ID: 961819723

View in Genome Browser
Species Human (GRCh38)
Location 3:129569807-129569829
Sequence TGCCCTCCAAGGTGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1075
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 1036}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961819717_961819723 13 Left 961819717 3:129569771-129569793 CCAATCTTCAGAGGGGCTGGGGC 0: 1
1: 0
2: 2
3: 16
4: 223
Right 961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG 0: 1
1: 0
2: 2
3: 36
4: 1036
961819712_961819723 20 Left 961819712 3:129569764-129569786 CCATCTGCCAATCTTCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 150
Right 961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG 0: 1
1: 0
2: 2
3: 36
4: 1036
961819708_961819723 27 Left 961819708 3:129569757-129569779 CCTTCTCCCATCTGCCAATCTTC 0: 1
1: 0
2: 5
3: 38
4: 481
Right 961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG 0: 1
1: 0
2: 2
3: 36
4: 1036
961819710_961819723 21 Left 961819710 3:129569763-129569785 CCCATCTGCCAATCTTCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG 0: 1
1: 0
2: 2
3: 36
4: 1036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961819723 Original CRISPR TGCCCTCCAAGGTGTCCTGA GGG Intronic
902664790 1:17929953-17929975 ACCCCTCCAGGGTGTCATGATGG - Intergenic
904278839 1:29404205-29404227 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
904369898 1:30041865-30041887 AGGCCCCCAAGGTGGCCTGATGG - Intergenic
905208779 1:36358947-36358969 GACCCTCCAAGGTCTCCTGGTGG + Intronic
906361560 1:45164295-45164317 TGCCCTACAAGAGCTCCTGAAGG + Intronic
906363222 1:45181906-45181928 TGCCCTACAAGAGCTCCTGAAGG + Intronic
906878613 1:49565470-49565492 TGCCCTAAAAGAGGTCCTGAAGG - Intronic
906893143 1:49739877-49739899 TGCCCTACAAGAGCTCCTGAAGG + Intronic
906903962 1:49867697-49867719 TGCCTTGCAAGAGGTCCTGAAGG + Intronic
906911604 1:49958026-49958048 TGCCCTACAAGAGCTCCTGAAGG - Intronic
907876266 1:58491239-58491261 TGCCCTACAAGAGCTCCTGAAGG + Intronic
907958315 1:59252773-59252795 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
908866079 1:68549701-68549723 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
909557340 1:76968747-76968769 TGCCTTACAAGATCTCCTGAAGG - Intronic
909668333 1:78160638-78160660 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
909672596 1:78205369-78205391 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
909841567 1:80333946-80333968 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
910111520 1:83688677-83688699 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
910204221 1:84731929-84731951 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
910314737 1:85869672-85869694 TGCCCTACAAGAGCTCCTGAAGG + Intronic
910353741 1:86330795-86330817 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
910379632 1:86612621-86612643 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
910398594 1:86815728-86815750 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
911270856 1:95799184-95799206 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
911632870 1:100201880-100201902 TGCCCTACAAGAGCTCCTGAAGG + Intronic
911851685 1:102828454-102828476 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
911938376 1:104010337-104010359 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
912235538 1:107846273-107846295 TGCCTTCCAAGAGCTCCTGAAGG + Intronic
912751272 1:112289949-112289971 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
913258504 1:116976698-116976720 TGCCCTACAAGAGCTCCTGAAGG + Intronic
913285190 1:117219574-117219596 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
913299550 1:117356730-117356752 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
913710613 1:121479062-121479084 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
913721629 1:121602357-121602379 TGCCCTACAAGAGCTCCTGAGGG - Intergenic
914376902 1:147079964-147079986 CGCCCTCCCAGGGCTCCTGAGGG + Intergenic
914458914 1:147863607-147863629 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
915258912 1:154660975-154660997 TGGCCTGGAAGGTTTCCTGAAGG - Intergenic
915757639 1:158278222-158278244 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
915862028 1:159454787-159454809 TGCCCTAAAAGATCTCCTGAAGG + Intergenic
915880676 1:159667839-159667861 TGCCCTGCAAAGTCTCCTGTGGG - Intergenic
916252046 1:162747975-162747997 TGCCCTACAAGAGCTCCTGAAGG + Intronic
916258081 1:162811115-162811137 TGCCCTACAAGAACTCCTGAAGG - Intronic
916311981 1:163407853-163407875 TCCCCACCAAGGTGTTCTGCTGG + Intergenic
916613376 1:166415460-166415482 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
917252016 1:173073268-173073290 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
917903735 1:179569708-179569730 TGCCTTACAAGGGCTCCTGAAGG - Intronic
918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG + Exonic
918501288 1:185199415-185199437 TCCCTTACAAGGGGTCCTGAAGG - Intronic
918697121 1:187558821-187558843 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
918802055 1:188985137-188985159 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
918832354 1:189414772-189414794 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
919060416 1:192624956-192624978 TGCCCTACAAGGGCTCCTGAAGG + Intergenic
919146568 1:193643560-193643582 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
919742425 1:200989005-200989027 AGCACTCCAAGGTGTCTTGAGGG - Intronic
920051200 1:203166092-203166114 TGCCCTCCCAGGCCTCCTGCAGG - Exonic
920625224 1:207590435-207590457 TGCCTTACAAGGGCTCCTGAAGG + Intronic
921043371 1:211455339-211455361 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
921174679 1:212583737-212583759 TGCCCTCCTCTGTGCCCTGAGGG - Intronic
921401184 1:214725844-214725866 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
922186584 1:223280061-223280083 TGCCCTACAAGAGCTCCTGAAGG + Intronic
922253211 1:223869323-223869345 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
922393328 1:225170094-225170116 TGCCCTACAAGAGCTCCTGAAGG + Intronic
924285628 1:242483033-242483055 TGCCCTACAAGAGCTCCTGAAGG + Intronic
924539541 1:244968721-244968743 TGCCCTCCTGGTTGTCCTGCAGG - Intergenic
924731556 1:246716160-246716182 TGCCCTACAAGAGCTCCTGAGGG + Intergenic
1062776401 10:152040-152062 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1062912950 10:1225578-1225600 TGCCCTACAAGAACTCCTGAAGG - Intronic
