ID: 961818237

View in Genome Browser
Species Human (GRCh38)
Location 3:129562096-129562118
Sequence GGGTACAAAGAGAAGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961818227_961818237 25 Left 961818227 3:129562048-129562070 CCCATCTGTAAAATGGGGAGGGC 0: 1
1: 2
2: 48
3: 265
4: 1115
Right 961818237 3:129562096-129562118 GGGTACAAAGAGAAGGTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 229
961818228_961818237 24 Left 961818228 3:129562049-129562071 CCATCTGTAAAATGGGGAGGGCA 0: 1
1: 2
2: 39
3: 243
4: 927
Right 961818237 3:129562096-129562118 GGGTACAAAGAGAAGGTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961818237 Original CRISPR GGGTACAAAGAGAAGGTGCC AGG Intronic
900101346 1:963415-963437 GGGCACAAGGCGAAGCTGCCTGG + Exonic
901127268 1:6938420-6938442 GGGAGCAAAGGGGAGGTGCCAGG + Intronic
901226676 1:7617098-7617120 GGGAGCCAAGAGAAGGAGCCAGG + Intronic
901847255 1:11991341-11991363 GGGCACACAGAGAAGGGGTCCGG + Intronic
903332374 1:22602683-22602705 GGGGACAAAGGGCAGGTGTCAGG - Exonic
903737117 1:25537138-25537160 AGGGACAAAGTGAAGGGGCCAGG - Intergenic
905407025 1:37740757-37740779 GGTTTCCAAGAGAAGATGCCAGG + Intronic
906036584 1:42754214-42754236 GGGTGCAGATAGGAGGTGCCAGG + Intronic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
906396809 1:45473248-45473270 AAGCACAAAAAGAAGGTGCCTGG - Intronic
907026554 1:51125817-51125839 GGTCCCAAAGAGGAGGTGCCAGG + Intronic
907868953 1:58425603-58425625 GGATGAAAAGAGAAGGAGCCAGG + Intronic
909802446 1:79828067-79828089 GGGTATAAAGGGAAAGTGTCTGG - Intergenic
910768803 1:90810052-90810074 AGGTTTAAAGAGAGGGTGCCTGG + Intergenic
916064808 1:161127787-161127809 GGGAACAAAGAGAAGTTGCAGGG - Intronic
917637461 1:176950925-176950947 GGCTACTAAGACAAGGTGCTTGG - Intronic
918097815 1:181349138-181349160 TGGGACAGAGAGAAGGTGCAGGG + Intergenic
920868491 1:209773226-209773248 GGGTGCAAAGAGAAGGATACTGG - Intronic
920945240 1:210522818-210522840 GGGTAGAAAGAGAGCGTGCCAGG - Intronic
922554395 1:226521866-226521888 GGGTATGAAGAGAAGGTGGTAGG - Intergenic
923269018 1:232338012-232338034 TGGTACAAAGATAGGGTGCTGGG - Intergenic
923374562 1:233347718-233347740 GGGGACTAAGAGAAGGTGGAGGG + Intronic
1062833947 10:624038-624060 GGGTGCAGAGAGAAGGAGCAGGG - Intronic
1062854318 10:772210-772232 AGCTGCAAAGGGAAGGTGCCTGG + Intergenic
1065933974 10:30504041-30504063 GGTTCCAAAGATAAGGTCCCAGG + Intergenic
1067292126 10:44950977-44950999 GGGAAGAAAGGGAAGGTGACTGG + Intergenic
1068808773 10:61231282-61231304 GGGTACAAAGAGAAAAGGTCTGG - Intergenic
1070582691 10:77734524-77734546 GTGTACAATGAAGAGGTGCCTGG - Intergenic
