ID: 961809778

View in Genome Browser
Species Human (GRCh38)
Location 3:129515085-129515107
Sequence GAACCCAAGGTGCAGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961809778_961809780 -8 Left 961809778 3:129515085-129515107 CCATCTTTCTGCACCTTGGGTTC 0: 1
1: 1
2: 0
3: 25
4: 257
Right 961809780 3:129515100-129515122 TTGGGTTCCCCCTTTCCCACAGG 0: 1
1: 0
2: 1
3: 15
4: 148
961809778_961809785 3 Left 961809778 3:129515085-129515107 CCATCTTTCTGCACCTTGGGTTC 0: 1
1: 1
2: 0
3: 25
4: 257
Right 961809785 3:129515111-129515133 CTTTCCCACAGGTAGTTGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961809778 Original CRISPR GAACCCAAGGTGCAGAAAGA TGG (reversed) Intronic
900521685 1:3108638-3108660 GAAACCAAGGCACAGAGAGATGG + Intronic
901038816 1:6352045-6352067 GGACCCAAGGTGCCGAAGAAAGG - Intronic
902503044 1:16923109-16923131 GAACCCAAGATACAGGAAGAGGG + Intronic
902825130 1:18967913-18967935 GAACCCAAGGATCAGAAAATTGG - Intergenic
903447166 1:23429922-23429944 GATGCCAACCTGCAGAAAGAAGG + Exonic
904215167 1:28913722-28913744 GGACCCACAGTGCAGAAAGAAGG - Intronic
905114562 1:35626168-35626190 GACCCCAAAGAGCAGAAAAAGGG - Intronic
905675281 1:39820417-39820439 GAAGCAGATGTGCAGAAAGAGGG - Intergenic
905906525 1:41622076-41622098 GAACCCAAGGATCTGCAAGATGG - Intronic
907486669 1:54782665-54782687 GAAACTAAGGACCAGAAAGAGGG - Intronic
907579331 1:55557515-55557537 GAACCCTGGCTGCAGAAACAGGG - Intergenic
908458750 1:64329279-64329301 GAACCCAATATGCAGAAAACTGG + Intergenic
912430776 1:109627303-109627325 GAACCCGACGAGCAGTAAGAGGG + Exonic
914982918 1:152430976-152430998 GCACCCAAGGCCCAGAGAGATGG - Intergenic
915216934 1:154346606-154346628 GAGCCCAATCTGCAGAAAGTAGG - Exonic
915839577 1:159203568-159203590 AGACCTAAGGTGCAGAAGGATGG - Intronic
915884127 1:159704836-159704858 GAAAGCAGGGTGAAGAAAGAAGG + Intergenic
918165075 1:181937186-181937208 AAACTACAGGTGCAGAAAGATGG - Intergenic
918378926 1:183935602-183935624 GATTCCAAGGTACAGAAAGATGG - Intronic
920297009 1:204964405-204964427 GAAGCCAAGGGGCAAAAAGCAGG + Intronic
921189957 1:212700028-212700050 GACCCCGAGGTGCGGAGAGAGGG - Intergenic
923052055 1:230396015-230396037 GAAGCAAGGGAGCAGAAAGAGGG - Intronic
923228949 1:231965618-231965640 GAGCCCAAGGGGCAGAGAGGAGG - Intronic
924724736 1:246658924-246658946 GACTCCAAGGTGCAGGAAGAAGG - Intronic
1063795643 10:9511537-9511559 GAACCATAGGGGCAGAAAGGAGG + Intergenic
1064688761 10:17892390-17892412 GAAGCCCAGGAGCAGAAAAAGGG - Intronic
1068109733 10:52665727-52665749 GAAACCAAGGTGTAAAAATAAGG - Intergenic