1064162922 10:12961066-12961088 TGGCCTCCGAGGTGTCGTCAGGG + Intronic
1064190023 10:13197706-13197728 TCACCTCCAGGATGTCCTGAGGG - Exonic
1064848241 10:19680803-19680825 TGCCTTCCAAGTGCTCCTGAAGG - Intronic
1066051633 10:31641983-31642005 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1066724522 10:38376795-38376817 TGCCCTACAAGAACTCCTGAAGG - Intergenic
1066983090 10:42437221-42437243 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1067006328 10:42667109-42667131 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1067066392 10:43106369-43106391 TGGCCACCACGGTGTCCTGCAGG - Exonic
1067172386 10:43918919-43918941 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1067212811 10:44275162-44275184 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1067845518 10:49716883-49716905 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1067959012 10:50826606-50826628 TGCCCTACAAGAACTCCTGAAGG + Intronic
1067996546 10:51280040-51280062 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1068181670 10:53527540-53527562 TGCCCTCCAAAGTCTCTTGTGGG - Intergenic
1069167504 10:65180810-65180832 TGCCTTACAAGGGGTCCTGAAGG - Intergenic
1070455501 10:76610472-76610494 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1071005874 10:80883421-80883443 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1071740622 10:88354382-88354404 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1071748209 10:88445293-88445315 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1071999010 10:91176077-91176099 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1072032214 10:91531606-91531628 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1072358752 10:94638515-94638537 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1072361223 10:94661729-94661751 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
1072364737 10:94697455-94697477 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1072901765 10:99413915-99413937 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1074526906 10:114270622-114270644 TGCCCTCCCAGGAGCCCTGGAGG + Intronic
1074704368 10:116118176-116118198 TACCCTCCATGGTGTCCAGTGGG + Intronic
1075215404 10:120528434-120528456 TGGCCACCAATGTGTCCTGTTGG - Intronic
1075810040 10:125218648-125218670 TGCACTCCAGCGTTTCCTGAGGG + Intergenic
1076665879 10:132091938-132091960 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1076838904 10:133035286-133035308 TGCCCTCCAAAGTCTCCTGTGGG + Intergenic
1077208070 11:1353543-1353565 TGCCCCCCAGGCTGTCCTGTGGG - Intergenic
1077450268 11:2638341-2638363 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1077545784 11:3169150-3169172 TGCCCTCCCTGCTGCCCTGAAGG + Intergenic
1077591683 11:3497120-3497142 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1077673051 11:4174412-4174434 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1077771092 11:5220147-5220169 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1077857726 11:6145484-6145506 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1077861735 11:6187185-6187207 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1078032416 11:7766112-7766134 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1078033892 11:7782306-7782328 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1078166578 11:8891215-8891237 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1078485120 11:11715457-11715479 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1078674596 11:13398709-13398731 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1079757518 11:24283230-24283252 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1079800556 11:24862373-24862395 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
1080081200 11:28220728-28220750 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1081405228 11:42689979-42690001 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1081632757 11:44700892-44700914 TGCCCTGCAAGAGGTCCTGCAGG + Intergenic
1082155272 11:48802602-48802624 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1082240665 11:49866872-49866894 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1082620138 11:55410385-55410407 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
1082629018 11:55519376-55519398 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
1082647772 11:55749356-55749378 TGCCCTAGAAGATCTCCTGAAGG + Intergenic
1082667139 11:55987851-55987873 TGCCCTAAAAGATCTCCTGAAGG + Intergenic
1083006104 11:59348339-59348361 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1083124668 11:60552322-60552344 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1083494602 11:63040455-63040477 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1084247519 11:67869836-67869858 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1084825308 11:71725660-71725682 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1085058249 11:73420886-73420908 TTACCTTCATGGTGTCCTGAGGG + Intronic
1085155862 11:74293613-74293635 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1085162627 11:74362368-74362390 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1085368666 11:75978035-75978057 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1085911133 11:80828154-80828176 AGCCTTCCTAAGTGTCCTGAGGG - Intergenic
1086078465 11:82878708-82878730 TGCCCTACAAGCGTTCCTGAAGG - Intronic
1086142667 11:83516691-83516713 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1086214861 11:84366288-84366310 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1086409316 11:86527830-86527852 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1086529027 11:87762556-87762578 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1086586792 11:88462011-88462033 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1087103369 11:94386173-94386195 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1087243601 11:95808192-95808214 TGCCTTACAAGATCTCCTGAAGG + Intronic
1087248956 11:95874761-95874783 TGCCCTACAAGCGCTCCTGAAGG - Intronic
1087653847 11:100900073-100900095 TGCCTTACAAGAGGTCCTGAAGG - Intronic
1087878748 11:103390664-103390686 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1087911393 11:103758074-103758096 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1087925519 11:103914227-103914249 TGCCCTAGAAGGTTTGCTGAGGG - Intronic
