ID: 961807407

View in Genome Browser
Species Human (GRCh38)
Location 3:129499318-129499340
Sequence CTGGTGACTCAGAGAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 2, 1: 0, 2: 2, 3: 40, 4: 457}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961807407 Original CRISPR CTGGTGACTCAGAGAGGGCA TGG Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900476767 1:2879748-2879770 CTGGTCACTCACCGAGGGCCGGG + Intergenic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901948388 1:12721834-12721856 CTGGAGCCTCAAAGAGGGCGTGG + Intronic
901954979 1:12777510-12777532 CTGATGCCACAGCGAGGGCAGGG - Exonic
901972698 1:12920351-12920373 CTGATGCCACAGCGAGGGCAGGG - Exonic
902012482 1:13281411-13281433 CTGATGCCACAGCGAGGGCAGGG + Exonic
902991464 1:20190461-20190483 CTGGGCACTCAGGGAGGGAATGG + Intronic
903034982 1:20487071-20487093 ATGGTAACTCCGAGGGGGCAAGG + Intergenic
903069467 1:20719865-20719887 CTCGTGTTACAGAGAGGGCAAGG - Intronic
903069979 1:20722305-20722327 AAACTGACTCAGAGAGGGCAGGG - Intronic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903414906 1:23175900-23175922 ATGGAGCCTCAGAGAGGGTAAGG + Intronic
903705943 1:25286016-25286038 GTGGAAGCTCAGAGAGGGCAAGG + Intronic
903721292 1:25407391-25407413 GTGGAAGCTCAGAGAGGGCAAGG - Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
904472651 1:30745597-30745619 CACGAGACTCATAGAGGGCAGGG + Intronic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
904812150 1:33170501-33170523 CTGAAGACTCAGCGAGGCCAGGG - Intronic
905357471 1:37394837-37394859 CTAGTCACTGAGAAAGGGCAGGG + Intergenic
905515600 1:38559696-38559718 GTGGTGACCCAGGGATGGCAAGG - Intergenic
905859843 1:41342846-41342868 CTGGGGTCACAGAGAGGGAATGG - Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906293220 1:44633098-44633120 CTGGTAAGTGAGAGAGGCCATGG + Intronic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
906920982 1:50064137-50064159 CTGGTGTGTCATAGAGTGCAAGG + Intronic
907093426 1:51751635-51751657 CTAGTCACTCAAACAGGGCATGG - Intronic
907219548 1:52896176-52896198 CTGATAACTGAGAGAGGTCAGGG + Exonic
907502091 1:54887994-54888016 CTGGTTGCTGAGTGAGGGCAGGG - Intergenic
907801150 1:57767010-57767032 GTGGTGCCTCAGAGAGGTCATGG - Intronic
908554149 1:65240285-65240307 CTGGGGACTACTAGAGGGCAAGG - Intergenic
908875348 1:68668241-68668263 CTGCACACTCAGAGACGGCATGG - Intergenic
909754516 1:79207292-79207314 CTGGAGACTCACAGATGACACGG - Intergenic
910597324 1:88993288-88993310 AAGGTGCCTGAGAGAGGGCAGGG + Intergenic
911370500 1:96989384-96989406 CTGGTTTCTAACAGAGGGCAGGG - Intergenic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
916175658 1:162036149-162036171 CTGGAGGCTCAGGGAGGCCATGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916879389 1:169004579-169004601 TTAGTGACTGAAAGAGGGCATGG + Intergenic
917186210 1:172359048-172359070 CTGGTGGCTCAGACGGGGCCTGG + Intronic
917250996 1:173060551-173060573 GTGGTGTGTCAGAGAGGGGATGG - Intergenic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917666287 1:177228910-177228932 CGTCTAACTCAGAGAGGGCAGGG + Intronic
918059631 1:181049866-181049888 CTGGGGACTCAGCGATGCCATGG + Intronic
919673116 1:200355827-200355849 CTGGTGAGTGAGAGAGAGGAGGG - Intergenic
920350203 1:205332929-205332951 CTGGGCAATCAGAGAGGGCCAGG - Intergenic
920430853 1:205918112-205918134 CTTATGACCCACAGAGGGCAGGG + Intronic
920648990 1:207822936-207822958 ATGGAGACACAGAGAGCGCAAGG + Intergenic
922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG + Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923722733 1:236481242-236481264 CTGGTCACTTGGAAAGGGCAAGG + Intronic
1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG + Intergenic
1063355299 10:5393597-5393619 CTGGTACCTCAGAGAAGGCATGG - Exonic
1063629872 10:7723362-7723384 CTGGGGACTCAGAGAAGAGAGGG - Intronic
1063733124 10:8722137-8722159 CTGGTGACAAAGAGTCGGCAAGG + Intergenic
1067514101 10:46921923-46921945 CTGGGGCCTAACAGAGGGCATGG + Intronic