1069029669 10:63582329-63582351 TATCACAAGGTGCAGAGAGAGGG - Intronic
1069351548 10:67532695-67532717 GATACCAAGGAGAAGAAAGATGG + Intronic
1069957733 10:72062036-72062058 TAACCCAAGGCGGAGAATGAAGG - Exonic
1073543024 10:104327819-104327841 GAGCCCAAGGTGCTGAGAGGTGG + Intronic
1074463249 10:113658172-113658194 CAACACAAGGTCCAGAAATAGGG - Intronic
1074805425 10:117046052-117046074 GAACACCAGGAGAAGAAAGAGGG + Intronic
1075442824 10:122493322-122493344 GAATCCCAGCTGCAGAAAGTCGG + Intronic
1077723116 11:4647006-4647028 GGATCCATGGTGCAGCAAGAAGG + Intronic
1078360567 11:10664567-10664589 GAACTCATGGGGCAGAAAGCAGG - Intronic
1078843539 11:15101383-15101405 AAAACCAAGGCTCAGAAAGAAGG - Intergenic
1080023901 11:27593876-27593898 GAAGCAAAGATCCAGAAAGATGG + Intergenic
1081469996 11:43360734-43360756 GTATCCAAAGTGCAAAAAGAAGG - Intronic
1081631796 11:44694354-44694376 GATCCCAAGATGCAGAAACCAGG + Intergenic
1083155315 11:60819258-60819280 AAACACCAGGTGGAGAAAGAAGG + Intergenic
1084190604 11:67497072-67497094 GAACCTGAGGCCCAGAAAGAAGG - Intronic
1084701676 11:70790321-70790343 CCACCCAGGGTGCATAAAGAGGG + Intronic
1084972705 11:72780528-72780550 CAACCCAGGGTGCAGAAAGCGGG + Intronic
1086024173 11:82270266-82270288 GGATCCAAGGTTCTGAAAGAGGG + Intergenic
1086914048 11:92507315-92507337 GAAACCAGGGTCCAGAAGGAGGG - Intronic
1089455603 11:118623797-118623819 CTACCCAAGGGGCAGATAGATGG + Intronic
1090692857 11:129202450-129202472 GAAGGCAATGTGCATAAAGAAGG + Intronic
1093047978 12:14472572-14472594 GAAGTCAAGGTGAAGAAAAATGG - Intronic
1093156588 12:15693324-15693346 GATACCAAGGTACAGACAGAGGG - Intronic
1094025927 12:25959245-25959267 GTACCCAAGGTGCGGAGAGAGGG - Intronic
1094113238 12:26883372-26883394 AAAGCCAAGGTACAGAGAGAAGG + Intergenic
1094312839 12:29104352-29104374 AAAACCAAGGAGTAGAAAGAGGG + Intergenic
1096123049 12:49101094-49101116 CAACCTCAGGTTCAGAAAGAAGG - Intronic
1098719413 12:73877323-73877345 GAAACCAAGTTGTAGAAGGAAGG + Intergenic
1100288500 12:93190584-93190606 GTACCTTAGGGGCAGAAAGAAGG - Intergenic
1102382719 12:112481347-112481369 GAATCAAAGATGCAGAGAGAAGG - Intronic
1104418649 12:128616655-128616677 GAACCGAGTTTGCAGAAAGATGG - Intronic
1106162485 13:27213730-27213752 TGACCCCAGGTGCTGAAAGAAGG - Intergenic
1107408806 13:40139696-40139718 GAAACCAAGGTGTAGAAAAAGGG + Intergenic
1107804842 13:44144047-44144069 GATCCAAAGGGGCAGAAAAAGGG - Intronic
1109080944 13:57900458-57900480 GTACCCACAGTTCAGAAAGATGG + Intergenic
1111647638 13:91050476-91050498 GAAAACAAGGTGGATAAAGAAGG + Intergenic