1088380877 11:109191528-109191550 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
1088790966 11:113225907-113225929 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1089172705 11:116526346-116526368 TGCCCTCCCAGGTGCCCAGGTGG + Intergenic
1089195711 11:116693004-116693026 TGCCCTCCCAGCTGGTCTGAGGG + Intergenic
1091246795 11:134103337-134103359 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1091424425 12:374740-374762 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1092274967 12:7053664-7053686 TGCCTTACAAGAGGTCCTGAAGG - Intronic
1092417800 12:8305229-8305251 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1092575688 12:9780577-9780599 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1092680579 12:10975399-10975421 TGCCTCACAAGGGGTCCTGAAGG + Intronic
1093265650 12:17000278-17000300 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1093484542 12:19639301-19639323 TGCCCTCCAAGGTGACTGGCAGG + Intronic
1093615068 12:21213231-21213253 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1093673138 12:21901279-21901301 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1093694545 12:22145298-22145320 TGCCCTACAAGAAGTGCTGAAGG + Intronic
1094093004 12:26671524-26671546 TGCCCTAAAAGAGGTCCTGAAGG + Intronic
1094127833 12:27042006-27042028 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1094387611 12:29911861-29911883 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1094602247 12:31919615-31919637 TGGCCTTCAAGGGGTCCTCAAGG + Intergenic
1094755605 12:33464691-33464713 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1094791322 12:33919067-33919089 TGCCTTACAAGATCTCCTGAAGG - Intergenic
1095779087 12:46038832-46038854 TGCCTTACAAGATCTCCTGAAGG + Intergenic
1096359833 12:50974464-50974486 TGCCCTACAAGAACTCCTGAAGG + Intergenic
1096926654 12:55155612-55155634 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1097344419 12:58475572-58475594 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1097375604 12:58839552-58839574 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1097561165 12:61208050-61208072 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1098053137 12:66474803-66474825 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1098800747 12:74954383-74954405 TGCCCAGCAAGGAGTCATGATGG + Intergenic
1099241843 12:80148220-80148242 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1099369714 12:81813928-81813950 TGCCCTGCAAGAGCTCCTGAAGG + Intergenic
1099720724 12:86358302-86358324 TGCCTTCCAAGAGGTCCTGAAGG + Intronic
1099878641 12:88438945-88438967 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1100282007 12:93127236-93127258 TTGCCTCCAAGCTGTCCTGCAGG + Intergenic
1100564012 12:95777136-95777158 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1100579731 12:95927705-95927727 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1100653140 12:96612363-96612385 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1101243097 12:102857799-102857821 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1101299817 12:103467538-103467560 TACCCTCCAGCGGGTCCTGAGGG - Intronic
1101768316 12:107724053-107724075 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1101961193 12:109251699-109251721 TGCACTCCTAGGTGTCCTTTTGG + Intronic
1102871297 12:116416293-116416315 TTCCCGCCAAGGTGACCTCAGGG + Intergenic
1103641376 12:122355243-122355265 TGCCCTCCAGGAGGCCCTGAAGG - Exonic
1103908709 12:124340286-124340308 TGCCCTACCAGGTCTCCAGATGG + Exonic
1104156135 12:126134731-126134753 TGCCTTACAAGGGGTCCTGAAGG - Intergenic
1105201559 13:18184153-18184175 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1105317042 13:19274824-19274846 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1105420207 13:20245222-20245244 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1105992797 13:25639081-25639103 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1106429081 13:29662406-29662428 TGCCCTGCAAAGTGTCTTGTGGG + Intergenic
1106608286 13:31252193-31252215 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
1107393324 13:39990213-39990235 TGCCCTACAAGAGATCCTGAAGG - Intergenic
1108113685 13:47104473-47104495 TGCCTTGCAAGATCTCCTGAAGG + Intergenic
1108308379 13:49161771-49161793 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1108607659 13:52055772-52055794 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1108628506 13:52256272-52256294 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1108657553 13:52550177-52550199 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1108757453 13:53521243-53521265 TGCCTTCCCTGGTGACCTGAAGG - Intergenic
1109216244 13:59592611-59592633 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1109312485 13:60711586-60711608 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1109669612 13:65587138-65587160 TGCCCTAGAAGAGGTCCTGAAGG + Intergenic
1109670470 13:65600289-65600311 TACCCTCCAAGAGCTCCTGAAGG - Intergenic
1109972175 13:69784159-69784181 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1110652695 13:77960512-77960534 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1110818725 13:79889029-79889051 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1110891425 13:80703357-80703379 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1110912955 13:80986291-80986313 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1111967209 13:94872738-94872760 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1112060857 13:95738990-95739012 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1112085309 13:96025010-96025032 GGCCCTCCAAGTTGTCCTGTGGG + Intronic
1113276743 13:108739303-108739325 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1113590906 13:111500290-111500312 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1114029946 14:18569216-18569238 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1114156168 14:20105619-20105641 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1114395086 14:22350873-22350895 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1114923300 14:27361707-27361729 TGCCCTACAAGACCTCCTGAAGG - Intergenic
1115968924 14:38923634-38923656 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1116009230 14:39331623-39331645 TGCCTTACAAGGGCTCCTGAAGG - Intronic
