ID: 961807660

View in Genome Browser
Species Human (GRCh38)
Location 3:129500915-129500937
Sequence CAGTAGAGCAGGAGGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961807653_961807660 21 Left 961807653 3:129500871-129500893 CCTCAGGCAGGCAGGTAGAATGG 0: 1
1: 0
2: 3
3: 23
4: 257
Right 961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG 0: 1
1: 0
2: 0
3: 27
4: 275
961807650_961807660 24 Left 961807650 3:129500868-129500890 CCCCCTCAGGCAGGCAGGTAGAA 0: 1
1: 0
2: 2
3: 33
4: 198
Right 961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG 0: 1
1: 0
2: 0
3: 27
4: 275
961807652_961807660 22 Left 961807652 3:129500870-129500892 CCCTCAGGCAGGCAGGTAGAATG 0: 1
1: 0
2: 2
3: 15
4: 207
Right 961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG 0: 1
1: 0
2: 0
3: 27
4: 275
961807651_961807660 23 Left 961807651 3:129500869-129500891 CCCCTCAGGCAGGCAGGTAGAAT 0: 1
1: 0
2: 1
3: 17
4: 176
Right 961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG 0: 1
1: 0
2: 0
3: 27
4: 275
961807656_961807660 -5 Left 961807656 3:129500897-129500919 CCAGATAACTGGCTAGTGCAGTA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG 0: 1
1: 0
2: 0
3: 27
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961807660 Original CRISPR CAGTAGAGCAGGAGGGAACT TGG Intronic
901495188 1:9617021-9617043 CAGAAGATCAGGAAGGAATTTGG + Intergenic
901560325 1:10065225-10065247 CACTAAAGCAGATGGGAACTAGG + Intronic
902157962 1:14505014-14505036 GTGTAGCTCAGGAGGGAACTAGG + Intergenic
902661462 1:17906918-17906940 CTGTGGAGGAGGAGGGAGCTGGG + Intergenic
902787577 1:18742982-18743004 CACATGAGCAGGAGGTAACTGGG + Intronic
903059560 1:20660627-20660649 CAGCAGAGCAGCAGGGCCCTGGG + Intronic
904317707 1:29676566-29676588 CATCAGAGCAGGGAGGAACTAGG + Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
904808788 1:33150102-33150124 CAGAGGAGAAGGAGGAAACTGGG + Intronic
905025930 1:34849432-34849454 CATTAGAACAGGAGGGAGCAGGG + Intronic
905408541 1:37753354-37753376 CAGTCGGGGAGGAGGGAACCAGG + Intronic
905510315 1:38514255-38514277 CATTTTACCAGGAGGGAACTTGG + Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905864937 1:41371621-41371643 CCTAAGGGCAGGAGGGAACTTGG - Intronic
906501561 1:46344814-46344836 CAGTCGAACAGCAGGGAATTTGG - Exonic
906789756 1:48648459-48648481 CAAGAGAGTAGGAGGGAAATAGG + Intronic
908273156 1:62440074-62440096 CAGTAAAGCAGCAGTGAACTTGG + Intronic
908537313 1:65090273-65090295 AAGATGAGCAGGAGGTAACTTGG + Intergenic
913326658 1:117633972-117633994 CACTAGAGCAGGAGGGTTCTGGG - Intergenic
915601292 1:156924577-156924599 CAGGGGAGCGGGAGGGAGCTGGG - Intronic
915830467 1:159124784-159124806 CAGTAGAGCAGGAGGAAAACAGG + Intronic
917439511 1:175054761-175054783 GAGTAGAGCTGGAGGGAGATGGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
920258442 1:204672672-204672694 AAGGAGAGCAAGAGGGAGCTAGG - Intronic
920609184 1:207421163-207421185 CAGATGAACAGGAGGGAGCTAGG - Intergenic
920611407 1:207441512-207441534 AAGTGTAGAAGGAGGGAACTTGG - Intergenic
921512248 1:216046532-216046554 CAGGAGAGCAGCAAAGAACTGGG + Exonic
923096111 1:230776473-230776495 CAGTTGAGCAAGAGGGATCATGG - Intronic