1112011995 13:95300906-95300928 GAACCCAGGCTGCCGAAAGGGGG - Intronic
1113399242 13:109976096-109976118 GGTCCCAAGAAGCAGAAAGAAGG + Intergenic
1113507670 13:110828279-110828301 GCACTCACGGTACAGAAAGAAGG - Intergenic
1113599656 13:111559662-111559684 AACCCCAAGGTGGAGGAAGAAGG - Intergenic
1114657152 14:24323026-24323048 GAAGCTCATGTGCAGAAAGAGGG + Exonic
1114852454 14:26397242-26397264 CAACCCAAGGTGAAGACACAAGG - Intergenic
1115320177 14:32071551-32071573 GAAGCCTAGTTGGAGAAAGAAGG + Intergenic
1117640639 14:57795388-57795410 GAACCTAATGTGCATAAGGAAGG + Intronic
1118475241 14:66110076-66110098 GAAACCAAGGTGGAGAATGACGG + Intergenic
1120188967 14:81422679-81422701 AAGCCCATGCTGCAGAAAGATGG - Intronic
1120529092 14:85610541-85610563 GAAGGCAAAGTGCAGAAATAGGG - Intronic
1121386587 14:93532652-93532674 GAAACCACGGTGCAGAAATGAGG - Intronic
1121652397 14:95568788-95568810 GAGGCCACGGTGCAGAAAGTTGG - Intergenic
1122128703 14:99592920-99592942 GGACAGAAGGTGCCGAAAGAGGG + Intronic
1124722121 15:32119485-32119507 GAAGCCAGGGTTCAGAGAGAGGG + Intronic
1125575629 15:40753786-40753808 GAAACCAAGATTCAAAAAGATGG - Intronic
1127671276 15:61197447-61197469 AAACCTGAGGTGCAGGAAGATGG - Intronic
1129366809 15:75060912-75060934 GAACCTGAGGCCCAGAAAGAAGG + Intronic
1129878674 15:78993466-78993488 GAAACCCAGGTGCAGGAACATGG + Intronic
1130176382 15:81575778-81575800 GAAACCAAATTACAGAAAGATGG - Intergenic
1130955421 15:88623925-88623947 TAACCCAGGGTGGAGGAAGAGGG - Intronic
1131976773 15:97954603-97954625 GCTCCCAAGGTTCAGAAAGATGG - Intergenic
1134748606 16:16607664-16607686 AAACACAAGCTGCAGAAATAAGG - Intergenic
1134996860 16:18745952-18745974 AAACACAAGCTGCAGAAATAAGG + Intergenic
1136545104 16:30950099-30950121 AAACCCCAGGTGCAGGAGGACGG + Intronic
1137702882 16:50509876-50509898 GGAACCAAAGGGCAGAAAGAGGG - Intergenic
1138445285 16:57059453-57059475 GAGCCCAGGCTGCAGAGAGAAGG - Exonic
1138526077 16:57608031-57608053 GAGACCAAGGTTCAGAAAGGTGG - Intergenic
1139560799 16:67740725-67740747 AAAACCAAGATGCAGAGAGATGG + Intronic
1140019638 16:71225666-71225688 GAACTTGAGGTTCAGAAAGAAGG + Intronic
1140654035 16:77121643-77121665 GAATCCAAAGTCCTGAAAGAGGG - Intergenic
1140866014 16:79062774-79062796 GAACCCAGAATGCACAAAGAAGG - Intronic
1140929805 16:79617028-79617050 GAGCCCCTGGTGCAGAATGATGG - Intergenic
1142540594 17:655708-655730 GAAGCCAATTTGCAGAAAGTGGG + Intronic
1142729699 17:1844819-1844841 GCACCCAAGGAGGAGAAACATGG + Intronic
1142731460 17:1861265-1861287 GAACCCGAGGTGCAGAAATGGGG - Intronic
1143119522 17:4598262-4598284 GAACCCAATCTGAAGACAGAGGG + Intronic