1116494944 14:45549897-45549919 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1116771255 14:49129937-49129959 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1116871920 14:50075815-50075837 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1117292463 14:54346957-54346979 TGCCCTCCAAGAGTTCTTGAGGG - Intergenic
1117664440 14:58041419-58041441 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1117797762 14:59411411-59411433 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1117808074 14:59515141-59515163 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1117852871 14:59993286-59993308 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1118146473 14:63143150-63143172 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1118415031 14:65526729-65526751 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1118498655 14:66334716-66334738 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1118521133 14:66586554-66586576 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1118958302 14:70503268-70503290 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1119079566 14:71679409-71679431 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1119699816 14:76746249-76746271 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1119853342 14:77881854-77881876 TATCTTCCAAGGTGACCTGACGG - Intronic
1120069863 14:80090490-80090512 TGCCCTCAAAGAGCTCCTGAAGG + Intergenic
1120259746 14:82167580-82167602 TGCTCTCCATAGTGTCCTTATGG + Intergenic
1120709583 14:87779620-87779642 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1121151992 14:91644377-91644399 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1122328082 14:100894688-100894710 TGCCCTCCCAGGTGGCGTGAAGG + Intergenic
1122839623 14:104450968-104450990 TGCCCACCACGGAGTCCAGAGGG + Intergenic
1202846462 14_GL000009v2_random:181998-182020 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
1202915926 14_GL000194v1_random:172600-172622 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
1123822553 15:24045149-24045171 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1123877432 15:24638101-24638123 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1123949571 15:25257580-25257602 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1124561442 15:30777220-30777242 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1124669094 15:31621931-31621953 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1125232065 15:37467746-37467768 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1125784508 15:42303330-42303352 TGCCTTGCAAGAGGTCCTGAAGG + Intronic
1126071396 15:44867768-44867790 TGCCTTACAAGATCTCCTGAAGG + Intergenic
1126118072 15:45227009-45227031 TGCCCTACAAGGTCTCCTGTGGG - Intergenic
1126235557 15:46379611-46379633 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1126646028 15:50875540-50875562 TGCCCTGCAAAGTGTCTTGTGGG - Intergenic
1126966160 15:54056935-54056957 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1126996284 15:54448941-54448963 TGCCCTGCAAGAGCTCCTGAAGG - Intronic
1127057330 15:55145136-55145158 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1127355540 15:58195371-58195393 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1130737327 15:86564297-86564319 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1130777919 15:87004859-87004881 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1130798235 15:87233937-87233959 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1132116177 15:99138039-99138061 TCCCCAGCAGGGTGTCCTGAGGG + Exonic
1132139549 15:99380700-99380722 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1132216897 15:100069718-100069740 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1132245013 15:100287836-100287858 TGCCTTACAAGATGTCCTTAAGG + Intronic
1133645858 16:7763943-7763965 TGCCCTGCAAAGTGTCTTGTGGG + Intergenic
1135059943 16:19262886-19262908 TAGCCTCCAAGGTGGGCTGAGGG + Intronic
1135924495 16:26680694-26680716 TGATCTACAATGTGTCCTGAGGG - Intergenic
1136675787 16:31904952-31904974 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1137461325 16:48666814-48666836 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
1137503601 16:49030659-49030681 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1137525293 16:49230046-49230068 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1137808721 16:51331767-51331789 TGCCCTACAAAGGCTCCTGAAGG + Intergenic
1137907245 16:52335368-52335390 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1138264740 16:55652379-55652401 TGCCCAGCCAGGTGGCCTGAGGG - Intergenic
1140932825 16:79643533-79643555 TGGCCTCCAAGGAATCCTGCTGG + Intergenic
1141228435 16:82141083-82141105 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1141234973 16:82207928-82207950 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1142538514 17:638582-638604 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1142756254 17:2018183-2018205 TTCCCTCCAGGGTGACCTGATGG - Intronic
1144012753 17:11165205-11165227 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1144448756 17:15356621-15356643 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1144760038 17:17701923-17701945 TGCCCTCCAAGGACTCCAGTCGG + Intronic
1146417095 17:32645079-32645101 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1146463080 17:33063328-33063350 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1146580404 17:34032337-34032359 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1146732145 17:35202977-35202999 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1146752686 17:35395769-35395791 TGCCCTACAAGGGCTCCTGAAGG + Intergenic
1147047992 17:37769013-37769035 TGCCCTTCAAGGTTTCCTTAAGG + Intergenic
1147556390 17:41481857-41481879 TGCCCTCCTAGATGTCATCATGG - Intergenic
1149262894 17:54898898-54898920 TGCCCTCCAGGGTGTTGTGGTGG - Intergenic
1149409665 17:56392422-56392444 TGCCCTCTAAGGGGACCTGTGGG - Intronic
1150442435 17:65202386-65202408 AGCCTTCTTAGGTGTCCTGAGGG + Intronic
1150782264 17:68133650-68133672 TCCCGTGCAAGGTGTGCTGAGGG + Intergenic
1151145252 17:72034532-72034554 TGCCTTCTAAGGTTTCATGAGGG - Intergenic
1151205790 17:72505724-72505746 TGCCCTGCAAAGTGTCTTCATGG - Intergenic
1151714370 17:75823866-75823888 TGCCTTCCCAGGTCTCCTGCTGG + Intronic