1070710203 10:78675738-78675760 GGCTAGCAAGAGAAGGTGCAAGG - Intergenic
1071924973 10:90395668-90395690 GGTTACAAAGAGAAGGTCTGAGG + Intergenic
1073033709 10:100548350-100548372 GGGCAGAGAGAGAAGGTGCTGGG - Exonic
1073467744 10:103704228-103704250 GGGCACTGAGAGAAGGAGCCAGG + Intronic
1074093142 10:110282577-110282599 GGGTACAAGGAGGAGGTAACAGG - Intronic
1077384985 11:2264688-2264710 GGCCACACAGAAAAGGTGCCAGG + Intergenic
1078329648 11:10409066-10409088 GGTTACACAGATAAGATGCCTGG - Intronic
1082178467 11:49089089-49089111 AGATACAAAGAGAATGTGCAGGG - Intergenic
1082961347 11:58921391-58921413 GGGCCCAAAGAGAAGGAGCCCGG + Intronic
1083237778 11:61362569-61362591 AGGTACAAAGGGAAGGCGGCAGG + Intronic
1084690255 11:70721082-70721104 GGGCACAGAGAGAAGGTGCCCGG - Intronic
1084892199 11:72242101-72242123 TGGGACATGGAGAAGGTGCCTGG - Intronic
1086686602 11:89740747-89740769 AGATACAAAGAGAATGTGCAGGG + Intergenic
1087129270 11:94654419-94654441 GGATACCAAGAGCAGGAGCCTGG - Intergenic
1088560651 11:111112455-111112477 GGGTAAAAAGAGAAGGTGGGTGG + Intergenic
1088803640 11:113330888-113330910 AGGTACCAGGAGAATGTGCCAGG + Intronic
1089085822 11:115816005-115816027 GGGCACAATGAGAAGGGGCTTGG - Intergenic
1089786281 11:120909559-120909581 GTGTACAAGGATGAGGTGCCAGG + Intronic
1090049791 11:123367952-123367974 GGGGAGAAAGAGGAGGAGCCAGG + Intergenic
1091440776 12:510609-510631 GGGTACAAAGAGGAGGGGGTTGG + Intronic
1091565529 12:1645524-1645546 GAGTAGAAAGTGAAAGTGCCTGG + Intronic
1091641995 12:2244393-2244415 AGGTCCTAAGGGAAGGTGCCAGG + Intronic
1092481239 12:8860965-8860987 GGGTATCAAGAGCAGGAGCCAGG - Intronic
1093053416 12:14531207-14531229 GAATACAAAGAGATGGTACCTGG - Intronic
1095293850 12:40506546-40506568 GGGTACATAGAAACGTTGCCAGG + Intronic
1096777213 12:53971686-53971708 GGATCCAAAGAGGAGCTGCCAGG - Intergenic
1097194132 12:57234572-57234594 GGGTTCAAACAGAAAGTGCCTGG - Exonic
1098044774 12:66389080-66389102 GGGAACAGAGAGAATGTGCAGGG + Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099774386 12:87105377-87105399 GGATACAAGGAGAAGATGGCAGG - Intergenic
1100814772 12:98375633-98375655 GGGGACAAAGAGACAGTGGCAGG + Intergenic
1101740438 12:107495724-107495746 AGGCACAATGAGAAGCTGCCAGG - Intronic
1102145062 12:110648912-110648934 GGGCACACAGAGGAGGGGCCTGG + Exonic
1102645241 12:114399597-114399619 AGTTACAAAGTGAAGGTGACGGG - Exonic
1103076413 12:117986331-117986353 GGGTACAGTGAGAAGATGGCTGG + Intergenic
1103538779 12:121651868-121651890 GGGTGCAAATAGAAGGTTTCAGG + Intronic
1104811051 12:131620695-131620717 TGGTCCAATGAGAATGTGCCCGG - Intergenic
1105559440 13:21476878-21476900 GGGTACTAAGAGAAGAGGCTGGG + Intergenic
1106242107 13:27920612-27920634 GGGAACAGAGAGAAGGCTCCTGG - Intronic
1106353816 13:28959642-28959664 AGGGAGAAAGAGGAGGTGCCAGG + Intronic
1107560224 13:41551481-41551503 GAGGACACAGAGAAGGAGCCAGG - Intergenic
1110184812 13:72660408-72660430 GTGTACAAATAGAGGGTGCTTGG + Intergenic
1112420662 13:99245127-99245149 AGCTAAAAAAAGAAGGTGCCTGG - Intronic
1112651416 13:101402890-101402912 GGGTGCAAAGAGAACCTGCTGGG - Intronic
1114441241 14:22750048-22750070 GGGAACAAAGGGAAGAGGCCAGG + Intergenic
1117354049 14:54906493-54906515 AGGTACAAAGAAAAGGTGGCCGG + Intergenic
1119768814 14:77207384-77207406 GGATAAAAATAGAAGCTGCCTGG + Intronic
1120561627 14:86001034-86001056 TGGTACAAAGAGCAAATGCCAGG + Intergenic
1123990253 15:25678084-25678106 AGGTCCCAAGAGAGGGTGCCTGG - Exonic
1123998394 15:25734471-25734493 GGCTACAGAGAGCAGGTGCTGGG - Intronic
1125772625 15:42180179-42180201 TGGTACACAGAGAAGGTGGCTGG + Intronic
1128259428 15:66222228-66222250 GGGTCCAAGGAGAAAGAGCCAGG - Intronic
1129253356 15:74320525-74320547 GGGTACAAACAGCAGCTGCCAGG + Intronic
1129619296 15:77129172-77129194 GGACACAAAGAGAAGGTGGCTGG + Intronic
1129851511 15:78796517-78796539 GGGTGCAAAGAGTGGGTGCAGGG - Intronic
1131570553 15:93531025-93531047 GAATTCAAAGAGAAGGTGCAAGG + Intergenic
1131772210 15:95750647-95750669 AGGGAGAGAGAGAAGGTGCCAGG + Intergenic
1132511275 16:342827-342849 TGGCACAAAGCAAAGGTGCCAGG + Intronic
1132551959 16:557207-557229 GGGTACACAGTGGGGGTGCCAGG - Intergenic
1132681862 16:1145743-1145765 GGCTCCTCAGAGAAGGTGCCAGG - Intergenic
1133291126 16:4721929-4721951 GTGTATAAAGAGACGGGGCCAGG - Intronic
1137764616 16:50968250-50968272 GGGTGCAGAGGGCAGGTGCCAGG + Intergenic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1141840599 16:86571859-86571881 GTGTACAAAAAGTACGTGCCCGG + Intergenic
1142486001 17:248047-248069 GGCCAGCAAGAGAAGGTGCCCGG - Intronic
1143738074 17:8927892-8927914 GGGTGCAGGGGGAAGGTGCCAGG - Intronic
1144031720 17:11329127-11329149 GGGAATAAAGAAAAGGTGGCAGG + Intronic
1144658758 17:17055082-17055104 GGGTAGGAAGTGAAGGGGCCAGG + Intronic
1146905206 17:36613594-36613616 GTGTACACTGAGAAGGGGCCAGG - Intergenic
1147559526 17:41500370-41500392 GAGCACAGAGAGAAGGGGCCAGG + Intergenic
1150962244 17:69926600-69926622 GAAAGCAAAGAGAAGGTGCCAGG - Intergenic
1151691996 17:75692253-75692275 GGCTCCAAAAGGAAGGTGCCAGG - Intronic
1152306971 17:79526801-79526823 GGGTATAACGGGAAGGTGCAAGG - Intergenic
1152492696 17:80648411-80648433 AGGGACAAGGAGAAGATGCCTGG - Intronic
1154058518 18:11035292-11035314 GGAGAGAGAGAGAAGGTGCCAGG - Intronic
1155200667 18:23514945-23514967 GGGTACATTGAAAATGTGCCTGG + Intronic
1155993134 18:32301707-32301729 GAGAACAAAGGGAAGGTCCCGGG - Intronic
1157320070 18:46627617-46627639 GGGTTGAAAGAGAATGTGGCTGG + Intronic
1157506650 18:48231158-48231180 GGGTAAAAAGTGCAGGTCCCTGG + Intronic
1157542056 18:48517806-48517828 GGATAGGAAGAGACGGTGCCTGG - Intergenic
1161848314 19:6725060-6725082 GGGGAAAATGAGAAGGGGCCAGG + Intronic
1162145019 19:8608260-8608282 GGGGTCAAAGAGGAGGAGCCGGG + Exonic
1163668077 19:18612392-18612414 GTGTCAAAAGAGAAGATGCCAGG + Intronic
1164705495 19:30316614-30316636 GGCTACAAAGACGAGGTACCAGG + Intronic
1167269168 19:48498364-48498386 GGGAACAGAGAGAAAGTCCCGGG - Exonic
1167513052 19:49906761-49906783 GAGTAAAAAGAGCAGGTTCCAGG - Intronic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
925663067 2:6223169-6223191 GGGGAAAAAGAGAAGGTGTATGG - Intergenic
926289515 2:11517314-11517336 CAGTCCAAAGAGCAGGTGCCTGG - Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
927020367 2:19010441-19010463 TGGTACAAAGAGATGCTGCAGGG - Intergenic
927514964 2:23666874-23666896 GGGCACAGAGAGAAGGGCCCTGG - Intronic
928448648 2:31356993-31357015 GGGATCAAAGAGAAGGTGTCAGG + Intronic
928478244 2:31653385-31653407 GGGTACAAAGAGAAGGATTTGGG - Intergenic
929852270 2:45603388-45603410 GGGGCTAAAGAGAAGCTGCCAGG - Intronic
930015620 2:46968521-46968543 GGGGACAAATACAAGGTTCCCGG + Intronic
931471866 2:62546183-62546205 GAGTAAGAAGAGATGGTGCCTGG + Intergenic
932455241 2:71845346-71845368 TGTTACGAAGGGAAGGTGCCAGG + Intergenic
932494195 2:72138419-72138441 GGGCACACTGGGAAGGTGCCGGG + Intronic
932575442 2:72960066-72960088 GGGTCCAAAGACAAGCAGCCAGG - Intronic
934150398 2:89142818-89142840 GGAGACAAAGACAGGGTGCCTGG + Intergenic
934750309 2:96789581-96789603 GGGTCCAGAAAGAAGGTTCCTGG - Intronic
935594529 2:104868593-104868615 GGGTGGATAGAGAAGGTGTCTGG - Intergenic
935681564 2:105642756-105642778 AGGTGCAAAGAGTAGGTGCAAGG + Intergenic
938061870 2:128261230-128261252 GGGGACAGTGAGAAGGTGCAAGG + Intronic
938304553 2:130243192-130243214 GGGAAAAAAGAGAATGTGCCTGG + Intergenic
940824282 2:158393171-158393193 GGGAACTGAGTGAAGGTGCCAGG + Intronic
941839967 2:170071442-170071464 GGGTCCAAAGAGTAGGGGCCAGG + Intronic
941880705 2:170477273-170477295 GCCTTCATAGAGAAGGTGCCTGG - Intronic
944203612 2:197134715-197134737 AGCTACAAAGAAAAGGTGCCTGG + Intronic
947739395 2:232478301-232478323 GGACACAGAGAGAAGGGGCCTGG + Intergenic
947750410 2:232529191-232529213 AGGCAGAGAGAGAAGGTGCCAGG + Intronic
949079390 2:242084747-242084769 GGGTACAAGGAGGAGGTGCCTGG - Intergenic
1169006194 20:2209123-2209145 GGGTAGTAGGAGAAGGTGGCAGG + Intergenic