1063342087 10:5275404-5275426 GAGCAGAGCAGGAGGGAGGTGGG - Intergenic
1064284008 10:13976367-13976389 CAGAAGAGGAGGTGGGACCTTGG + Intronic
1064981017 10:21166717-21166739 CAGTAGGCCAGGATGGAGCTAGG + Intronic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1068119921 10:52774854-52774876 CTGGAGAGCAGGATGTAACTGGG - Intergenic
1068440508 10:57049423-57049445 CAGTAAAGCAGGAGACAGCTAGG - Intergenic
1068660021 10:59614104-59614126 CACAAGAGCAGGAGGGCACAGGG + Intergenic
1069799839 10:71075279-71075301 AAGTAGAGCAGCAGGGGCCTGGG - Intergenic
1069834243 10:71298711-71298733 CATGGGAGCAGGAGGGAACACGG + Intronic
1069873358 10:71546731-71546753 CAGTGGAGGAGCTGGGAACTAGG + Intronic
1070499817 10:77062016-77062038 CTGTACAGCATGAGGGAATTTGG + Intronic
1070771043 10:79082497-79082519 TATTGGAGCAGGAGGGACCTGGG + Intronic
1071803424 10:89090142-89090164 AGGTAGAGTAGGAGGAAACTGGG - Intergenic
1072495580 10:95954862-95954884 CAATAGAACTGGAGGAAACTAGG - Intronic
1072521295 10:96232197-96232219 CAGCGGGGCAGGAGGGAGCTGGG - Intronic
1072803663 10:98410601-98410623 CATGAGAGCAGGTGGGAACCAGG - Intronic
1072805884 10:98423908-98423930 CATTACAGCAGAAGGGACCTAGG + Intronic
1073717196 10:106121149-106121171 CAGTAGAGCAGGAGAGAGAAAGG + Intergenic
1074205507 10:111279580-111279602 CATGAGAGCAGGAGGACACTGGG + Intergenic
1074260909 10:111852235-111852257 CAGTGGAGCAGGAGAGCCCTGGG - Intergenic
1074448443 10:113539415-113539437 AAGCAGAGTGGGAGGGAACTTGG - Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075476679 10:122741397-122741419 CTGTAGAGCAGGAGAGAATAGGG + Intergenic
1075482375 10:122793078-122793100 CAGTAGAGCAAGATGAAACCGGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077827670 11:5827968-5827990 AAGTAGAGAAGGAGCCAACTAGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078519323 11:12050814-12050836 CTGCAGAGCTGGAGGGAACTGGG + Intergenic
1078522826 11:12077037-12077059 CTTTTGAGGAGGAGGGAACTGGG + Intergenic
1078693342 11:13603907-13603929 CATGAGAGAGGGAGGGAACTTGG - Intergenic
1079209787 11:18450564-18450586 CAGTGAAGCAGGAGGTGACTGGG - Intronic
1079249998 11:18780367-18780389 CAGAAAAGCAGGAGGGAGCATGG - Intronic
1080458210 11:32433782-32433804 CAGGATACAAGGAGGGAACTCGG - Intronic
1080587639 11:33696003-33696025 CAGAAGAGCAGGAGAGAAGAGGG - Intergenic
1080826329 11:35852196-35852218 CAGCAGAGAAGGAGTGAAATGGG - Intergenic
1081800983 11:45859177-45859199 CTGTTGAGCAGGATGGAAGTGGG - Intronic
1084069219 11:66723264-66723286 CAAGAGAGGAGGAGGGGACTGGG + Intronic
1084273379 11:68040381-68040403 AAGGAGAGAAGGAGGGAACGAGG - Intronic
1084357530 11:68650112-68650134 CAGCAGAGCAGGCGGGAAAGGGG - Intergenic
1084527965 11:69709090-69709112 CCATGGAGCAGGAGGGAAATGGG + Intergenic
1084663274 11:70559754-70559776 CATTTGGGCAGGAGGGGACTGGG - Intronic
1084904750 11:72336936-72336958 CACTGGAGGAGGAGAGAACTGGG - Intronic
1085076373 11:73596726-73596748 CTGGAGAGCAGGGGGGAATTGGG - Intronic
1085597865 11:77826602-77826624 CAGTGTAGCAGGAGTGTACTTGG - Intronic
1085929022 11:81058395-81058417 CTTTAGAGCAGGATGTAACTGGG + Intergenic