1146948792 17:36891696-36891718 GCACCCATGGTGGAGTAAGATGG + Intergenic
1147357178 17:39907219-39907241 GAAGCCAAGGCCCAGAAAGGGGG + Intronic
1147781749 17:42947911-42947933 GCACCAAGGGTGCAAAAAGATGG + Intergenic
1148147972 17:45377897-45377919 GACCCCAAGGTGGAAAAGGAGGG - Intergenic
1149301462 17:55308030-55308052 GGACGCAAGGAGCAGAAGGAAGG + Intronic
1152632183 17:81415217-81415239 AAACCCAGGGTCCAGGAAGATGG - Intronic
1153330023 18:3863918-3863940 GTACCCAAGTTGCCCAAAGATGG - Intronic
1153835232 18:8957912-8957934 CAACCCAAGCAGCAGAAAGTTGG - Intergenic
1157497844 18:48169207-48169229 GAACCCAGGATGCAAAAAGATGG - Intronic
1158271910 18:55725751-55725773 TAAACTAAGGTGGAGAAAGAGGG + Intergenic
1158368358 18:56767327-56767349 GAATTCAATGTACAGAAAGAAGG - Intronic
1158510447 18:58085555-58085577 GAACCCAAGCTTCAGAACGGAGG + Intronic
1161675707 19:5647365-5647387 GGACACAAGGTGCAGAGAGATGG + Intronic
1161849657 19:6731814-6731836 GCATCCAAGGGGCAGAAAGAAGG + Intronic
1162084956 19:8243018-8243040 GACCCCAAGGTGCAGATGGAAGG - Intronic
1162898154 19:13777839-13777861 GAAGCCAAGGTGCAGAAGTGAGG + Intronic
1163326586 19:16607436-16607458 GAACTCAGGGAGCAGACAGAGGG + Intronic
1163928879 19:20369778-20369800 GCTCCAAAGGTGCAGAAAAAGGG + Intergenic
1164048456 19:21563268-21563290 GAACCCTAGGTGGAGAAAACAGG + Intergenic
1164252516 19:23493535-23493557 GAGCTTAAGGTGCACAAAGAAGG - Intergenic
1164775561 19:30850876-30850898 AAACCCCAGGAGCAGACAGAGGG + Intergenic
1167041864 19:47027397-47027419 GGACCCAGGGGGCAGAGAGAGGG - Intronic
1167591332 19:50406045-50406067 CAACCCTGGGGGCAGAAAGACGG - Intronic
1167678638 19:50905934-50905956 GAGACCAAGGAGTAGAAAGAGGG - Intergenic
926049688 2:9736885-9736907 TTAGCCCAGGTGCAGAAAGAAGG - Intergenic
926466763 2:13200644-13200666 CAGACCAAGATGCAGAAAGAAGG + Intergenic
929088582 2:38192857-38192879 GAGCCCAAGGTGAGGAAATAAGG - Intergenic
930223582 2:48769373-48769395 AAACCCATGGTGAAGAAAAACGG + Intronic
932608244 2:73178261-73178283 GAACACAAGGCTCAGAAACAGGG - Intergenic
934519324 2:95010081-95010103 GAACCAGAGGTACAGAGAGATGG - Intergenic
934618698 2:95791208-95791230 GAACCCAAGGAGGAGAGGGAGGG + Intergenic
934642195 2:96033349-96033371 GAACCCAAGGAGGAGAGGGAGGG - Intronic
936721887 2:115261383-115261405 GAACGCATGGTGAAGAAATACGG + Intronic
937147395 2:119659530-119659552 GTACCCATGGGGCAGCAAGATGG - Intronic
937870379 2:126782014-126782036 GAGACCCAGGTGCAGAAGGAGGG - Intergenic
938223714 2:129597018-129597040 TAATCCAAGGTGAAAAAAGATGG + Intergenic
939056915 2:137376933-137376955 GAAGCCATGATGTAGAAAGAAGG + Intronic
