ID: 961816590

View in Genome Browser
Species Human (GRCh38)
Location 3:129553883-129553905
Sequence GTTACTGACATATTGTCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961816590 Original CRISPR GTTACTGACATATTGTCGCA TGG Intergenic
908652670 1:66353236-66353258 GTTACAAACATATTGTATCATGG + Intronic
909290873 1:73881669-73881691 GTTACTGACACCTTCTCCCAGGG + Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
1063692579 10:8301100-8301122 TGTACTGACATATTTTCTCATGG + Intergenic
1068844558 10:61657367-61657389 GTAACTGACCTAATGTCTCATGG - Intergenic
1070180168 10:74005711-74005733 GTTACTTACATAAAGTGGCATGG + Intronic
1075775910 10:124987599-124987621 GTTACTGACCTATTACCCCAGGG - Exonic
1079654175 11:22967710-22967732 GTTTCTTACATAATGTTGCATGG + Intergenic
1091036721 11:132240826-132240848 GTTACAGAAATATTGTGGCTGGG + Intronic
1095876593 12:47085563-47085585 CTTACTGAAATAATGTGGCAGGG + Intronic
1100025665 12:90124851-90124873 GTTACTGACTTATTGCCTCTTGG + Intergenic
1100804851 12:98272239-98272261 GTTATTGATACATTGTCACATGG - Intergenic
1116261997 14:42641999-42642021 TTTCCTGAAATATTGTCTCAGGG + Intergenic
1125379934 15:39077026-39077048 GTTACTGACATTTTGTTGTAGGG + Intergenic
1131791272 15:95968222-95968244 GTTACTAACAACTTGCCGCAGGG - Intergenic
1133425536 16:5685459-5685481 GATTTTGACATATTGTCCCAAGG + Intergenic
1153326669 18:3827454-3827476 GTTGCTGACTTAGTGTCCCATGG - Intronic
1156229919 18:35143358-35143380 ATTACCCACCTATTGTCGCATGG + Exonic
1157554106 18:48601626-48601648 CTTACTGACACATTGAAGCAGGG + Intronic
1163260398 19:16186059-16186081 GTCACTGGCCTAGTGTCGCAGGG - Intronic
931614749 2:64144415-64144437 GTCACTGACATACACTCGCAAGG + Exonic
947128836 2:226900429-226900451 GATACTGACATACAGTCACAGGG - Intronic
954874019 3:53789202-53789224 GATACCAACATATTTTCGCATGG + Intronic
961816590 3:129553883-129553905 GTTACTGACATATTGTCGCATGG + Intergenic
968459081 4:714872-714894 GTTACTGACATACTGACCCATGG - Intronic
980314520 4:131180209-131180231 GTCACTGACATATTTTCAGAAGG + Intergenic
990868908 5:60409718-60409740 CTTACTGACATATTGTCTTGAGG + Intronic
1000044381 5:157509687-157509709 GTTACTGACATTTTTTAGAAAGG + Intronic
1000742885 5:164992269-164992291 ATTATTGAAAGATTGTCGCATGG - Intergenic
1002837474 6:877140-877162 GGTACTGAGATAATGTCACAAGG - Intergenic
1003478200 6:6504856-6504878 GTTAGTCACATAATGTCACAAGG - Intergenic
1008130871 6:47719284-47719306 GATACTGACATACAGTCGCAGGG + Intronic
1015380989 6:132568781-132568803 TTTACTGACATCTCGTAGCAGGG + Intergenic
1031747824 7:125525765-125525787 TTTACAGACATATTGTCCCCTGG - Intergenic
1033715199 7:143994411-143994433 CTTTCTGACATAGTGTTGCATGG - Intergenic
1034671333 7:152861106-152861128 GTTAATGTCATATTGTTGCTAGG + Intergenic
1038372270 8:27006241-27006263 GTTACTCACATGTAGTCACAAGG + Intergenic
1039028453 8:33283846-33283868 ATTACTGACTTATTGTCTCATGG - Intergenic
1042508798 8:69590086-69590108 GTTACTTACCTATTTTCGTAAGG - Intronic
1050895263 9:10878890-10878912 GTAACTGACATATGGGCCCATGG - Intergenic
1051219855 9:14836852-14836874 GTTAGTGTGATATTGCCGCAGGG + Intronic
1052557953 9:30044111-30044133 GTAACTGACATATTGCTGCTGGG - Intergenic
1201858668 Y:18572024-18572046 GTTGTTAACATATTGTAGCAAGG + Intronic
1201874653 Y:18748357-18748379 GTTGTTAACATATTGTAGCAAGG - Intronic
1202167901 Y:22012397-22012419 GTTTCTGACATAATGTCAGAAGG + Intergenic
1202223460 Y:22573971-22573993 GTTTCTGACATAATGTCAGAAGG - Intergenic
1202319655 Y:23621689-23621711 GTTTCTGACATAATGTCAGAAGG + Intergenic
1202551113 Y:26048367-26048389 GTTTCTGACATAATGTCAGAAGG - Intergenic