1086399572 11:86449487-86449509 CAGAAGATAAGGAGGAAACTGGG + Intronic
1086506842 11:87514020-87514042 GAGTAGAGCAGACTGGAACTGGG - Intergenic
1086832809 11:91586462-91586484 CAGTAGAAGAGGTGGGAACTTGG - Intergenic
1088698944 11:112394891-112394913 CAGACGAGCAGGTGAGAACTAGG - Intergenic
1089747862 11:120629655-120629677 GAAAAGAGCAGGAGGGAAGTTGG - Intronic
1089776201 11:120837956-120837978 GAGTAGAGGAGGAAGGAACTGGG + Intronic
1090505159 11:127303861-127303883 CATGAGAGCAGCAGGGACCTTGG + Intergenic
1090660038 11:128875644-128875666 CAGAAGGGCAGGTGGGAACAAGG + Intergenic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091194580 11:133720126-133720148 CTGTGGAGCGGGAGGGTACTGGG + Intergenic
1091788791 12:3259225-3259247 AAGAAGAGCAAGAAGGAACTTGG - Intronic
1091827697 12:3525335-3525357 CTGAAGAGCAGGAGGGGGCTGGG + Intronic
1091970581 12:4783273-4783295 GGGTAGAACAGGAGGGAACCTGG + Intronic
1092520814 12:9270779-9270801 CAGCAGAGAAAGAGGGAAATAGG - Intergenic
1093473898 12:19534076-19534098 CTGAAGAGCATGAGGGAGCTAGG + Intronic
1094143709 12:27206958-27206980 AAGGAGAGCAGAGGGGAACTTGG - Intergenic
1096427235 12:51514374-51514396 CAGTAAAGGAGGGAGGAACTTGG - Exonic
1096568871 12:52507135-52507157 CAGCATAGCTGGAGGGAGCTGGG + Intergenic
1096953516 12:55501408-55501430 CAGTAGAGCAGGAGGATATATGG - Intergenic
1097573816 12:61365586-61365608 CAGTGGAGCAGGAGTGGAATGGG - Intergenic
1097806597 12:63971307-63971329 CTGTAGACCAGGAGGTAACCTGG + Intronic
1100312782 12:93413043-93413065 CAGAAGAGGAGGAGAGAAATTGG - Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102879490 12:116473476-116473498 CAGAGCAGCTGGAGGGAACTAGG + Intergenic
1104299316 12:127549797-127549819 CACTAGACCAGGAGGGAAGAAGG - Intergenic
1106121770 13:26865666-26865688 CACTGGAGCAGGAGGGAGCAAGG - Intergenic
1112284267 13:98089874-98089896 CAGGAGAGCAGGTGGCCACTTGG + Intergenic
1112776588 13:102850304-102850326 CCTTAGAGTAGGAGAGAACTAGG + Intronic
1112801001 13:103109798-103109820 CAGAACAGCAGGAGGAGACTGGG - Intergenic
1114211663 14:20621064-20621086 CAGTAGGGAGGGAGGAAACTTGG - Intergenic
1118170860 14:63387180-63387202 CAGTAAAGAAGGAGGCACCTAGG - Intronic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1119635586 14:76270742-76270764 CAGCAAAGCAGGAGGGACTTAGG + Intergenic
1120110518 14:80549234-80549256 CATTAGAGCAGTGGGAAACTTGG + Intronic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121643079 14:95499380-95499402 AAGTAGAGGAGGTGGGAAGTAGG - Intergenic
1121709674 14:96028159-96028181 CAGGAGAGCTGGAGGGGGCTAGG - Intergenic
1121947655 14:98138225-98138247 CAGGAGAGCAGGAGGCGGCTGGG + Intergenic
1122852539 14:104544544-104544566 CATTAGAGCTGCAGGGGACTGGG + Intronic
1123044483 14:105504513-105504535 CAGTAGAGAGGGAGGGAGTTCGG + Intergenic
1123054868 14:105564574-105564596 CAGGACAGCAGCAGGCAACTCGG - Intergenic
1123079312 14:105684153-105684175 CAGGACAGCAGCAGGCAACTCGG - Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1125682270 15:41539002-41539024 TAGGAGAGCTGGAGGGAAATGGG + Intronic
1125685484 15:41560908-41560930 CCTTAGAGCCGGAGGGAACTTGG + Intronic