1067648152 10:48129909-48129931 CTGGGGCCTAACAGAGGGCATGG - Intergenic
1067655498 10:48188543-48188565 CTGGGGACTCTCAGAGGACAGGG - Intronic
1067826793 10:49580218-49580240 CTGGAGTCTCTGAAAGGGCAGGG + Intergenic
1070749811 10:78957338-78957360 TGGTTGACTCAGAGAGGACAAGG - Intergenic
1070816171 10:79324926-79324948 CTGGGGACTCAGAGACTCCAGGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1072311132 10:94156542-94156564 GTGGTCACCCAGAGAGGGTATGG - Intronic
1072613578 10:97035078-97035100 CAGGTGACTCGGAGAGGCCATGG - Intronic
1073606661 10:104902363-104902385 CCAGTGACTCTGAGAGGTCATGG + Intronic
1073793442 10:106962684-106962706 CTAGTGATTCAGGGATGGCATGG + Intronic
1075045386 10:119142511-119142533 CTGTTGGCTCAAGGAGGGCATGG - Intronic
1075422865 10:122316722-122316744 CTGGTGAGTCAGTGAGTGAATGG + Intronic
1075517494 10:123120280-123120302 CTGGTGACTCGCAGAGGGCCTGG + Intergenic
1075518475 10:123128920-123128942 TTGGAAACTCAGAGAGAGCATGG + Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1076424790 10:130359825-130359847 CTGGTGACGCAGGGAGCCCATGG + Intergenic
1076742032 10:132490546-132490568 CTGGTGGGGGAGAGAGGGCAGGG - Intergenic
1077162374 11:1119634-1119656 ATGGCGGCTCACAGAGGGCAGGG + Intergenic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077425310 11:2473311-2473333 CTGGGGACTCAGGGAGGGTTGGG + Intronic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080679240 11:34458643-34458665 CTGGTTACCCAGGGAGGGAACGG + Intronic
1080863342 11:36170024-36170046 CTGGGGATCCAGAGAGGGAAGGG - Intronic
1080954735 11:37080097-37080119 CTGGGGCGGCAGAGAGGGCAAGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081201384 11:40220498-40220520 AAGGTCAATCAGAGAGGGCAGGG - Intronic
1082799864 11:57406556-57406578 CTAGTGACTCAGAGTGGTTAAGG + Intronic
1085041266 11:73327743-73327765 CTGGTGAGTCAGCAAGGGCCAGG + Intronic
1085519104 11:77127846-77127868 TTTGGGACTCAGAGAGGGAACGG - Intergenic
1086603116 11:88660077-88660099 CTGTTGACTCCTTGAGGGCATGG - Intronic
1087689252 11:101300581-101300603 CTGGTGACTCAGTGAGGTTGGGG - Intergenic
1088711326 11:112511510-112511532 GTGGTGATTCAGAGAGGACTTGG - Intergenic
1089111668 11:116062359-116062381 CAGATGACTCAGAGAGAGCTGGG - Intergenic
1090421347 11:126577403-126577425 CTGATAACTCAGAGTGGGGAGGG + Intronic
1090499047 11:127243888-127243910 CTGGTCACTCAGGCAGGTCACGG - Intergenic
1091174692 11:133547480-133547502 ATAGGGACTCAGAGAGGGGAGGG - Intergenic
1091662554 12:2395467-2395489 CTGGTCACTTTGAGAGGCCAAGG - Intronic
1092057837 12:5522212-5522234 CTAGGGACTCAGAGAAGTCATGG - Intergenic
1092183287 12:6460917-6460939 CTGGGGCTTCAGAGACGGCAAGG + Exonic
1092184661 12:6470222-6470244 GTGGAGACTCGGAGAGGGCGGGG - Intronic
1092289416 12:7150354-7150376 CTAGTTAGTCAGAGTGGGCAGGG + Intronic
1092548407 12:9471419-9471441 CTGGTGCTTCAGAGGTGGCACGG + Intergenic
1093007508 12:14066272-14066294 CTGGTGACTCAGCCAGGCCCAGG - Intergenic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1093662857 12:21776550-21776572 CTGGGGACTGCTAGAGGGCAAGG + Intergenic
1094331345 12:29297615-29297637 CTTGGGGCTCAGAGAGGGCAAGG - Intronic
1096799354 12:54099377-54099399 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1096994899 12:55832323-55832345 CTGCTGCTTCAGTGAGGGCAGGG + Intergenic
1098282418 12:68874782-68874804 CTTGGGACTCAGATAGGCCAGGG - Intronic
1098652379 12:72989673-72989695 CAGGTGACCCAGGGAGGGAAGGG - Intergenic
1099165398 12:79300430-79300452 CTGGTGACCCCAAGAGGCCAGGG - Intronic
1099400138 12:82193762-82193784 CTGTTGTCTCAGACAGTGCAGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101305352 12:103522420-103522442 CTGGTGTTACAGAGAGGGCCGGG - Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102244032 12:111343619-111343641 TTGGGGACTGAGAGAGGGTATGG - Intronic
1102571492 12:113829674-113829696 TTGGTAACTCAGAGAAGGCTGGG - Intronic
1102589421 12:113946276-113946298 CAGGTGGCTTAGAAAGGGCAGGG + Intronic