1169925434 20:10779033-10779055 GGGAACAAAGACAATGTTCCTGG - Intergenic
1170317830 20:15061704-15061726 GGGTAAAAAGAGAAGGGGAAGGG + Intronic
1170966205 20:21073904-21073926 GGATAAGAAGGGAAGGTGCCAGG + Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1175644465 20:60659096-60659118 GTGGACAGAGAGAAGCTGCCTGG - Intergenic
1175922586 20:62457108-62457130 GGCTAGGAAGAGAATGTGCCGGG - Intergenic
1179088605 21:38242752-38242774 GGGAACACAGAGCAGGTGGCAGG - Intronic
1180161315 21:45999806-45999828 GTGGACAAAGAGCTGGTGCCAGG + Intronic
1181716938 22:24737862-24737884 GTGTAGAAAGAGAAGGGGGCCGG + Intronic
1181771453 22:25128681-25128703 GGGTGCAAAGAGATGGGGCTGGG - Intronic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1183543835 22:38445091-38445113 GGGCATAAAGAGAAGGTCCTAGG + Intronic
1184111604 22:42398774-42398796 GGGCACAAGGAGTAGGTGCCTGG + Intronic
1184869082 22:47222163-47222185 CGTTAAAGAGAGAAGGTGCCAGG - Intergenic
949945220 3:9184776-9184798 GGGTGCAAGGATAAGGAGCCAGG - Intronic
952431611 3:33229263-33229285 GGTTACATAGAGACTGTGCCTGG - Intergenic
954632051 3:52052958-52052980 GGGAACCAAAAGTAGGTGCCTGG - Intronic
956011186 3:64833314-64833336 GGGGACACAGAGAAGAGGCCAGG + Intergenic
956765143 3:72478531-72478553 GATGACACAGAGAAGGTGCCTGG + Intergenic
958835192 3:99137419-99137441 GTGTACAAAGAGAAGATTCTAGG + Intergenic
961785451 3:129344313-129344335 GGGTGCAAGGGTAAGGTGCCAGG - Intergenic
961818237 3:129562096-129562118 GGGTACAAAGAGAAGGTGCCAGG + Intronic
962820071 3:139039795-139039817 GGGAACAAAGAAAATGTGACAGG + Intronic
963507601 3:146206662-146206684 TGGTACAAAGGGAAGGTACTGGG + Exonic
963629565 3:147716174-147716196 TAGTACTAAGAGAAGGAGCCTGG + Intergenic
963900203 3:150726333-150726355 GGATACACAGAGAAGATGCTAGG + Intergenic
964682293 3:159355660-159355682 GGGTAAAGAGAGGAGGGGCCAGG - Intronic
965425381 3:168516454-168516476 GGAGAAAAAGAGAAGGAGCCAGG - Intergenic
966473681 3:180320663-180320685 ATTTACAAAGAGAAGGTGTCAGG - Intergenic
967390357 3:188948544-188948566 GGGTGAAAGGAGAAGGTTCCAGG + Intronic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968318275 3:197742720-197742742 GGGCACAGAGAGAAGAAGCCTGG + Intronic
968530739 4:1090134-1090156 GGGTACCAAGATAAGGTGACAGG + Intronic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
970766971 4:19561646-19561668 AACTACAAAGAGAAGGAGCCAGG + Intergenic
974988604 4:69059117-69059139 GGGCCCAAAGAGAAGCAGCCTGG - Intronic
975719425 4:77235562-77235584 AAGTACAAAGAGTAGGTGGCAGG + Intronic
976252852 4:83070995-83071017 TGGGACAAAGAGAAGATGGCTGG - Intronic