1151869407 17:76826312-76826334 TGCCCTCCACGGTGCCTTGAGGG - Intergenic
1154397505 18:14004976-14004998 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1154403644 18:14066946-14066968 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1154414109 18:14164621-14164643 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1156002174 18:32397127-32397149 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1156143119 18:34140846-34140868 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1156186469 18:34669593-34669615 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1156806624 18:41190693-41190715 TAGCCTCCAAGGTGTCAAGAGGG - Intergenic
1157919950 18:51704781-51704803 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1159231884 18:65618971-65618993 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1159629971 18:70737809-70737831 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1159944175 18:74431405-74431427 TGCTCTTCAAAGTGTCCTGTAGG + Intergenic
1159984271 18:74823186-74823208 TGCCTTACAAGAGGTCCTGAAGG + Intronic
1160036308 18:75304796-75304818 TGTCCTGCCAGGTGTCGTGAGGG + Intergenic
1160285208 18:77536313-77536335 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1160324991 18:77937837-77937859 GGCCCTCAAAGTTGTCCTGAAGG + Intergenic
1162245832 19:9399618-9399640 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1162938360 19:13993415-13993437 TGCCCCCCAAGGTTTCTGGATGG - Intronic
1164265786 19:23615366-23615388 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1164568548 19:29350311-29350333 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1164729079 19:30488296-30488318 GGCCCTCTAAGGTGTTCTGCAGG + Intronic
1165003569 19:32786096-32786118 TGCCTTCCAAGAGCTCCTGAAGG - Intronic
1165055839 19:33175915-33175937 TGCCCTGTAAGGTGACCTGTGGG + Intergenic
1165254389 19:34566379-34566401 TGCCTTACAAGATCTCCTGAAGG - Intergenic
1165262030 19:34627083-34627105 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1165270632 19:34704548-34704570 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1165288017 19:34859314-34859336 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1166048457 19:40243450-40243472 TCCCCTCCAGGGAGTCCTGCGGG - Intronic
1167774737 19:51547414-51547436 TACCCTCCCAGGTGTCCTGGGGG - Intergenic
1168323881 19:55528156-55528178 TGTCCTGCAGGGGGTCCTGATGG - Intergenic
1168420433 19:56198735-56198757 AGCCCTCCAATTTGTCCTAAAGG - Intergenic
1168424646 19:56229233-56229255 AGCCCTCCAATTTGTCCTAAAGG - Intronic
1168710746 19:58498676-58498698 TGACCTCCATGGCGTCCTGCAGG + Exonic
924967948 2:95285-95307 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
925672983 2:6331672-6331694 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
926454087 2:13042258-13042280 TGCCTTGCAAGATCTCCTGAAGG + Intergenic
926925882 2:17987290-17987312 TGCCCTACAAGAGCTCCTGAAGG - Intronic
927188044 2:20496648-20496670 TGAGCTTCATGGTGTCCTGAGGG - Intergenic
927827884 2:26322029-26322051 TGGCCTCCAAGGTGTAGTGCTGG - Intronic
928802425 2:35111019-35111041 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
928881256 2:36098973-36098995 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
928881901 2:36106281-36106303 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
930448031 2:51499494-51499516 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
930473989 2:51855277-51855299 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
930517108 2:52421673-52421695 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
930803231 2:55464118-55464140 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
931211884 2:60205490-60205512 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
931317337 2:61144940-61144962 TGCTCTCCTAGGAGACCTGAAGG - Intergenic
931475633 2:62585017-62585039 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
931822563 2:65967235-65967257 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
932520408 2:72405677-72405699 TGCCCTACAAGAGCTCCTGAAGG + Intronic
932660342 2:73646371-73646393 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
933130437 2:78666047-78666069 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
933202612 2:79467853-79467875 TGCCCTACAAGAGCTCCTGAAGG + Intronic
933404582 2:81841890-81841912 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
933729186 2:85444557-85444579 TGCCCTCCTAAGTGTCCTCTGGG + Intergenic
935369168 2:102326327-102326349 TGCCCTACAAGAGCTCCTGAAGG + Intronic
936171720 2:110182618-110182640 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
936407527 2:112220316-112220338 TGCCTTACAAGAGGTCCTGAAGG - Intronic
936908532 2:117566059-117566081 TGCCTTACAAGATGTCCTAAAGG + Intergenic
936971100 2:118177098-118177120 TCCCCTCCCTGCTGTCCTGATGG + Intergenic
937225504 2:120366537-120366559 TGCCCTCCAGGGTGACATGTGGG + Intergenic
937562907 2:123246706-123246728 TGCCTTACAAGGGCTCCTGAAGG + Intergenic
938147727 2:128850915-128850937 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
938156672 2:128947471-128947493 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
938651353 2:133387212-133387234 TGCCCTACAAGAGCTCCTGAAGG - Intronic
939019751 2:136945055-136945077 TGCCCTACAAGAGCTCCTGAAGG - Intronic
939109906 2:137993995-137994017 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
940125016 2:150312671-150312693 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
940437501 2:153671526-153671548 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
940528060 2:154843103-154843125 TGCCCTACAAGAGCTCCTGAAGG - Intronic
940593800 2:155765277-155765299 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
940694971 2:156966502-156966524 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
941895636 2:170626714-170626736 TGCCCTACAAGAGCTCCTGAAGG - Intronic
941971272 2:171354125-171354147 TGCCCTACAAGAGCTCCTGAAGG - Intronic
942270573 2:174270271-174270293 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
942381163 2:175392495-175392517 TGCCTTCCAAGGTGTACAGGAGG + Intergenic
942411929 2:175718540-175718562 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
942956452 2:181779808-181779830 TGCCCTCCAAGGTCACTTCATGG + Intergenic
943125991 2:183793389-183793411 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
943140662 2:183977396-183977418 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
943310145 2:186314735-186314757 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
943681805 2:190776415-190776437 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
943837034 2:192526451-192526473 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
943946525 2:194072623-194072645 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
944169226 2:196756791-196756813 TGCCCTACAAGAGCTCCTGAAGG - Intronic
944196971 2:197064276-197064298 TGCCCTACAAGAGCTCCTGAAGG + Intronic
944307897 2:198198205-198198227 TGCCCTACAAGAGCTCCTGAAGG + Intronic
944788993 2:203104713-203104735 TGCCTTACAAGATATCCTGAAGG - Intronic
944918289 2:204383930-204383952 TGCCTTGCAAGGGGTCCTGAAGG - Intergenic
945652702 2:212584559-212584581 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
945742570 2:213681181-213681203 TGCCCTGCAAAGTATCCTGTGGG - Intronic
945873711 2:215254930-215254952 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
945998133 2:216456669-216456691 TGCCCTACAAGGGCTCCTGAAGG + Intronic
946786029 2:223245683-223245705 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
947242048 2:228005716-228005738 TGCCCTACAAGAGCTCCTGAAGG - Intronic
947244624 2:228032852-228032874 TGCCCTACAAGAGCTCCTGAAGG + Intronic
947263780 2:228253729-228253751 TCCCCTGCCAGGTGTCCTTATGG + Intergenic
947770790 2:232668555-232668577 TGCCCACCCAGGTGACCTCAGGG - Intronic
948342938 2:237269830-237269852 TGCCTGCAAACGTGTCCTGAGGG + Intergenic
1169133514 20:3181271-3181293 TACCCACCAAGTTGTCCAGAAGG + Intergenic
1170495232 20:16917089-16917111 AGTGCTCCAAGGTGTCCTGGGGG + Intergenic
1170497464 20:16940054-16940076 TGCCCTCCAAGGTGCCCATGTGG + Intergenic
1170689107 20:18596111-18596133 TACCCTCCAGTGTGTCCTGAAGG + Exonic
1171434272 20:25107215-25107237 TGCCTTACAAGGGCTCCTGAAGG + Intergenic
1171513937 20:25712680-25712702 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
1171958929 20:31479768-31479790 TACACTCCAAGTGGTCCTGATGG - Intronic
1172848654 20:37944976-37944998 GGCCCTCAAAGGGGTCCTGCTGG - Exonic
1173272240 20:41547868-41547890 TGCCATCCATGATGTCATGAGGG - Intronic
1174385739 20:50187693-50187715 TGCCGACCCAGGTGTCCTGCAGG - Intergenic
1176451185 21:6862797-6862819 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1176635280 21:9187247-9187269 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
1176716393 21:10353844-10353866 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1176829354 21:13727848-13727870 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1176858921 21:13993628-13993650 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
1176942156 21:14938012-14938034 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1177025618 21:15918747-15918769 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1177181784 21:17752241-17752263 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
1177956388 21:27604579-27604601 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
1178345000 21:31818394-31818416 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1178586358 21:33874440-33874462 TGCCCTCCAAGGGCACCTGTTGG + Intronic
1178903751 21:36618486-36618508 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1178965316 21:37111029-37111051 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1179882218 21:44297649-44297671 TGCCATCGAAGGTGTGCTGCGGG - Exonic
1180042811 21:45288543-45288565 GGCCCTCCAAGGAGCCCTGGAGG + Intergenic
1180454063 22:15496266-15496288 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1180596429 22:16976996-16977018 TGCCTTACAAGATCTCCTGAAGG + Intronic
1180601945 22:17026101-17026123 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1181162506 22:20966773-20966795 GGCCCTGCAAGGTGCCCTGGGGG - Intronic
1181603180 22:23964361-23964383 GGCCCTCCCAGCTGTCCTGAAGG + Intergenic
1181605334 22:23976946-23976968 GGCCCTCCCAGCTGTCCTGAAGG - Intronic
1181795220 22:25303210-25303232 TGCCCTCCAATGTGTGCTGTGGG + Intergenic
1181835761 22:25606730-25606752 TGCCCTCCAATGTGTGCTGTAGG + Intronic
1182789995 22:32943421-32943443 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1182924586 22:34110385-34110407 TGTCCTCCAGAGTGTCCAGAAGG - Intergenic
1182989098 22:34749788-34749810 TGCCCTACAAGAACTCCTGAAGG - Intergenic
1184017312 22:41795779-41795801 GGCCCTCCAAGGAGGCCTGCAGG - Exonic
1184456999 22:44616515-44616537 TGATCTCTAAGGTGTCCTGGTGG - Intergenic
1184690276 22:46114320-46114342 TGCCCTGGAAACTGTCCTGAGGG - Intergenic
1184886575 22:47349717-47349739 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
949173674 3:1033297-1033319 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
949225035 3:1683620-1683642 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
949245075 3:1917648-1917670 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
949533161 3:4977320-4977342 AGCTCTCCAAGGCGACCTGAAGG + Intergenic
949816712 3:8066786-8066808 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
950995589 3:17493099-17493121 TGCCTTGCAAGATCTCCTGAAGG - Intronic
951439749 3:22708872-22708894 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
951584948 3:24205475-24205497 TGCCCTACAAGAGCTCCTGAAGG + Intronic
951672756 3:25203598-25203620 TGCCCTACAAGAGCTCCTGAAGG - Intronic
951684672 3:25330489-25330511 TGCCCTACAAGAGCTCCTGAAGG + Intronic
951949332 3:28182058-28182080 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
952049064 3:29361214-29361236 TGCCCTACAAGAGCTCCTGAAGG - Intronic
952118584 3:30214547-30214569 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
952290730 3:32012417-32012439 TGCCCTACAAGAGCTCCTGAAGG + Intronic
952319671 3:32264428-32264450 TGCCCTACAAGAGCTCCTGAAGG + Intronic
952583762 3:34866347-34866369 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
952667240 3:35922007-35922029 TTGCCTACAAGGTCTCCTGATGG + Intergenic
953145805 3:40273319-40273341 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
953305636 3:41826134-41826156 TGCCCTACAAGAGCTCCTGAAGG + Intronic
953516135 3:43593584-43593606 TGCCCTAAAAGGGCTCCTGAAGG + Intronic
953854737 3:46492580-46492602 TGACTTCCCAGCTGTCCTGAGGG - Intergenic
954500604 3:51010786-51010808 TGCCCTACAAGAGCTCCTGATGG - Intronic
954507945 3:51095326-51095348 TGCCTTACAAGGGCTCCTGAAGG - Intronic