1126774157 15:52085480-52085502 TAATAGAGCAGGAGGAATCTTGG + Intergenic
1127597259 15:60498238-60498260 AAGTAGAGCAGAAGGCATCTTGG - Intronic
1129967792 15:79752335-79752357 AAGTACAGCAGGAGTGATCTTGG + Intergenic
1131106331 15:89737290-89737312 CAGCAGAGAAGCAGAGAACTTGG + Intronic
1133834720 16:9357398-9357420 CAGAAGAGGAGCAGGGAAATGGG - Intergenic
1135131848 16:19859887-19859909 CAGTAGAGGTGGAGGGACCCTGG - Exonic
1138277578 16:55747194-55747216 TATTAGAGCAGGAGGAAGCTGGG - Intergenic
1138277673 16:55747899-55747921 TGTTAGAGCAGGAGGAAACTGGG - Intergenic
1138369595 16:56516126-56516148 GAGAACAGCAGGAGGGAACTGGG - Intronic
1139732254 16:68956529-68956551 AAGCAGAGCAGGAGGGAATAAGG + Intronic
1139848002 16:69934152-69934174 AGGGAGAGGAGGAGGGAACTAGG - Intronic
1140133435 16:72184079-72184101 CAGAAGAGCAGGAGGAAATCTGG - Intergenic
1140788299 16:78364809-78364831 TGGGAGAGCAGGAGGGAACAAGG + Intronic
1142088463 16:88197328-88197350 CACTAGAGCAGGAGCGAGCAGGG + Intergenic
1143243322 17:5462335-5462357 CAGAAGAGGAGAAAGGAACTCGG - Exonic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1144992305 17:19241887-19241909 CAGTGGAGCAGAAGGGACCCAGG - Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145799390 17:27673355-27673377 CAGTTGAGCAGGAGGGTGTTTGG + Intergenic
1145822988 17:27854518-27854540 CAGCAGAGCAAGATGGAGCTGGG - Intronic
1146601641 17:34222172-34222194 AAGTGGAGCATGAGGAAACTTGG - Intergenic
1147419310 17:40314274-40314296 TTGTTGAGCAGGAGGGAAATTGG - Intronic
1148106731 17:45122846-45122868 CAATAGAGGAGGTGGGAACTGGG + Intronic
1148541401 17:48483516-48483538 CAGTGGAACAGGAGGGGAATTGG - Intergenic
1148857340 17:50585935-50585957 CAGTGGAGCAGGTGGAAGCTGGG + Intronic
1149565883 17:57640127-57640149 CATCAGGGCAGGAGGGCACTGGG + Intronic
1149999420 17:61424349-61424371 CAGTAGGTCAGGATGGAACTTGG - Intergenic
1152221913 17:79073543-79073565 GAACACAGCAGGAGGGAACTTGG + Intergenic
1156590419 18:38481760-38481782 CAATAAAGAAGGAGGGAGCTGGG + Intergenic
1157451104 18:47789769-47789791 GTGTAGAGCAGGAGGTAACCTGG + Intergenic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1158589748 18:58769165-58769187 AACTAGAGTAGGAGGGACCTAGG - Intergenic
1159633431 18:70777073-70777095 AAGTAGAGTTGGAGGGAAATTGG + Intergenic
1160535768 18:79590502-79590524 CAGAGCAGCAGGAGGGAGCTGGG + Intergenic
1160901617 19:1431715-1431737 CAGTAGAGAAGAAGGGACATGGG + Intronic
1161770947 19:6230417-6230439 CAGCAGAGCTGGAGGGGACCTGG - Intronic
1162462449 19:10821136-10821158 GAGCAAAGCAGGAGGGAACCAGG - Intronic
1164512475 19:28908925-28908947 CAGTTGAGCAAGAGGAACCTCGG - Intergenic
1165097269 19:33416520-33416542 CAGGTGAGCAGGAGGGAGCAGGG - Intronic
1165137857 19:33681655-33681677 CACCAGAGCTGCAGGGAACTTGG + Intronic
1167981719 19:53281655-53281677 CAGCAGAGCAGGAGGAATCCAGG + Intergenic
1167984373 19:53302007-53302029 CAGCAGAGCAGGAGGAATCCAGG - Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
926133815 2:10322726-10322748 CAGTAGAGCAGAAGAAGACTGGG + Intronic
926764466 2:16312161-16312183 GAGAAAAGCAGGAGGGAGCTTGG - Intergenic
927013920 2:18935798-18935820 CAGTAGGTCAGTAGGGTACTGGG + Intergenic
928602366 2:32915992-32916014 AAGTAGAGCAGGAGGGAAGGAGG - Intergenic
929962044 2:46504299-46504321 AAGAAGGGGAGGAGGGAACTGGG - Intronic
930029451 2:47049362-47049384 CAGTATAGCAGCAGGGATCTGGG + Intronic
931666554 2:64613349-64613371 CAGTGGAGGAGGAGAGAGCTGGG - Intergenic
932584777 2:73020799-73020821 CAGTGGCGCAGTAGGGAGCTGGG + Intronic
936073091 2:109384328-109384350 CAGGAGAGGAGGAAGGACCTGGG + Intronic
937013257 2:118580767-118580789 CAGAAGAGCTGGAAGGAACTAGG - Intergenic
937454378 2:122028695-122028717 CAGAAGAGCAGGAGGAGACGGGG - Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
942000056 2:171637220-171637242 CATTTGAGCAGGATGGAGCTTGG - Intergenic
942171139 2:173290754-173290776 CTGCAGAGCAGGAGGGACTTGGG + Intergenic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
943410570 2:187541822-187541844 CAGCAAAGCAGGAGAAAACTTGG + Intronic
943796938 2:192007921-192007943 GAGTAGAGCAGGAAGGACATGGG - Intronic
944483697 2:200181968-200181990 CAGTGGAGCTGGTGGGAGCTGGG + Intergenic
947032131 2:225808303-225808325 CAGAGGAGCAGGAGGAAGCTTGG - Intergenic
947111203 2:226721403-226721425 CAGGAGAGCTGGAGGGAGCAAGG + Intergenic
947450953 2:230208476-230208498 TAGAAGAGAAGGAGGGAACTCGG + Intronic
948928817 2:241117189-241117211 CAGGAGAGAAGGGGGCAACTTGG + Intronic
1169016451 20:2296696-2296718 CAGGAGAGCACCAGGGAACAGGG + Intronic
1169136865 20:3203066-3203088 CGGTAGAGTAGGGGGGGACTTGG - Intronic
1170869599 20:20193036-20193058 CAGAAGAGCATGAGGGATGTGGG + Intronic
1172230122 20:33330769-33330791 CAGCAGAGCAGGAGGGACCAAGG + Intergenic
1172760603 20:37318592-37318614 CAGTAATGCAGGAGGGAAATCGG - Intergenic
1173018521 20:39248127-39248149 CAATAGAAGAGGAGGGCACTTGG + Intergenic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173417499 20:42869913-42869935 TAAAAGAGCTGGAGGGAACTAGG + Intronic
1173584878 20:44174946-44174968 CTGGAGTGCAGGAGGGATCTTGG - Intronic
1175462877 20:59166550-59166572 GAGGAGAGCAGGAGGGATTTGGG - Intergenic
1175555219 20:59848108-59848130 CAGTATACCAGGAGGGAAGGAGG - Intergenic
1175691296 20:61067711-61067733 CAGTAGAACTGGGGGCAACTGGG - Intergenic
1177473894 21:21593936-21593958 AAGTAGAGCAGAAGGGAAATGGG - Intergenic
1181626354 22:24124784-24124806 CAGCTGAGCAGGAGGCAACTGGG - Intronic
1182464458 22:30505758-30505780 CTGGAGAGGAGGAGAGAACTGGG - Intergenic
1182767537 22:32769192-32769214 AAGTAGAACAGGGGGGAAATGGG - Intronic
1182932539 22:34188903-34188925 CAGAAGAGCAGGAGGGCAAAAGG + Intergenic
1183281928 22:36936781-36936803 CACTAAAGCAGGAGGCACCTGGG + Intronic
1183442804 22:37832819-37832841 CAGTGGAGCAGGTGCCAACTGGG + Intronic
1183741922 22:39673549-39673571 CAGAAGAGCAAGAGGCACCTGGG - Intronic
1184490742 22:44807347-44807369 CAGCAGGGCAGGATGGAACGTGG + Intronic
950787767 3:15450228-15450250 CAGTAGAGGCGAAGGGAACAGGG + Exonic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
953272205 3:41456835-41456857 CAGAAGTGCAGAAGGAAACTAGG - Intronic
953273899 3:41475990-41476012 CAGGAGAGAAGGAGGGAAAAAGG + Intronic
955068982 3:55556421-55556443 AAGTGGAGGAGGTGGGAACTTGG - Intronic
958195011 3:90233235-90233257 AAGTAGTGGAGGAGAGAACTTGG + Intergenic
959667892 3:108941978-108942000 AATTAGAGCAGGAGGGAAGAGGG - Intronic
961085993 3:124067925-124067947 CAGTACATCAGGAGGCAGCTGGG - Intergenic
961100383 3:124193556-124193578 GAGTATAGTAGGAGTGAACTTGG - Intronic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
962017648 3:131458829-131458851 GAGTTGAGCAGGAGAGTACTGGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
963138415 3:141928689-141928711 CTCTCGGGCAGGAGGGAACTGGG + Intergenic
966052483 3:175637579-175637601 CAAGAGAGCAAGAGGGGACTGGG - Intronic
968492426 4:897207-897229 CAGGAGAGCAGGGGGCAAGTGGG + Intronic
969220528 4:5755796-5755818 CAGCAGAGCAGCAGGAGACTGGG - Intronic
969436575 4:7192565-7192587 CGGGAGAGCAGGAGGGCGCTGGG - Exonic
974106888 4:57479935-57479957 CAGTGGAGAAGGTGGGAACGGGG - Intergenic
976382109 4:84411384-84411406 CAGAAAAGCAGGAGGCAATTTGG - Intergenic
977577000 4:98685376-98685398 CAGTAGAGTAGGAAGGAGCCGGG - Intergenic
982165125 4:152607325-152607347 CACTTCAGCAGGAGGGCACTGGG + Intergenic
982321039 4:154077846-154077868 GAGAAGGGCAGGAGGGAAATGGG + Intergenic
983096237 4:163565636-163565658 CAGGAGAGCAGGAGTAAAGTGGG + Intronic
983528523 4:168785323-168785345 CAGTAGAGGAGGCAGGAACAAGG - Intronic
984864681 4:184271583-184271605 CAGTAGAGCAAGAAGGAAATGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986033734 5:3918201-3918223 CAGGACAGCAGGGGAGAACTGGG + Intergenic
989622411 5:43397473-43397495 CTGTGGACCAGGAGGGTACTTGG - Intronic
990953692 5:61323134-61323156 AAGCCGAGCAGGAGGAAACTAGG + Intergenic
992104015 5:73435972-73435994 CAAGACAGAAGGAGGGAACTAGG + Intergenic
993413877 5:87601981-87602003 CAGTAAAGCAAGCGGGATCTGGG + Intergenic
994275811 5:97836090-97836112 CACTATAGCAGGAAGGAACATGG - Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
996823611 5:127657082-127657104 GAGCAGAGCAGGAGGAGACTTGG + Intronic
997885813 5:137629055-137629077 CAGTACAGGAGGAGAGAAGTGGG - Intronic
999350203 5:150862819-150862841 CCCTAGACCAGGAGGGACCTGGG + Intronic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
999909730 5:156184695-156184717 TAGCAGAGCAGGAGGGAATAAGG - Intronic
1001054033 5:168434795-168434817 CAGTAGAGCAGTGGGCAACTAGG - Intronic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1002285811 5:178162039-178162061 GGGTAGAGGAGGAGGGTACTGGG + Intergenic
1002330576 5:178437699-178437721 CAGGTGAGCAGCAGGGAAGTAGG - Intronic
1002983225 6:2162849-2162871 TTGGAGAGCAGGAGGGAACTCGG - Intronic
1003509230 6:6765550-6765572 CAGGAGATCTGGAGGGAACAAGG + Intergenic
1003766538 6:9243365-9243387 CAGTTGCCCAGGAGAGAACTTGG + Intergenic
1004243847 6:13953422-13953444 CTATAGAGCAGGAGGTAAGTAGG + Intronic
1005200184 6:23335870-23335892 GAGTAGAGCAGGAGGGCACCAGG + Intergenic
1006893656 6:37451701-37451723 AAGTAGAGCAAGAAGGGACTTGG - Intronic
1009739251 6:67723055-67723077 GAGAAGCGCAGGAGGGAACCGGG + Intergenic
1013390117 6:109678411-109678433 GAGTAGAGCAGAAAGGAAGTGGG + Intronic
1014384598 6:120785617-120785639 CTGTGGAGCAGGCGGGACCTGGG + Intergenic
1015143756 6:129963342-129963364 GAGAAGAGCAGGATGGATCTAGG - Intergenic
1015201141 6:130582745-130582767 CTGAGGAGCAGGAGGGAGCTAGG + Intergenic
1019180706 6:170186055-170186077 CAGGAGAGCAGGAAGGAAACGGG - Intergenic
1021794142 7:24236537-24236559 CAGTAAAGCAGCAGGCAACATGG - Intergenic
1021858792 7:24884872-24884894 CAGTCAAGGAGGAGGGACCTTGG - Intronic
1022512007 7:30942346-30942368 AAGTACAGCATGAGGGAATTGGG - Intronic
1028474306 7:91236812-91236834 CAGAAGAGCAGGACTGAAATGGG + Intergenic
1029706090 7:102276789-102276811 CAGTAGGGGAGGAGGGAATGGGG + Intronic
1029945233 7:104526001-104526023 AAGTAGAGAAGGAGGGAACAAGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1034368439 7:150572031-150572053 CAGTAACGGAGGAGGGCACTGGG + Intronic
1036162512 8:6402817-6402839 CAGTAGAGTGGGAGGAAAATTGG - Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1039803547 8:40980434-40980456 CAGGAGGGAAGGAAGGAACTAGG - Intergenic
1042611889 8:70608620-70608642 CAGGAGGGCAGGAGGGCACCCGG - Exonic
1042694897 8:71546050-71546072 CAGGTGAGCAGGAGAGACCTAGG - Intronic
1043373655 8:79622986-79623008 CAGGAGAGCAGGAGGGTGCCAGG - Intronic
1044558573 8:93590635-93590657 CATTAGAGTAGGTGAGAACTTGG - Intergenic
1044606619 8:94053631-94053653 CAGGAGAGCAGGAGTGAGCAGGG + Intergenic
1045747638 8:105441872-105441894 CAGTCAGGCAGAAGGGAACTTGG + Intronic
1049467515 8:142758646-142758668 CAGGAGTGCTGGAGGGAGCTGGG + Intergenic
1050292132 9:4165951-4165973 CAGGGGAGTAGGAGGGAGCTGGG + Intronic
1051587947 9:18746944-18746966 CAGTAAAGCAGCAGTGTACTTGG - Intronic
1053609468 9:39697466-39697488 CAGGAGAGCAGAAGGGAGCCAGG - Intergenic
1053867364 9:42454051-42454073 CAGGAGAGCAGAAGGGAGCCAGG - Intergenic
1054088847 9:60774026-60774048 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054244056 9:62644931-62644953 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054558181 9:66679479-66679501 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1056507978 9:87275406-87275428 CACTAGAGCAGGAGGGAGGCAGG + Intergenic
1056723233 9:89089412-89089434 GGGTGGAGCAGGAGGGAACTGGG + Intronic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1057895272 9:98904148-98904170 CAGTATAGCAGGAGAGAGATGGG + Intergenic
1058005031 9:99905761-99905783 CAGTAGAGTAGGAGGTAAACAGG - Intergenic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1062719027 9:138025228-138025250 CTGTGGAGCAGGAGGGAATGGGG - Intronic
1186553921 X:10536896-10536918 CAGTAGAGACTGAAGGAACTCGG - Intronic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187298340 X:18024498-18024520 AGGTAGAGCAGGAAGGATCTGGG + Intergenic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1189848676 X:45158240-45158262 CAGCACGGCAGGAGGGCACTGGG + Intronic
1191920873 X:66255687-66255709 TAGTTGAGCAAGAGGGAACCTGG + Intronic
1195929831 X:110063484-110063506 CGGTAGAGAAGGTGGGAACCTGG + Intronic
1196366966 X:114934206-114934228 CAGTAAAGGAGGGAGGAACTTGG + Intergenic
1198640334 X:138749217-138749239 AGGAAGAGCAGGAGGCAACTAGG + Intronic
1198887184 X:141352293-141352315 CAGTAGAGCAAGAGCAAAGTAGG - Intergenic
1199701587 X:150381513-150381535 GAGCAGATCAGGAGGGAAGTGGG - Intronic
1199767936 X:150954136-150954158 CAGGAGAGCAGGAGGGGAAGGGG - Intergenic