185408517 22:50671258-50671280 CCTGAGGTCCTGAAGGTGGGTGG + Intergenic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
950135465 3:10577653-10577675 CCTGGGCTGCACAATGTAGATGG + Intronic
950413064 3:12851454-12851476 TGTGGGGTGCAGAAGGCAGAGGG - Intronic
950449747 3:13058961-13058983 CTCTGGGTGCAGGAGGTGGATGG + Intronic
950614648 3:14148938-14148960 CCTCTGGTGCAGATGGTGAAAGG - Exonic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
952375564 3:32764370-32764392 CCTCGGGCTCAGAAGGTAGAGGG - Intronic
952610703 3:35205777-35205799 GCTGGATTGCAAAAGGTGGATGG - Intergenic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
953056039 3:39387896-39387918 CCTGGGGTGCAGCAGGTGCTTGG + Intronic
954630108 3:52043513-52043535 CCTGGAGTGCACAGGCTGGAGGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955818860 3:62875067-62875089 CTTGGAGTGCAAAAGGTGGGGGG + Exonic
955852108 3:63231635-63231657 CCTGGGGCCTAGAAGTTGGAAGG - Intronic
955984581 3:64559398-64559420 ACTGGGGTGGTGAAAGTGGACGG - Intronic
956642612 3:71429093-71429115 GCTGGGGACGAGAAGGTGGATGG + Intronic
958100072 3:88998249-88998271 CCTGGGGTCCAGATTATGGATGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
960643335 3:119850330-119850352 AATGGGGTGTAGAAGTTGGAAGG - Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961464226 3:127071744-127071766 CCTGGGGTGCAGGAGGGGCGTGG + Intergenic
961496912 3:127299958-127299980 CCTGAGGTGCAGAAGGCTGTTGG - Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961716476 3:128861105-128861127 CGTGGGGTGCAGGAGGTGAAGGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962113526 3:132476040-132476062 ACTGGGGAGGCGAAGGTGGAAGG - Intronic
962488156 3:135864684-135864706 TGTAGGGTGCAGAAGGGGGAAGG + Intergenic
963509657 3:146231014-146231036 TCTGGAGGGCAGAAGGTGGGAGG - Intronic
964610665 3:158611782-158611804 TCTGGGGTACAAAAAGTGGATGG - Intergenic
964993144 3:162840561-162840583 ACTGGGGCTCAGAGGGTGGAGGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968479792 4:828023-828045 CCTGGGTTGTAGAACGGGGAGGG - Intergenic
969328060 4:6455413-6455435 CTGGGGGTGCAGATGGTGGCAGG - Intronic
971017760 4:22506124-22506146 CCAGGGGTGCTGAAGATGGGGGG + Intronic
972109292 4:35536253-35536275 CCTGGGGTGGGGAAGTGGGAGGG - Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972696619 4:41452691-41452713 CTTGCGGTGCAGAAGAAGGAAGG - Intronic
976678996 4:87734267-87734289 CCTGGGGTGCAGCAAGTGAGAGG + Intergenic
978536655 4:109770035-109770057 CCTGGGGTGCAGGTGGGAGATGG + Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979500484 4:121434430-121434452 CCTGGGTTTCAGAAGATGTATGG - Intergenic
980802110 4:137765363-137765385 CATGGGATGCTGAAAGTGGATGG + Intergenic
981171999 4:141636415-141636437 CCTGGGGCGCAGAACTTGCAGGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983876066 4:172875599-172875621 CCTGCTGTTCAGTAGGTGGATGG - Intronic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
989266017 5:39474975-39474997 ACTGGGATACAGAAGGTGTAGGG + Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
990114179 5:52368388-52368410 CCTGGAGTGCAGCAGGAGTAAGG - Intergenic
990269166 5:54116151-54116173 CCTGGGGAGCAGGAGGGGGTTGG + Intronic
990516945 5:56539208-56539230 CATGGGGTGGAGAAGGAAGAGGG + Intronic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