1103035222 12:117651212-117651234 CTGTTGCCTCAGGCAGGGCAGGG - Intronic
1103153960 12:118667510-118667532 CAGGTGGCTCTGTGAGGGCAGGG - Intergenic
1103396172 12:120608930-120608952 CTGTTGCCTCAGACAGTGCATGG - Intergenic
1104599294 12:130141733-130141755 CTGGTTCCAGAGAGAGGGCAGGG + Intergenic
1104892514 12:132147401-132147423 CTGGGGACTCCCAGAGGGCCTGG + Intronic
1104939499 12:132388242-132388264 ATGGGGGCTCAGAGAGGGGAGGG + Intergenic
1108399018 13:50020568-50020590 CTGGTTGCCCAGAGACGGCATGG - Exonic
1108495350 13:51019278-51019300 CTGGTGACGCTGAGTGGGTAGGG - Intergenic
1108498152 13:51044972-51044994 CAGGTGGCCCAGAGTGGGCAGGG + Intergenic
1108764100 13:53605527-53605549 CTGAGGAGTCAGTGAGGGCAAGG + Intergenic
1109061853 13:57631024-57631046 TGGGCGACTCAGGGAGGGCAGGG - Intergenic
1109713005 13:66183499-66183521 CTGTTGACTCAGGCAGTGCATGG + Intergenic
1110741466 13:79002246-79002268 CTGGTGATTTAGACAAGGCAGGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114504178 14:23196349-23196371 GTGGTGACGCAGAGTGGGCTTGG - Intronic
1114856073 14:26445766-26445788 CTGCTGACTCTGAGACAGCATGG + Intronic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1118076850 14:62308774-62308796 CAGGTGACACAGAGAAAGCATGG + Intergenic
1119261711 14:73241633-73241655 CTGCAGACTCACAGAGGGCAGGG - Intronic
1119485524 14:74984469-74984491 GGGGTGGCTCAGAGAGGGCGTGG + Intergenic
1120384569 14:83827896-83827918 CAGGTGTTTCAGAAAGGGCAAGG - Intergenic
1120719863 14:87879183-87879205 ATGATGACTCAGAAAGGCCAGGG + Intronic
1121311306 14:92936572-92936594 CTGGTGAGTCTGAGCAGGCAAGG + Intergenic
1121467540 14:94125803-94125825 CTGGAGACCCAGATATGGCAGGG - Intergenic
1121893411 14:97621031-97621053 CTTCTGACTCAGATGGGGCAAGG + Intergenic
1122188478 14:100020926-100020948 CTGGTCACTCTGTAAGGGCAGGG - Intronic
1122424145 14:101596009-101596031 GTGGTGACTCTGAGTGGGTAAGG + Intergenic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1122810383 14:104284810-104284832 CTGGTGACTGCGAGGGTGCAAGG + Intergenic
1122957285 14:105076641-105076663 GGGGTGACGCAGAGTGGGCAAGG + Intergenic
1123124405 14:105935898-105935920 CTGGAGATCCAGATAGGGCATGG + Intergenic
1125492632 15:40159621-40159643 CTTGGGACTGAGAGAGGGGAAGG - Intergenic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1126110704 15:45173185-45173207 CTGGTGACTGAAAGAGAGTAAGG - Intronic
1126344935 15:47683215-47683237 CTGGTGGCTCCAAGAGGGGAAGG - Intronic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127619205 15:60716827-60716849 ATGGTGCCCCAGGGAGGGCATGG + Intronic
1127930842 15:63596349-63596371 GAGTTGAGTCAGAGAGGGCAGGG + Intergenic
1128694021 15:69747054-69747076 CTGGAGGCTCATGGAGGGCAGGG - Intergenic
1128733839 15:70039365-70039387 CTGGTGACTCAAAGGGGGCCTGG - Intergenic
1129457656 15:75684170-75684192 CTGGTGGAACAGAAAGGGCATGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1129726145 15:77902789-77902811 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1129742181 15:77994621-77994643 CCTGTGACTCAGGCAGGGCATGG + Intronic
1129843301 15:78756859-78756881 CCTGTGACTCAGGCAGGGCATGG - Intergenic
1130274201 15:82468152-82468174 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130466546 15:84195526-84195548 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130497718 15:84478010-84478032 CTGGTGGAACAGAAAGGGCATGG - Intergenic
1130588843 15:85200119-85200141 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130651417 15:85764131-85764153 CTGGTGACCCAGGGAAGGCCAGG + Intronic
1131433253 15:92403181-92403203 ATGGAGACTCAGAGAGGTCTCGG + Intronic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132294684 15:100726472-100726494 ATGGTGAGTCAGTGAGGGCTGGG - Intergenic
1132560146 16:589890-589912 CTGGTGACTACGGGAAGGCAGGG + Intronic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1133978651 16:10617965-10617987 CTGATGACCCAGACAGGACAGGG - Intergenic
1134112881 16:11526882-11526904 CTGGAAACTCAGACAAGGCAGGG - Intergenic