939778612 2:146416459-146416481 GAACTGAAAGTACAGAAAGAGGG + Intergenic
944651564 2:201835594-201835616 CAAGCCAAGGTCCAGAACGATGG + Intronic
945854667 2:215054586-215054608 GCACCCAAGTTCCAGAAAGAAGG - Exonic
946491491 2:220153167-220153189 GAACCCCAGTTGCAGGCAGAGGG + Intergenic
948048084 2:234958669-234958691 GAAGTCAAGGAGGAGAAAGATGG + Intronic
948296252 2:236862810-236862832 GAAGCCAGGGTGAAGACAGATGG - Intergenic
948696285 2:239734647-239734669 GAGCCCAGGGTGCAGAGTGAAGG + Intergenic
949044976 2:241868288-241868310 GAGCCCAAGGAGCAGGAAGGCGG - Intergenic
1168949426 20:1786438-1786460 GAACCCAAAGCCCAGAGAGATGG - Intergenic
1169012456 20:2261809-2261831 GAAGCCAAGGTTTAGAGAGATGG + Intergenic
1169984932 20:11433699-11433721 CAACCAAAGGTGGAGAAAGGAGG + Intergenic
1170791601 20:19513339-19513361 GAACCCAAGGGGAAGACAGATGG - Intronic
1172361622 20:34316621-34316643 GAACCGTAGGAGCAGAGAGAAGG + Intergenic
1172890763 20:38262151-38262173 AAACATAAGGTCCAGAAAGAAGG + Intronic
1173341922 20:42160801-42160823 GAAGAGATGGTGCAGAAAGAGGG + Intronic
1173927957 20:46794657-46794679 GCACCCACGCTGCAGAAAAAGGG - Intergenic
1174002391 20:47384346-47384368 GAACTCAGGGTGCTGAAAGGAGG + Intergenic
1174283061 20:49453238-49453260 GATCCCACCTTGCAGAAAGAGGG + Intronic
1174683709 20:52433210-52433232 AAATTCAAGGTCCAGAAAGAAGG + Intergenic
1176261276 20:64182095-64182117 AAACCCAAGTAGCAGCAAGAAGG + Intronic
1178588818 21:33892322-33892344 CACCCCACGGTGCAAAAAGAAGG - Exonic
1179040367 21:37797140-37797162 GAACCCAGGGGGCAGAGAGGTGG - Intronic
1179965879 21:44805076-44805098 GAACCCAAGGTGAAGAAAGATGG - Intergenic
1181345383 22:22216366-22216388 GAACCCAGGGTGCATATGGATGG + Intergenic
1182758953 22:32706587-32706609 GAGACCAAGGTGTAGAAAAAGGG + Intronic
1183066249 22:35365125-35365147 GAAACCAAGGTCCAGCAAGTTGG - Intergenic
1184665572 22:45987209-45987231 GAGCCCAGGGAGCAGAAGGAGGG + Intergenic
1185292189 22:50032702-50032724 GAAGCCTTGGTGCAGACAGAGGG + Intronic
949197607 3:1331713-1331735 TCACCCAAGGAGCAGAATGATGG + Intronic
949221309 3:1637192-1637214 GAACCCAGGAAGCAGACAGAGGG + Intergenic
949590327 3:5487555-5487577 GAACCCAATGTGCAGAGAGTAGG + Intergenic
949898656 3:8791933-8791955 GAAGCCAAGGGGCAGAGTGAGGG - Intronic
951597218 3:24331379-24331401 GAAGCCAAGCTGGAGAAAGTAGG - Intronic
951952860 3:28220469-28220491 GAAGTCAAGGTGAAGAAAAATGG - Intergenic
954360043 3:50117084-50117106 GAGACCGAGCTGCAGAAAGACGG + Exonic
954678254 3:52327315-52327337 GAATCCAGGGAGGAGAAAGAGGG + Intronic
955412930 3:58667552-58667574 GGACCCAAGGTGCACTGAGAGGG + Intergenic