996710886 5:126542554-126542576 ACTGGGGAGCATGAGGTGGAAGG + Exonic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997621241 5:135297575-135297597 CCTGGGGTGCAGGCGCTGGTGGG + Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998347260 5:141475936-141475958 CCCGGGGCGCAGAAAGGGGACGG - Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999582734 5:153057723-153057745 CGTGTGATCCAGAAGGTGGAAGG + Intergenic
999694046 5:154172665-154172687 GCGAGGGTGCAGGAGGTGGAAGG + Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1000798455 5:165693673-165693695 CCTGGGAAGCAGAAGGTGTCAGG - Intergenic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1002923451 6:1590307-1590329 CCAGGGATGCAGAAGGTGTTTGG + Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006090473 6:31625815-31625837 CCTGGGGTCCATAGGGCGGAGGG - Exonic
1006451015 6:34105706-34105728 CCAGGGGAGCAGCAGCTGGATGG - Intronic
1006874679 6:37285096-37285118 CAGGGGTTGCAGAAAGTGGAAGG + Intronic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007398655 6:41591335-41591357 ACTGGGGCCCAGAAGGTGGAAGG - Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010083291 6:71887430-71887452 ACTGGGGTGCAGAGGAGGGATGG + Intronic
1011860218 6:91746035-91746057 CCTGGGATGAAGAACTTGGATGG - Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1013612927 6:111811990-111812012 CCTGGGGTGCAGAGGGTCCTAGG - Intronic
1016429604 6:143968864-143968886 ACTGGGGGGCAGGAGTTGGAGGG + Intronic
1016629689 6:146213946-146213968 CCTGGAGTCCAAAAGCTGGAGGG + Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1017492817 6:154959042-154959064 CCGGGGGTGCAGGAAATGGAAGG - Intronic
1017719674 6:157235967-157235989 CCTGGGGTGCACACGGAGGAGGG + Intergenic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1018940956 6:168308626-168308648 GCTGGAGTACAGACGGTGGAGGG - Exonic
1019083130 6:169449727-169449749 CCTGGGGAGCATGTGGTGGAAGG + Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019292719 7:258285-258307 CCTGGGGTGCTGGAGATGGGTGG + Intronic
1019292767 7:258429-258451 CCTGGGGTGCTGGAGATGGGTGG + Intronic
1019292779 7:258465-258487 CCTGGGGTGCTGGAGATGGGTGG + Intronic
1019318777 7:405513-405535 CCTGGGGTGGTGAAGGGGCATGG - Intergenic
1019478721 7:1256322-1256344 CCAGGGACGCAGAAGGTGGCTGG - Intergenic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1020469211 7:8516850-8516872 CCCAGGGTGCAGAAGGTGGATGG + Intronic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022443201 7:30450323-30450345 CATGGGGTGCAGGGGGTCGAAGG - Intronic
1023769752 7:43545815-43545837 CTCGGGGTGGAGGAGGTGGAAGG + Intronic
1023821895 7:43985310-43985332 CCTGAGGTGTGGAGGGTGGAGGG - Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1028990485 7:97044153-97044175 CCTGGGGTGCAGCAGGATGAAGG + Intergenic
1029152147 7:98488240-98488262 CCTGGGGAGCAGGATGTTGAAGG + Intergenic
1029750160 7:102538732-102538754 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1029768111 7:102637840-102637862 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1030308726 7:108047307-108047329 GCAGGGGTGGAGGAGGTGGAAGG - Intronic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1032068886 7:128791827-128791849 CCGGGGCTGCAGGAGGTGTAGGG - Intronic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1033178684 7:139152368-139152390 CTTTGGGTGCCCAAGGTGGAAGG - Intronic