1135561194 16:23478356-23478378 CAGAAGACTCACAGAGGGCACGG + Exonic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1136989391 16:35142869-35142891 CTGGTGAGGCAGGGAGGGCATGG - Intergenic
1137314291 16:47299981-47300003 CTTGTGTTTCAGAAAGGGCATGG + Intronic
1137507343 16:49065617-49065639 GTGGTGACTTAGGGAGAGCAGGG + Intergenic
1137723451 16:50641346-50641368 CTGGAGGCTTAGAGTGGGCAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138464830 16:57181857-57181879 ATGGTGCCCCAGAGAGTGCATGG - Intronic
1138527023 16:57614731-57614753 CTGCTGACTCTGAGGAGGCATGG + Intronic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1139651672 16:68365387-68365409 CTGGTCACTGGGAGATGGCAGGG - Intronic
1140904213 16:79396588-79396610 CTTGAGCCTCAGAGAGGTCATGG - Intergenic
1142062516 16:88039887-88039909 GTGGGGACTCAGAGGGGCCACGG - Intronic
1142185987 16:88694964-88694986 CTGGGGACTCAGCAAGGCCAGGG - Intergenic
1142307882 16:89295649-89295671 CTGCTGCCTCAGAAAGGCCATGG - Intronic
1142308899 16:89300672-89300694 CTGGTGCCTCAGATAGGAGACGG - Intronic
1143013898 17:3881553-3881575 CTGGGGACACAGGGAGGGAAAGG + Intronic
1143260525 17:5595232-5595254 CTGGAGACGCCGAGAAGGCAAGG - Intronic
1143455362 17:7064270-7064292 CTGGTGATTCAGAGTCGGCCAGG + Intergenic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1144708907 17:17387761-17387783 CTGGAAACTCAGAGAGGTTAGGG - Intergenic
1145164781 17:20604860-20604882 CTGTCCACTCAGTGAGGGCAGGG - Intergenic
1146676004 17:34774358-34774380 CTGGAGGCTCTGGGAGGGCAGGG - Intergenic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1148735402 17:49862317-49862339 CTGGGGGCTCCCAGAGGGCAGGG - Intergenic
1149538218 17:57448831-57448853 CTCGTTACACAGAGAGGCCAAGG - Intronic
1149559158 17:57595863-57595885 GTTGAGGCTCAGAGAGGGCAAGG + Intronic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1150633556 17:66897349-66897371 CTGGTGACTCACAGCTGGCGGGG - Intergenic
1150814027 17:68378588-68378610 CTGTGGACTCAGAGACAGCAGGG - Intronic
1151066010 17:71150967-71150989 CTGATGGTGCAGAGAGGGCATGG - Intergenic
1151671443 17:75573675-75573697 TCGGTATCTCAGAGAGGGCAGGG - Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152432187 17:80254655-80254677 CTTGTGAATGAGAGAGGGCCAGG - Intergenic
1152668920 17:81589745-81589767 CTGAGCACTCTGAGAGGGCAGGG + Intronic
1153783344 18:8513463-8513485 CTGGTCACTCTGACATGGCACGG - Intergenic
1154031915 18:10760677-10760699 CTGGAGATCCAGAGAGGCCAAGG + Intronic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155909461 18:31491761-31491783 CTTATGACTCAGAGAGGTGAAGG - Intergenic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1156899885 18:42288222-42288244 CTGGTGAGACATTGAGGGCAAGG - Intergenic
1160082227 18:75738976-75738998 CTGGTGTGTCAGAGAGGTCAAGG - Intergenic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1161034705 19:2078120-2078142 TTGGTGAGTCAGAGCTGGCAGGG - Exonic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161616518 19:5273971-5273993 AAGAAGACTCAGAGAGGGCAGGG + Intronic
1161743850 19:6042757-6042779 CTGATGTTTCAGAGAGGGGAGGG - Intronic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1163034063 19:14561472-14561494 CTGGGGGCTCAGGGAGGGCTGGG + Intronic
1163556540 19:17996718-17996740 GTGGTGCCTGAGAGAGGCCAGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164863319 19:31581120-31581142 CAGGGGACTCAGAGAGGTCCTGG - Intergenic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165771820 19:38384797-38384819 CTGGTGATTCAGTGTGGGTAGGG + Intronic
1166076211 19:40415068-40415090 CCGGTGGCTGAGAGTGGGCAGGG - Intergenic
1166123419 19:40699496-40699518 CTGGGCACTCTGAGAAGGCAAGG + Intronic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166661318 19:44649127-44649149 GTGATGACTCGGAGAGGGCAGGG - Intronic
1166687253 19:44802784-44802806 GTGATGACCCAGAGTGGGCATGG + Intergenic
1166721067 19:44996237-44996259 GTGATGACTCACAGTGGGCAGGG - Intergenic