954807241 3:53227648-53227670 TGCCCTCAGAGCTCTCCTGAGGG - Intronic
955156947 3:56426274-56426296 GGCCTTCCAAAGTGTCCTGATGG - Intronic
955174893 3:56604443-56604465 TGCCTTACAAGAGGTCCTGAAGG - Intronic
955282612 3:57608212-57608234 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
955386934 3:58487757-58487779 TGCCCTCAGAGCTGTCGTGAGGG + Intergenic
955405086 3:58620839-58620861 TGCTCTCCAAGGCCTCCTAATGG - Intronic
955642781 3:61104233-61104255 TGCCTTACAAGATCTCCTGAAGG - Intronic
955670365 3:61395228-61395250 TGCCCTAAAAGGGCTCCTGAAGG + Intergenic
956086258 3:65614225-65614247 GGCCCTGAAAGGTGGCCTGAAGG + Intronic
956215558 3:66844758-66844780 TGCCCTACAAGACCTCCTGAAGG + Intergenic
956243620 3:67156252-67156274 TACCCTACAAGAGGTCCTGAAGG + Intergenic
956265868 3:67394997-67395019 TGCCCTAAAAGATCTCCTGAAGG + Intronic
956569638 3:70679840-70679862 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
956795417 3:72714504-72714526 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
957061719 3:75487612-75487634 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
957102766 3:75849162-75849184 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
957287413 3:78234677-78234699 TGACCTTCAAGGTGTCCACATGG - Intergenic
957352968 3:79049870-79049892 TGCCCTACAAGAGCTCCTGAAGG + Intronic
957458106 3:80480021-80480043 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
957860457 3:85942241-85942263 TGCCCTACAAGAGCTCCTGAAGG + Intronic
957871491 3:86094921-86094943 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
957948641 3:87096411-87096433 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
957967831 3:87344692-87344714 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
957972657 3:87403134-87403156 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
958166447 3:89883617-89883639 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
958503537 3:94945056-94945078 TGCCCTCCAAAAGTTCCTGAAGG - Intergenic
958624335 3:96605506-96605528 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
958650301 3:96929399-96929421 TGCCTTGCAAGGGCTCCTGAAGG - Intronic
958654439 3:96983219-96983241 TGCCCTACAAGAGCTCCTGAAGG - Intronic
959076191 3:101752059-101752081 TGCCCTAAAAGAGGTCCTGAAGG - Intronic
959218357 3:103482340-103482362 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
959423011 3:106150974-106150996 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
959723775 3:109521614-109521636 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
959953904 3:112213181-112213203 TGCCCTACAAGAGCTCCTGAAGG + Intronic
959955879 3:112237623-112237645 TGCCCTACAAGAGCTCCTGAAGG - Intronic
960681438 3:120251316-120251338 TGCCCTGCAAGCACTCCTGAAGG + Intronic
961291688 3:125851788-125851810 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
961310794 3:125998522-125998544 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG + Intronic
961895497 3:130164605-130164627 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
961977729 3:131044073-131044095 TGCCTTACAAGAGGTCCTGAAGG + Intronic
962200399 3:133396587-133396609 TGTCCTCCATGGATTCCTGAGGG - Exonic
962424300 3:135256385-135256407 TGCCCTACAAGAGCTCCTGAAGG - Intronic
962439707 3:135401947-135401969 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
962548777 3:136466978-136467000 TGCCCTACAAGAGCTCCTGAAGG + Intronic
962553901 3:136526759-136526781 TGCCCTACAAGAGCTCCTGAAGG - Intronic
962691039 3:137898567-137898589 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
962699400 3:137981804-137981826 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
962931962 3:140046680-140046702 TGCCCTACAAGAGCTCCTGAAGG - Intronic
963281918 3:143392425-143392447 TGCCCTACAAGAGCTCCTGAAGG + Intronic
963387754 3:144618785-144618807 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
964175805 3:153825251-153825273 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
964500405 3:157342000-157342022 TGCCCTACAAGAGCTCCTGAAGG + Intronic
964587938 3:158328399-158328421 TGCCCTACAAGAGCTCCTGAAGG - Intronic
964842935 3:161014189-161014211 TGCCCTACAAGAGCTCCTGAAGG - Intronic
964845985 3:161044596-161044618 TGCCCTACAAGAGCTCCTGAAGG + Intronic
969005604 4:4017703-4017725 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
969400031 4:6948523-6948545 TGCCCACCATGGTGTTCTCACGG + Intronic
969586702 4:8098016-8098038 TGACCAGCAAGTTGTCCTGAGGG - Intronic
969747270 4:9082503-9082525 TGCCCTGCAAGAGCTCCTGAAGG + Intergenic
969807379 4:9619877-9619899 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
970163939 4:13216343-13216365 TGCCCTCAAAGTTGTCATGGGGG + Intergenic
970917656 4:21354123-21354145 TGCCCTACAAGACCTCCTGAAGG + Intronic
970928556 4:21482478-21482500 TGCCCTACAAGAGCTCCTGAAGG - Intronic
970972329 4:21998602-21998624 TGCCCTCAAAGAGCTCCTGAAGG + Intergenic
970985170 4:22148264-22148286 TGCCCTCAAAGAGCTCCTGAAGG + Intergenic
971388956 4:26168239-26168261 TGCCCTACAAGAGCTCCTGAAGG - Intronic
971441892 4:26695833-26695855 TGCCCTACAAGAGCTCCTGAAGG + Intronic
971621139 4:28855672-28855694 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
972196363 4:36658001-36658023 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
972739539 4:41877470-41877492 TGCTCTCCAAGGCGTCCTCTAGG - Intergenic
973845998 4:54913982-54914004 TGCCCTTGAAGGCGTCCTGGTGG + Intergenic
973883737 4:55299103-55299125 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
973923153 4:55709615-55709637 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
973935669 4:55843705-55843727 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
974287980 4:59893929-59893951 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
974350304 4:60735918-60735940 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
974427392 4:61758846-61758868 TGCCCTACAAGAGCTCCTGAAGG - Intronic
974612907 4:64239826-64239848 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
975203444 4:71617778-71617800 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
975291363 4:72681220-72681242 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
975483976 4:74914366-74914388 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
975535546 4:75446703-75446725 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
975887228 4:78980611-78980633 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