956612826 3:71141901-71141923 ATAGCCAAGGAGCAGAAAGAAGG + Intronic
956665804 3:71641079-71641101 GAAGCTAAGGCTCAGAAAGATGG + Intergenic
956769865 3:72516154-72516176 GAAGCCAACGTGGGGAAAGAAGG - Intergenic
957876636 3:86155270-86155292 GAATCCAAGAAGCAGAAACAGGG - Intergenic
960053012 3:113255325-113255347 GAACTCAGGGTCCAGTAAGAAGG - Intronic
960819829 3:121717421-121717443 GAATCCAAGGGGTAGAAAAAAGG + Intronic
960992489 3:123321082-123321104 GAGCCCAGGGTGCAGGAGGATGG - Intronic
961096463 3:124160694-124160716 GACACCAAGGAGGAGAAAGAAGG - Intronic
961679945 3:128592912-128592934 GAAACCAAGGTGCAGAACCCTGG + Intergenic
961809778 3:129515085-129515107 GAACCCAAGGTGCAGAAAGATGG - Intronic
961919120 3:130407650-130407672 GCACCTAAGGTGCAGAATGGAGG - Intronic
962799827 3:138880640-138880662 AAAACCAAAGTGCGGAAAGAAGG + Intergenic
963525005 3:146406301-146406323 GCTCCAAAGGTGCAGAAAAAAGG - Intronic
965644313 3:170864104-170864126 CAACCCAAAGTTGAGAAAGAGGG - Intergenic
966521868 3:180882157-180882179 CAGCCCAGGGTCCAGAAAGAAGG - Intronic
968313559 3:197703796-197703818 GAACGCGAGGTGCAGCAAAATGG + Intronic
968710823 4:2116011-2116033 AAAATCAAGGTGCAGAAAGCTGG - Intronic
969838035 4:9859438-9859460 GAAACTAAGGCCCAGAAAGATGG + Intronic
970269026 4:14323125-14323147 TTACCCAAAGTGGAGAAAGATGG + Intergenic
970748518 4:19329519-19329541 AAATCCAAGGTGAAAAAAGAAGG - Intergenic
971293225 4:25364162-25364184 CAACCCAATCTGCACAAAGAAGG - Intronic
976214020 4:82698660-82698682 GTGTCCAAGGAGCAGAAAGATGG - Intronic
978500592 4:109405404-109405426 GAAGCAAAGATGAAGAAAGAAGG - Intergenic
983504718 4:168540434-168540456 GAACCCTAAGGACAGAAAGAGGG - Intronic
983627447 4:169815852-169815874 TCACCCAAGGATCAGAAAGATGG - Intergenic
984654797 4:182306105-182306127 GCACCCAAGGAGAAGAAAGAGGG + Intronic
985088637 4:186341503-186341525 GAGCACAAGATGCAGAAAGGTGG + Intergenic
986723580 5:10577857-10577879 GACCCCACGGTGCAGCAAGCTGG - Intronic
986963168 5:13239872-13239894 GGAACCAAGGTGAAGAAAGATGG - Intergenic
987212707 5:15699600-15699622 AAACCCATAATGCAGAAAGAAGG + Intronic
988411174 5:30887802-30887824 GAAACCAAGATTCAGAAGGATGG + Intergenic
992267122 5:75030521-75030543 GAACCCCACGTTCAGAAAGAAGG + Exonic
994650983 5:102527959-102527981 GAAGCCAACATACAGAAAGAAGG + Intergenic
995245546 5:109931360-109931382 GAACCCAAAGTGCTAAGAGAAGG - Intergenic
996647618 5:125835404-125835426 GAACACAAAGTGCAGAGAGAAGG + Intergenic
997871097 5:137505696-137505718 GAACCCATAGTGCTGAAAAAAGG + Intronic