1166780274 19:45338637-45338659 CTGATGACCCAGAGTTGGCAGGG + Intronic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1167684888 19:50950046-50950068 CTGGTTGCTCCCAGAGGGCACGG + Exonic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167696954 19:51020408-51020430 CTGGTGGCACACAGATGGCAGGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1167799073 19:51728646-51728668 CTGGGGAACCAGTGAGGGCAAGG + Intergenic
1168325236 19:55535541-55535563 GCTGAGACTCAGAGAGGGCAAGG + Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
929210358 2:39350060-39350082 CTGGTAACTAACAGAGGACAGGG + Intronic
929243525 2:39676943-39676965 CTAGAGATTCAGAGATGGCATGG + Intronic
929660293 2:43777520-43777542 CTGGTGACACAAAAAGGTCAAGG + Intronic
929913033 2:46108496-46108518 GTGGAGACTCAGAGAGGTCAAGG + Intronic
930404685 2:50940535-50940557 CTTGTGACCCAGAGAGCACAAGG - Intronic
931411622 2:62037996-62038018 CTGGTGAATCAGTCTGGGCATGG + Intronic
933160645 2:79020289-79020311 TAGGTGACTCAGCCAGGGCAAGG - Intergenic
934034574 2:88078159-88078181 CCTGTCACTCAGAGAGGGCTGGG - Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934796930 2:97109274-97109296 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG + Intergenic
935335644 2:102013407-102013429 GTGGTGAGTCAGAGTAGGCAAGG + Intronic
936533599 2:113293707-113293729 GTGGGGACTCAGAGAGGATAAGG - Intergenic
936545321 2:113387303-113387325 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
937799999 2:126072226-126072248 CTGTTGCCTCAGACAGTGCATGG - Intergenic
940812684 2:158263053-158263075 CTAGAGAGACAGAGAGGGCAAGG - Intronic
941754822 2:169173837-169173859 ATGGGGACTGAGAGAGGACATGG - Intronic
942026345 2:171914214-171914236 CTGGTGACATTCAGAGGGCAAGG + Intronic
942890952 2:180987345-180987367 GTGGTGACTAGGAGAGGACAAGG - Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946123159 2:217534499-217534521 CAGGAGTCTCTGAGAGGGCAAGG - Intronic
946408820 2:219506554-219506576 CCGGTGACTCACACAGGGCCTGG - Intronic
946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG + Intergenic
946856690 2:223957324-223957346 GGGGCGACTGAGAGAGGGCAGGG - Intergenic
948184295 2:236007786-236007808 CTGGTGATGCCGAGAGGGGAAGG - Intronic
948229642 2:236340718-236340740 CTCCTGCCTCAGAAAGGGCAGGG - Intronic
948459723 2:238123394-238123416 ATTGAGGCTCAGAGAGGGCAAGG - Intronic
948881241 2:240858313-240858335 CTGGTGCCTTAGTGATGGCAGGG - Intergenic
1168954225 20:1823569-1823591 CCTGAGGCTCAGAGAGGGCAGGG + Intergenic
1169260641 20:4135820-4135842 CTGGTGACTCAGGTAGGGGGAGG - Intronic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170312078 20:15003358-15003380 CTAGTAACTCACACAGGGCAAGG - Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171797077 20:29574963-29574985 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1171851173 20:30309201-30309223 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172146505 20:32762013-32762035 GCGGGGGCTCAGAGAGGGCAGGG - Intergenic
1172857498 20:38017137-38017159 CTAGAGGCTCTGAGAGGGCAGGG + Intronic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174423370 20:50415430-50415452 AAGGAGACTCAGAGAGGGCTGGG + Intergenic
1174451594 20:50624201-50624223 ATGGGGCCTCAGGGAGGGCAAGG - Intronic
1174519836 20:51120894-51120916 CTGGGGAGTCAGAGAGGTCTGGG + Intergenic
1174998577 20:55600469-55600491 CAGTGCACTCAGAGAGGGCATGG + Intergenic
1175420213 20:58827280-58827302 CTCCTGACTCATAGAGGGCCTGG + Intergenic
1178704747 21:34864134-34864156 GTGGGGCCACAGAGAGGGCAGGG - Intronic
1178805330 21:35834531-35834553 CTGGAGCCTCAGAGAGTTCAGGG - Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1180949107 22:19713358-19713380 CTGGTGATTCAGAGATGGAAAGG + Intergenic
1181317387 22:21979371-21979393 ATGCTGACCCAGGGAGGGCAAGG + Intronic
1182087864 22:27573818-27573840 CTTGGGACTCAGAGAGGGGCTGG + Intergenic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1183208384 22:36434698-36434720 CAGGTGACTCAGTGAGGTCAGGG + Intergenic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183667832 22:39255430-39255452 CTGTCAACTCTGAGAGGGCAGGG - Intergenic
1183863041 22:40683157-40683179 CTGGTGACTCAGCGGGGGTGAGG - Intergenic
1184416957 22:44357807-44357829 CAGGAGGCTCAGAGAAGGCAAGG - Intergenic
1184718495 22:46295774-46295796 CTGGGGGCTCAAAAAGGGCAGGG - Exonic
1184726646 22:46351143-46351165 CCGGTGTCCCAGAGAGGGCTGGG + Intronic
1184740823 22:46428217-46428239 CTGGTGATTCTGAGATGGCGCGG - Intronic
949876545 3:8629622-8629644 CTGGTGAGTCAGTGAGGGTGTGG - Intronic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
951411838 3:22375346-22375368 CTGCTCAGTCTGAGAGGGCAGGG + Intergenic
952646532 3:35665777-35665799 CTGGAGTCTCCTAGAGGGCAGGG + Intronic
953042800 3:39269726-39269748 CTGGGGACTCTGAGACAGCAGGG - Intronic
953851491 3:46468598-46468620 CTAGAGGCTCATAGAGGGCAGGG - Intronic
954289459 3:49642071-49642093 CTGGCAACTCCTAGAGGGCAGGG + Intronic
954440169 3:50517417-50517439 CTCCTGCCTCAGAGAGGGAAGGG - Intergenic
954798666 3:53174613-53174635 CTTGTGGCTCAGAGAGGCCCAGG + Intronic
954941406 3:54376279-54376301 CAGGTGACTGAGAGAGGTGACGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
955207725 3:56911544-56911566 CGTGTGACTCGGAGCGGGCAAGG - Intronic
955261874 3:57399490-57399512 ATGGTAACTAAGAGAGAGCAGGG + Intronic
955799418 3:62670567-62670589 CTGGTGACTCAAATACAGCAGGG - Intronic
956721362 3:72120757-72120779 CTGGTGAATGAGTGAGGGCATGG - Intergenic
960086832 3:113600379-113600401 CTGGTCACTCTGAGAGTGGATGG - Intronic
961009857 3:123428500-123428522 CTGGTGATTCTCAGAGGACAGGG - Intronic
961045993 3:123708465-123708487 CCAGTAACCCAGAGAGGGCAGGG + Intronic
961153702 3:124661220-124661242 CTGGTGACACATAGTGGGAAAGG + Intronic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961662532 3:128477321-128477343 CTGTTGCCACAGTGAGGGCAGGG - Intergenic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
962391326 3:134975213-134975235 ATGGGGACTCAGAGAGCTCAGGG + Intronic
964280396 3:155057714-155057736 GTGGTGACTTTGAGAGGGCAGGG + Intronic
964548199 3:157858407-157858429 ATGGTGTCTTAGATAGGGCAAGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964868645 3:161289349-161289371 CTGGTGCCTTAGAGAGGGCCTGG - Intergenic
964894166 3:161574793-161574815 CTGGTTACACAGAGAGGTCAAGG - Intergenic
967014989 3:185473593-185473615 CTGGTGACTTGGAAAGGTCAGGG - Exonic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967936518 3:194732453-194732475 CTGGTGATTTCGAGAGGGAATGG + Intergenic
968980042 4:3842628-3842650 CTGGTCACCCAGAGACGCCAAGG + Intergenic
969210767 4:5685497-5685519 CATGTGACTCAGGGAGGGCTTGG + Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971674197 4:29604047-29604069 GTGGTGACTCAGAGAAGGATTGG + Intergenic
975766693 4:77676060-77676082 CTGGAGACTCTCAGAAGGCAGGG + Intergenic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
979174758 4:117650067-117650089 CTGGGGCCTGTGAGAGGGCAGGG + Intergenic
982010393 4:151100127-151100149 CTGGTAACTAAGAGACTGCATGG - Intronic
982742779 4:159074988-159075010 GTGGTCACTGTGAGAGGGCAAGG - Intergenic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
984571725 4:181403485-181403507 CTGGAGACAGAGAGAGGGCAGGG + Intergenic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
985701010 5:1372550-1372572 CTGGTGGCTCAGGGACTGCAAGG + Intergenic
985757675 5:1728900-1728922 GTGGTGACACAGAGTGGGCCTGG - Intergenic
986342649 5:6804189-6804211 GTGGATCCTCAGAGAGGGCATGG - Intergenic
989398718 5:40986154-40986176 CTGGGAACACAGAGAGGTCAAGG + Intergenic
990509350 5:56476205-56476227 CTTGAGACTCAGACATGGCAGGG - Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994216928 5:97148089-97148111 CAGGTGACTGAGAGAGGGAGTGG + Intronic
994275785 5:97835584-97835606 ATGTTCACTCAGTGAGGGCAGGG + Intergenic
996165276 5:120215054-120215076 CTGTTGCCTCAGACAGTGCATGG + Intergenic
997242567 5:132318625-132318647 GGAGTGACTCAGAGAGGGCCAGG - Intronic
998183494 5:139961666-139961688 CTGGTGACACATAGTGGGAATGG - Intronic
998384040 5:141745880-141745902 CTGCTGAGGCAGAGAGGGCTTGG - Intergenic
998648208 5:144088334-144088356 ATGGTGATTTAGAGAGGGCTTGG - Intergenic
999715449 5:154356486-154356508 ATTATGAATCAGAGAGGGCAGGG - Intronic
999831508 5:155324630-155324652 ATGGTGACTCAGAGAGATCCTGG - Intergenic
1001001934 5:168015693-168015715 TTGCTGACTCAGAGAAGGAATGG - Intronic
1001251951 5:170153378-170153400 CTGGTGTCTAAGACAGGGCTTGG - Intergenic
1001397446 5:171427523-171427545 GTGGAGACTCAGAGAGGTTAAGG - Intronic
1001557254 5:172645219-172645241 GTGGAGGCTCAGAGAGGTCAAGG + Intronic
1002352724 5:178594446-178594468 CTGGTAACTCAGAGAACGCTGGG + Intergenic
1003094039 6:3128515-3128537 CGGGTGAATCAGAGAGGGTCTGG - Intronic
1005511599 6:26516834-26516856 CAGGGGACACACAGAGGGCACGG - Intergenic
1005708467 6:28480779-28480801 CTTGAACCTCAGAGAGGGCATGG + Intergenic
1005823146 6:29614635-29614657 CTGATGATTAAGAGAGGGCATGG - Intronic
1006026183 6:31148580-31148602 CTAGAGACTCGGGGAGGGCAAGG - Intronic
1006517691 6:34553858-34553880 CTGGTTCCTCCTAGAGGGCAGGG - Intronic
1006790640 6:36698916-36698938 CTGGTCCCTCAGAGACAGCAAGG - Intronic
1007066563 6:38996771-38996793 CTGGTGTGTTAGAGAGGACACGG + Intronic
1007223739 6:40298634-40298656 CTGGGGACTCAGGGAGGGCAAGG + Intergenic
1007364015 6:41377525-41377547 ATGGTTACTTAGAGAAGGCATGG + Intergenic
1007602305 6:43090148-43090170 CTGGTGACCCAGAAAGGGGTAGG + Intronic
1007763436 6:44147566-44147588 GTGGGGACTCACTGAGGGCAGGG - Intronic
1008164280 6:48116856-48116878 CTGGCTACTCAGAGAAGACATGG - Intergenic
1008595277 6:53035785-53035807 CTGCTGACTCAGAAGGGGAAGGG - Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1016191735 6:141276833-141276855 CCGGTGGCTCACAGAGGGGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1017798408 6:157869186-157869208 CTCGTGAGGCAGAGAGGGGAGGG - Intronic
1019049237 6:169170399-169170421 ATGGTGAACCAGACAGGGCAGGG - Intergenic
1019196235 6:170284735-170284757 CTGGGGAATGAGAGAGGCCAGGG - Intronic
1019521718 7:1463667-1463689 CTGGGGACCCAGGGAGGACATGG + Intergenic
1020083783 7:5299721-5299743 GAGGGGACTCAGAGAAGGCAGGG + Intronic
1023319360 7:38976301-38976323 CTGCGGGCTCACAGAGGGCAGGG - Intergenic
1024475139 7:49801490-49801512 ATGGTCACTCACACAGGGCATGG - Intronic
1025210496 7:57017464-57017486 GAGGGGACCCAGAGAGGGCAGGG - Intergenic
1025661460 7:63559383-63559405 GAGGGGACCCAGAGAGGGCAGGG + Intergenic
1025981625 7:66411904-66411926 CTGATCACTCAGAGGGGGAAAGG + Intronic
1026019234 7:66694960-66694982 CTGGTGACCCAGGGAGAGTATGG + Intronic
1026309928 7:69174589-69174611 CAGAAGACTCAGAGAAGGCAAGG + Intergenic
1026829614 7:73602896-73602918 CTGGTGACTCAGGGATGAGAGGG - Intronic
1026963503 7:74424711-74424733 CTGGGCACTCCCAGAGGGCAGGG - Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028739359 7:94254572-94254594 CTTGTCACTCAAAGAGGGGAAGG - Intergenic
1029193215 7:98786352-98786374 CTGCTGAGTCAGAGAGGAGAAGG - Intergenic
1029551114 7:101237606-101237628 CTGGTGCCCCAGAGAGGGGGAGG + Exonic
1029615098 7:101651282-101651304 CCAGAGGCTCAGAGAGGGCATGG + Intergenic
1029646056 7:101856848-101856870 GTGGGGACACAGAGAGGTCAAGG - Intronic
1029973245 7:104810110-104810132 TCAGTGACTCAGAGAGAGCATGG + Intronic
1030078564 7:105758001-105758023 CTAGTGATCCAGAGAGGGCCTGG - Intronic
1030308732 7:108047324-108047346 TTGCTGTCTCAGAGATGGCAGGG - Intronic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1032440014 7:131935397-131935419 CTGTTGACTCTGTGTGGGCAGGG + Intergenic
1033166545 7:139043310-139043332 CTGGGGATTTAGAGAGGGAAGGG - Intergenic
1034292664 7:149945262-149945284 CTGGTCCCTGAGGGAGGGCAAGG + Intergenic
1034549926 7:151813951-151813973 GTGATGACTCAGGAAGGGCAAGG + Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034813406 7:154151630-154151652 CTGGTCCCTGAGGGAGGGCAAGG - Intronic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1035756049 8:2033870-2033892 CTGGGAGCTCAGATAGGGCAAGG - Intergenic