1033628997 7:143139053-143139075 CCTGGTGAGGAGAAGGTGGGAGG - Exonic
1034075532 7:148227464-148227486 CCTGGATTGCAGAAGATGGTGGG - Intronic
1034190229 7:149208010-149208032 GCTGGGGTGGAAAGGGTGGAAGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1041353474 8:56973952-56973974 TCTCGGGTGGAGGAGGTGGAAGG - Intronic
1042281919 8:67064545-67064567 CCTGGGGTGGTGTAGGTTGAGGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1047920280 8:129628321-129628343 CCTGTGGTGGAGAAGGTGGGAGG - Intergenic
1048053355 8:130840231-130840253 GCTGGGGTTCAGAAGGCAGATGG + Intronic
1048054745 8:130852743-130852765 CATGGGGTGCAGAAGGGTGAGGG - Intronic
1048365380 8:133733594-133733616 CCAAGGGTGCAGATGGTAGAAGG - Intergenic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049575982 8:143389810-143389832 CCTGGGGTGAAGCATGTAGACGG + Intergenic
1049785404 8:144448390-144448412 TCTGGGGTGGGGAAGGTGGGAGG - Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1051791912 9:20814598-20814620 TCTGGGAGGCTGAAGGTGGATGG - Intronic
1053138472 9:35666570-35666592 CCTGGGGTGCAGTTGGTGATGGG + Intronic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053674160 9:40405259-40405281 TCTGGAGTGCAGAAGTTGGGAGG + Intergenic
1053730351 9:41049131-41049153 CCTGGGGTGTAGGGAGTGGAGGG - Intergenic
1053923963 9:43031628-43031650 TCTGGAGTGCAGAAGTTGGGAGG + Intergenic
1054385265 9:64545328-64545350 TCTGGAGTGCAGAAGTTGGGAGG + Intergenic
1054510463 9:65971031-65971053 TCTGGAGTGCAGAAGTTGGGAGG - Intergenic
1054698151 9:68382930-68382952 CCTGGGGTGTAGGGAGTGGAGGG + Intronic
1055441592 9:76342011-76342033 CCTGGAGCAGAGAAGGTGGATGG + Intronic
1055638351 9:78298718-78298740 CCTGGGGGGCAGGAGGGTGAGGG + Intronic
1055862736 9:80772417-80772439 CGTGGGGTGAGGAAGGTGCAAGG + Intergenic
1056089275 9:83188697-83188719 GCTGGGCTGCGGTAGGTGGAAGG - Intergenic
1056655084 9:88502622-88502644 CCTGGGGGACACAAGGAGGATGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058645856 9:107131031-107131053 CCTGGGGCTAAGGAGGTGGAAGG - Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1060389422 9:123266924-123266946 TCTGGAGTACAGTAGGTGGAGGG - Intronic
1060402219 9:123355712-123355734 ACTGGGGAGCAGCAGGTGGGGGG + Intergenic
1060556790 9:124512160-124512182 CCTGGAGAGCTGGAGGTGGAGGG + Intergenic
1061008230 9:127940467-127940489 CCAGGGGTGGGGAAGGTGTAGGG - Intergenic
1061013306 9:127967927-127967949 CCTGGGGTGGAGAAGAAGGTAGG - Intronic
1061497155 9:130981630-130981652 CCTGGGGTGCAGCAGGGGAAGGG - Intergenic
1061670580 9:132185968-132185990 CCTGGTGTGGGGAAGGAGGAGGG + Intronic
1061681565 9:132245055-132245077 CCCCTGGTGCAGAAGGTGGGCGG + Intergenic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1187271993 X:17788087-17788109 CCTGGGGTGCAGCCGGGGTAGGG + Intergenic
1189298522 X:39935877-39935899 CCTGGGGTGCAGAAAGCAGCCGG + Intergenic
1189728285 X:43990807-43990829 ATTGGAGTGCAGCAGGTGGAAGG - Intergenic
1193750758 X:85340264-85340286 CTAGGGGCACAGAAGGTGGATGG + Intronic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1198815012 X:140580487-140580509 CCAGGGATGCAGTAGGTGGCAGG - Intergenic
1199806753 X:151307849-151307871 CTTTGGGTGCAGCAGGTGGTGGG + Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic