ID: 961818870

View in Genome Browser
Species Human (GRCh38)
Location 3:129565138-129565160
Sequence CAAGCCAGCCAGGCTTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 292}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961818864_961818870 2 Left 961818864 3:129565113-129565135 CCAAGCATCCGTTGAGCCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818860_961818870 25 Left 961818860 3:129565090-129565112 CCTGACACAACCTCTGTTATGCC 0: 1
1: 0
2: 2
3: 9
4: 123
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818863_961818870 3 Left 961818863 3:129565112-129565134 CCCAAGCATCCGTTGAGCCCTTG 0: 1
1: 0
2: 1
3: 2
4: 76
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818858_961818870 27 Left 961818858 3:129565088-129565110 CCCCTGACACAACCTCTGTTATG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818865_961818870 -6 Left 961818865 3:129565121-129565143 CCGTTGAGCCCTTGCAGCAAGCC 0: 1
1: 0
2: 1
3: 16
4: 141
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818859_961818870 26 Left 961818859 3:129565089-129565111 CCCTGACACAACCTCTGTTATGC 0: 1
1: 0
2: 0
3: 11
4: 86
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818862_961818870 4 Left 961818862 3:129565111-129565133 CCCCAAGCATCCGTTGAGCCCTT 0: 1
1: 0
2: 1
3: 8
4: 97
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292
961818861_961818870 15 Left 961818861 3:129565100-129565122 CCTCTGTTATGCCCCAAGCATCC 0: 1
1: 0
2: 0
3: 16
4: 135
Right 961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG 0: 1
1: 0
2: 3
3: 39
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961818870 Original CRISPR CAAGCCAGCCAGGCTTCCCC GGG Intronic