998159552 5:139805751-139805773 GAACTCAGGGAGCGGAAAGAAGG + Intronic
998637465 5:143971860-143971882 GAAACGCAGGTGGAGAAAGAGGG + Intergenic
999136583 5:149324327-149324349 GACCCCAGGGAGCAAAAAGATGG - Intronic
999196345 5:149784126-149784148 CAACCCAAGTAGAAGAAAGAAGG - Intronic
999252734 5:150192233-150192255 GAAACCAAGTTTCAGGAAGAAGG - Intronic
999631618 5:153577298-153577320 GATCCCAAGGCACAGAAAGCAGG + Intronic
1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG + Intergenic
1001208079 5:169782590-169782612 GACCCTAAGGCGTAGAAAGAAGG - Intronic
1001294710 5:170490816-170490838 GTGCTCAAGGTGCAGAGAGAAGG - Intronic
1002292098 5:178206936-178206958 GATACCAAGGACCAGAAAGAAGG - Intronic
1002831112 6:822145-822167 GAACCCAAGCTGAAGCCAGAGGG - Intergenic
1003965681 6:11250116-11250138 GAGCACAAGTTCCAGAAAGAGGG + Intronic
1006339038 6:33435954-33435976 GAAACCAAGGTACAGAAACTTGG - Intronic
1007325347 6:41055273-41055295 GGACCCAAGGCTCAGAAAAAGGG + Intronic
1008159746 6:48062575-48062597 GAAACCAAGGAGCAGAAACTAGG + Intronic
1010461828 6:76122294-76122316 GTACCCAGTCTGCAGAAAGAAGG - Intergenic
1011341296 6:86317554-86317576 GACCCCAAGGTTCAGAGATAAGG - Intergenic
1012681123 6:102182185-102182207 GAGTCCAAGGCACAGAAAGATGG - Intergenic
1012732730 6:102902352-102902374 GAAACCCAGGAGCAGAAAGGAGG + Intergenic
1014630616 6:123785201-123785223 CAAACCCAGATGCAGAAAGATGG - Intergenic
1014988492 6:128043578-128043600 AAACCAAAGGTTAAGAAAGATGG + Intronic
1016873113 6:148838272-148838294 GGACTCAAGGAGCAGAAGGAAGG + Intronic
1019786082 7:2978434-2978456 GAAGCAGAGGTGGAGAAAGAGGG + Intronic
1020474075 7:8574563-8574585 GAACCCCAGATGGAGAAGGAAGG + Intronic
1022051271 7:26675869-26675891 AAATCCCATGTGCAGAAAGAAGG + Intronic
1022173706 7:27853203-27853225 GGAGGGAAGGTGCAGAAAGAGGG - Intronic
1022506955 7:30913429-30913451 GAAGCCAAGGAGCAGAGAGGAGG + Intronic
1026551702 7:71374415-71374437 AAACACAAGGAGCAGAAAGGCGG - Intronic
1027350238 7:77304687-77304709 GACACCAAGTTGTAGAAAGAAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1030420278 7:109300240-109300262 GAAGCCCAGGTGCCTAAAGAAGG - Intergenic
1033707823 7:143905741-143905763 GAACCCACAGTGCAGGAAGAAGG + Intergenic
1035012503 7:155732046-155732068 CCTCCCCAGGTGCAGAAAGAAGG - Intronic
1035773082 8:2165198-2165220 CTACCCAGGGTGCAGAAAGCTGG - Intronic
1041396947 8:57401398-57401420 GAACTGAAGGGGCAGAAAGTGGG + Intergenic
1042700082 8:71602659-71602681 AAGCTCAAGGTGCTGAAAGAAGG + Intergenic
1043949299 8:86290440-86290462 GAAACTGATGTGCAGAAAGATGG + Intronic
1044407339 8:91843657-91843679 AAAATCAAGGTGAAGAAAGAAGG - Intergenic