977531153 4:98201654-98201676 TGGTAAAAAGAGAAGGTTTCAGG - Intergenic
982754152 4:159198739-159198761 GGGTAAAAACAGAAGAGGCCAGG - Intronic
983082679 4:163406392-163406414 GGGCACAAAGAGAAAGAGCCTGG + Intergenic
983414887 4:167440396-167440418 GGGTACAAAGATAAGAGGTCAGG + Intergenic
984244966 4:177264033-177264055 GGTTCCAAAGAGAAAGGGCCAGG - Intergenic
986280633 5:6319276-6319298 CGGTATAAAGTGAAGGTTCCAGG + Intergenic
988211078 5:28204294-28204316 AAGTACAAAGAGAAGTTGGCCGG - Intergenic
989666546 5:43860434-43860456 GGATATACAGAGAAGGTACCTGG - Intergenic
990845656 5:60135555-60135577 GGGTAAAAAAAGAAGGTAGCTGG + Intronic
991403006 5:66273844-66273866 GGGTACAGAGAGAAGAGGCTAGG - Intergenic
994192388 5:96882831-96882853 GGGAAAAAAGAGAAGCTGTCAGG - Intronic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
997987315 5:138512828-138512850 GGGGACAAAGTGAATGTGGCTGG - Exonic
999325724 5:150642280-150642302 GGGCACAATGAAAAGCTGCCTGG - Intronic
1000292449 5:159883149-159883171 GGGGAAAAAGAGAAGGAGCAAGG - Intergenic
1000381270 5:160631742-160631764 GGATACATAGAGAAGGTGGGTGG + Intronic
1004535213 6:16493914-16493936 AGGAATAAAGAGAAGCTGCCAGG + Intronic
1005225162 6:23634185-23634207 GAGTACAAAGACAGGATGCCAGG + Intergenic
1005878225 6:30032034-30032056 GGGGACAAAGGGAAGGTGGCTGG + Intergenic
1007965590 6:46001228-46001250 GGGTACCAAGAGAAGGTCCTGGG + Intronic
1009710678 6:67314265-67314287 GGGTAGAAAAAGTAGGTGGCCGG - Intergenic
1011629496 6:89310488-89310510 GGGTAGAGAGAGAAGATGGCTGG - Intronic
1012491215 6:99784239-99784261 GGGAAAAAAGAGCAGGAGCCAGG + Intergenic
1013228081 6:108135195-108135217 GGGAACAAACAGCAGGTGCCCGG + Intronic
1014018743 6:116564796-116564818 GAATAGAAAGAGATGGTGCCTGG + Intergenic
1014751750 6:125264750-125264772 TGGTAAAAAAAGAAGGTGGCAGG - Intronic
1014918378 6:127182086-127182108 GGAGAGAGAGAGAAGGTGCCAGG + Intronic
1014964288 6:127727855-127727877 GGTTTCAAAGAAATGGTGCCAGG - Intronic
1016516380 6:144897085-144897107 GGATATAATGAGAAGGTGGCTGG - Intergenic
1017048558 6:150369817-150369839 GGGTACAAATAGCAAGTGCTGGG + Intronic
1017717675 6:157223711-157223733 GGGAACACAGAGAAGGTGGCTGG + Intergenic
1018193147 6:161328948-161328970 AGGTACAAAGAGAAAAAGCCTGG + Intergenic
1018729413 6:166637456-166637478 AGGAACAATGAGCAGGTGCCAGG + Intronic
1019630085 7:2044411-2044433 GAGGCCAAAGAGAAGCTGCCCGG + Intronic
1022883240 7:34612833-34612855 GGGTACAGACAGAAGTTGTCTGG - Intergenic
1023157140 7:37262563-37262585 GGGTACCAAGGGAAGGAGCAAGG - Intronic
1023369859 7:39502407-39502429 GAGGACAAAGAAAAGGTGGCAGG - Intergenic
1023820853 7:43979782-43979804 GGGAACCAAGACAAGGTGCAGGG + Intergenic