1036394573 8:8358279-8358301 GTGGTTTGTCAGAGAGGGCATGG - Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1037806397 8:22059998-22060020 CTGGTGGCTCAGATAAGGCAGGG + Intronic
1039097689 8:33904245-33904267 CTGGTATCTCAGAGAAGGGAGGG + Intergenic
1039191830 8:34984995-34985017 CTGATGATTCAGAGACAGCATGG + Intergenic
1040709972 8:50176205-50176227 CTTGTGACACAGAGAGGGGCAGG - Intronic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1041835751 8:62212835-62212857 CTGATGAGTCAGTGAGTGCACGG + Intergenic
1042252469 8:66770639-66770661 CTGGCAACTCACAGAGGGCCAGG - Intronic
1042876904 8:73448650-73448672 CTGGGGTCTCAGTGAGGTCATGG + Intronic
1045000136 8:97871278-97871300 CTGGCACCTAAGAGAGGGCAAGG + Intronic
1045135935 8:99218444-99218466 CTGTAGACTAAGAGAGGGTAAGG + Intronic
1046652783 8:116856703-116856725 CCCCTGCCTCAGAGAGGGCAGGG + Exonic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047727578 8:127697256-127697278 CTGGAGAGTCAGAAAGGCCAAGG - Intergenic
1048996772 8:139799490-139799512 TGGGTGATTCAGAGAGGGTAAGG - Intronic
1049385524 8:142341200-142341222 GTGGGGACTGAGAGAGGACAAGG + Intronic
1049758934 8:144323177-144323199 TTGGTGGCTCAAAGGGGGCAGGG - Intronic
1050263785 9:3869037-3869059 CTGGATACTCTGAGAGGGCAAGG + Intronic
1050393015 9:5167087-5167109 GGCGTGACTCAGAGAGAGCAAGG + Intronic
1052920173 9:33959121-33959143 CTGGTGACAGAGCGAGAGCAAGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053788947 9:41672481-41672503 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054156192 9:61642286-61642308 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1054177229 9:61883826-61883848 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054475963 9:65573287-65573309 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054660304 9:67696979-67697001 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1056472850 9:86922871-86922893 CTGGAGGCTCAGCGAAGGCAGGG + Intergenic
1057819725 9:98321694-98321716 CTGGTCCCTCAGACATGGCATGG + Intronic
1057889877 9:98861808-98861830 ATTGAGACTCAGAGAGGGTAAGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1059627621 9:116084327-116084349 CTGTTGGCTCCAAGAGGGCAGGG + Intergenic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060191951 9:121599261-121599283 CTGGGGACTCCGGGAGGGGAGGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061137175 9:128741646-128741668 CTGGTCACACTGTGAGGGCAGGG + Exonic
1061545002 9:131299347-131299369 CAGTTGACTCAAGGAGGGCAAGG - Intronic
1061742583 9:132717812-132717834 ACTGTGGCTCAGAGAGGGCAGGG - Intergenic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062461705 9:136665165-136665187 CTGATGCCTGAGAGAGGGCCAGG + Intronic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1189288124 X:39866523-39866545 CTGGGGAGTGAGAGTGGGCAGGG + Intergenic
1190463079 X:50698343-50698365 CTGGTGACTGAGAAGGGGCATGG - Intronic
1191900020 X:66031297-66031319 CTGGTCAAGCAGAGAGGGCAGGG - Intronic
1192179466 X:68907331-68907353 ATGGGGGCTCAGAGAAGGCAAGG + Intergenic
1194984148 X:100471853-100471875 CTAGTCCCTCTGAGAGGGCAAGG + Intergenic
1195018524 X:100801904-100801926 CCTCTGCCTCAGAGAGGGCAGGG - Intergenic
1195344162 X:103932003-103932025 GTGGTGACCCAAGGAGGGCATGG + Intronic
1195399056 X:104442400-104442422 GTGATGACTGAGAGAAGGCATGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197180947 X:123536009-123536031 ATGGTGACTAAAAGAGAGCAGGG + Intergenic
1197760482 X:130024530-130024552 TTGGGGTCTCAGACAGGGCAAGG - Intronic
1198118652 X:133569332-133569354 CTGGAGACAAAAAGAGGGCAGGG - Intronic
1198412883 X:136389636-136389658 CTCGAGTCTCAGAGAGGGGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199409945 X:147509856-147509878 CTGGTGCATCATAGATGGCAAGG - Intergenic
1199672170 X:150156263-150156285 CTGCTGAATGAAAGAGGGCAAGG + Intergenic
1199829512 X:151535462-151535484 CTGGTAGCTGACAGAGGGCAGGG - Intergenic
1199937707 X:152591807-152591829 CTCATGACTCAGAGAAGGAAAGG + Intergenic
1200167680 X:154048510-154048532 CTGGTGACTGAGCGAGGTAAGGG - Intronic