1045320723 8:101080020-101080042 GAATCCAAGGTACAGAGAGGAGG + Intergenic
1045575564 8:103416167-103416189 GAACCTAAGGCATAGAAAGAAGG + Intronic
1046630942 8:116622581-116622603 GAAATGAAGATGCAGAAAGATGG - Intergenic
1048710500 8:137205001-137205023 GAACCTAAGGTTCTGAATGATGG - Intergenic
1050107335 9:2179021-2179043 GAACCCATTGTCCAGAAAAATGG - Intronic
1051410658 9:16786669-16786691 GAACCCCAACTGCAGAAAGGGGG + Intronic
1051888224 9:21916966-21916988 GAAGTCAAGGTGAAGAAAAAAGG + Intronic
1052375342 9:27712622-27712644 TATCTCATGGTGCAGAAAGACGG + Intergenic
1052506753 9:29364729-29364751 TAAGCCAGGGTGCAGAAACAGGG - Intergenic
1053023115 9:34709313-34709335 GAACCCAAGATGCAAGAAGGAGG - Exonic
1053210101 9:36220334-36220356 AAAGCCTTGGTGCAGAAAGATGG - Intronic
1055872129 9:80894078-80894100 GAAGGCAAGGTGTAGAATGAGGG + Intergenic
1056749893 9:89341131-89341153 AAACCCAATGTTCTGAAAGAAGG + Intronic
1057473827 9:95381966-95381988 GAAGCTCAGGTGGAGAAAGAGGG - Intergenic
1057565909 9:96166204-96166226 GAAACCAAGGTGCAGAGACATGG + Intergenic
1057725962 9:97568371-97568393 GAATCCAAGGTCCACAATGAGGG + Intronic
1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG + Intronic
1058226138 9:102366100-102366122 GAACACAGGGGACAGAAAGAGGG + Intergenic
1058975620 9:110123077-110123099 CAACCCAAGCTGCAAAAATAGGG - Intronic
1060234821 9:121855057-121855079 GAACCCAGGGTGCAGACGGGGGG + Intronic
1060261014 9:122073530-122073552 CAACCCAAGGTGGGGAAGGAAGG + Intronic
1060994460 9:127868211-127868233 GAAACCAAGGCCCAGAGAGAGGG + Intronic
1061221638 9:129255443-129255465 GAACCGAGTGAGCAGAAAGAGGG + Intergenic
1187048879 X:15676120-15676142 GAAACCAAGGAGCAGCAAGCTGG + Intergenic
1189372490 X:40439903-40439925 GAAACTATGGTGCAGAGAGATGG - Intergenic
1192210395 X:69124014-69124036 GATCCAGAGGGGCAGAAAGATGG + Intergenic
1192735055 X:73842909-73842931 GCACACAAGGGGCAGAGAGAGGG + Intergenic
1193741558 X:85223571-85223593 GAAGCCTAGGTCCAGAAAGTGGG + Intergenic
1195728606 X:107942348-107942370 AGACCCAATGGGCAGAAAGAGGG + Intergenic
1196271078 X:113711698-113711720 AAACACAAGGTGCAAAAAGGTGG - Intergenic
1196627906 X:117898904-117898926 GATCTTAAGGTGCAGAAAGAGGG + Exonic
1196816227 X:119667269-119667291 TAACCCAAGGTTCACACAGAAGG + Intronic
1198124506 X:133629292-133629314 GAAACCAAGGAGCAGAGAGGTGG - Intronic
1198496166 X:137195786-137195808 GAAACCAAGGATCAGAGAGAAGG - Intergenic
1199363938 X:146956505-146956527 AAACTCAAGGTGAAGCAAGATGG + Intergenic
1201936910 Y:19419666-19419688 GAAGTCAAGGTGCAGAAATAAGG - Intergenic