1024930231 7:54661191-54661213 GGGTACAAAGAGCAGGACCTGGG + Intergenic
1026613478 7:71881456-71881478 TGGGACAATGAGAAGGTGCCAGG - Intronic
1027163431 7:75818478-75818500 AGGTAAAAAGAGAAAGAGCCAGG + Intronic
1029749128 7:102533219-102533241 GGGAACCAAGACAAGGTGCAGGG + Intergenic
1029767071 7:102632323-102632345 GGGAACCAAGACAAGGTGCAGGG + Intronic
1030116067 7:106063180-106063202 GGGAACAAAGAGCAGGGGCGTGG + Intergenic
1030116588 7:106066229-106066251 GGGAACAAAGAGCAGGGGCGTGG + Intergenic
1030746261 7:113170313-113170335 GGGTAAACAGAGAAGTTGCATGG - Intergenic
1031369217 7:120944113-120944135 TGTTACAAAGAGAAGATGCTTGG + Intergenic
1031998781 7:128251031-128251053 GGGTATAAAGACATGGTGGCGGG - Intronic
1032311008 7:130787113-130787135 AGGGAGAGAGAGAAGGTGCCAGG - Intergenic
1032374188 7:131393266-131393288 GGGAACAAAGAACACGTGCCTGG + Intronic
1034046682 7:147936819-147936841 GGGCACAAAGAGACGGTAACAGG - Intronic
1034474841 7:151276228-151276250 GTGGAGACAGAGAAGGTGCCAGG + Intronic
1034507254 7:151502808-151502830 GGGGACAAAGTGAATGTGGCTGG + Intronic
1035537537 8:403835-403857 GGGTACAAGGAGGAGGTGCCTGG - Intergenic
1037815055 8:22107732-22107754 GGGCAGAATGAGAGGGTGCCTGG + Exonic
1037837672 8:22223873-22223895 GGGGCCAAAGGGAAGGTGGCAGG - Intronic
1038147523 8:24912953-24912975 GGGGACAAAGAGAACAGGCCGGG - Intergenic
1045460928 8:102425260-102425282 GGATAAAAAGGGAAGGTGGCTGG + Intergenic
1047289196 8:123514338-123514360 GGATAAAAATAGAAGTTGCCAGG + Intronic
1047944146 8:129858224-129858246 GAGGACAAAGAAAAGATGCCTGG + Intronic
1049235140 8:141508465-141508487 AGGGACACAGAGAAGGAGCCTGG - Intergenic
1051045425 9:12867390-12867412 AGGTACAAAGAGGAGCTGCTAGG - Intergenic
1052804380 9:32999982-33000004 GGTAACAAAGAGTAGGTGTCTGG + Intronic
1056442937 9:86638419-86638441 GGCCACAAAAAGAAAGTGCCTGG + Intergenic
1058984332 9:110197415-110197437 GGCCAGAAAGAGAAGGTGCAGGG + Intronic
1060185714 9:121562951-121562973 GGCTACAAGGGGAAGGTGGCCGG - Intergenic
1061962591 9:133995639-133995661 GGGTCCAAGGAGAGGGGGCCTGG - Intergenic
1062126000 9:134863464-134863486 TGGTGAGAAGAGAAGGTGCCAGG + Intergenic
1187365401 X:18662074-18662096 GGGCACAGCAAGAAGGTGCCAGG + Intronic
1187908816 X:24091587-24091609 GGGTACATAGACATGGTTCCTGG + Intergenic
1189364751 X:40379985-40380007 GGGGGCCCAGAGAAGGTGCCTGG - Intergenic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1190829565 X:54047822-54047844 GGGTTCTCAGAGAAGGTGACAGG + Intronic
1191254667 X:58274579-58274601 GGGTACAAAGACAGGAGGCCAGG - Intergenic
1196086558 X:111689750-111689772 GGGTAGAAAGAGCAGGGGACTGG - Intronic