976026105 4:80689517-80689539 TGCCCTACAAGAGCTCCTGAAGG + Intronic
976143868 4:82021527-82021549 TGCCCTACAAGAGCTCCTGAAGG + Intronic
976170707 4:82301710-82301732 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
976289226 4:83399861-83399883 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
976352345 4:84074332-84074354 TGCCCTCAAAGAGCTCCTGAAGG + Intergenic
976372068 4:84300617-84300639 TGCCCTCAAAGAGCTCCTGAAGG + Intergenic
976375785 4:84343128-84343150 TCCCTTACAAGGTCTCCTGAAGG + Intergenic
976792986 4:88900622-88900644 TGCCTTGCAAGAGGTCCTGAAGG + Intronic
976837439 4:89391169-89391191 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
977171475 4:93767945-93767967 TGGCCTCCCAGGGGTCATGAAGG - Intronic
977185447 4:93930972-93930994 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
977218649 4:94313304-94313326 TGCCCTACAAGAGCTCCTGAAGG - Intronic
977343864 4:95793333-95793355 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
977455879 4:97258975-97258997 TGCCCTACAAGAACTCCTGAAGG - Intronic
977480092 4:97564600-97564622 TGCCCTAAAAGAGGTCCTGAAGG - Intronic
977508815 4:97936544-97936566 TGCCTTGCAAGATCTCCTGAAGG - Intronic
977699395 4:100004696-100004718 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
977953923 4:103004910-103004932 TGCCTTACAAGAGGTCCTGAAGG + Intronic
977973881 4:103242249-103242271 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
978186501 4:105862078-105862100 TGCCCTACAAGAGCTCCTGAAGG + Intronic
978188172 4:105882124-105882146 TGCCCTACAAGAGCTCCTGAAGG + Intronic
978196954 4:105983226-105983248 TGCCCTACAAGAGCTCCTGAAGG - Intronic
978231543 4:106406617-106406639 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
978243024 4:106539278-106539300 TGCCCTTCAAGAGGTCCTAAAGG - Intergenic
978245022 4:106562258-106562280 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
978257862 4:106714085-106714107 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
978904348 4:113987985-113988007 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
979299010 4:119066071-119066093 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
979299973 4:119075601-119075623 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
979310698 4:119199637-119199659 TGCCCTACAAGAGCTCCTGAAGG + Intronic
979344909 4:119575661-119575683 TGCCCTACAAGACCTCCTGAAGG + Intronic
979445145 4:120803678-120803700 TGCCCTACAAGAGCTCCTGAAGG + Intronic
979462508 4:121000187-121000209 TGCCCTACAAGAACTCCTGAAGG - Intergenic
979589641 4:122464014-122464036 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
979592370 4:122494878-122494900 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
979599594 4:122573351-122573373 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
979671693 4:123366350-123366372 TGCCATTGAAGGTGACCTGAGGG - Intergenic
979912096 4:126380523-126380545 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
980195930 4:129589190-129589212 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
980217813 4:129874906-129874928 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
980319893 4:131257543-131257565 TACCCTCCTTGGTTTCCTGAAGG + Intergenic
980413905 4:132459743-132459765 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
981050292 4:140303197-140303219 TGCCATCCAAGATGTACTGCTGG - Intronic
981060176 4:140415175-140415197 TGCCCTACAAGAGCTCCTGAAGG + Intronic
981149624 4:141366552-141366574 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
981151087 4:141379742-141379764 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
981345768 4:143674366-143674388 TGCCCTACAAGAGCTCCTGAAGG + Intronic
981560766 4:146046430-146046452 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
981629922 4:146806209-146806231 TGCCCTACAAGAGCTCCTGAAGG + Intronic
981984542 4:150837958-150837980 TGCCCTACAAGAGCTCCTGAAGG - Intronic
982405872 4:155019941-155019963 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
983364461 4:166768354-166768376 TGCCCTACAAGAGCTCCTGAAGG - Intronic
984015036 4:174416062-174416084 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
984063635 4:175021574-175021596 TGCCCTAAAAGGGCTCCTGAAGG + Intergenic
984345312 4:178515079-178515101 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
986581867 5:9273814-9273836 TGCCCTACAAGAGCTCCTGAAGG + Intronic
986689832 5:10305204-10305226 TGGCCACCAGGGTGTCCTGCAGG - Intronic
987310721 5:16678865-16678887 GGCCCTCCAAGCAGTCCTGCAGG - Intronic
987528001 5:19078846-19078868 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
987957061 5:24753954-24753976 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
987980787 5:25081825-25081847 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
987983462 5:25117903-25117925 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
988086199 5:26477880-26477902 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
988618429 5:32796983-32797005 TGCCTTCCAAGAGTTCCTGAAGG + Intergenic
988638570 5:33015637-33015659 TGCACTCCAATGTATCCTGAGGG + Intergenic
989072371 5:37524455-37524477 TGCCCTACAAGAGCTCCTGAAGG + Intronic
989370929 5:40707004-40707026 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
989449333 5:41568702-41568724 TGCCTTACAAGATCTCCTGAAGG - Intergenic
989523305 5:42425007-42425029 TCCCTTCCAAGGTCTCCTGGCGG - Intronic
989544942 5:42661579-42661601 TGCCCTACAAGAGCTCCTGAAGG + Intronic
989684049 5:44064051-44064073 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
989725399 5:44580763-44580785 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
989733052 5:44670340-44670362 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
989966263 5:50469448-50469470 TGCCCTACAAGAGCTCCTGAGGG - Intergenic
990084158 5:51953704-51953726 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
990653144 5:57924817-57924839 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
990940524 5:61198985-61199007 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
991199819 5:63979050-63979072 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
991226884 5:64284021-64284043 TACCTTACAAGATGTCCTGAAGG - Intronic
991242535 5:64476032-64476054 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
991280589 5:64909050-64909072 TGCCCTACAAGAGTTCCTGAAGG - Intronic
991535432 5:67665001-67665023 TGCCCTACAAGAACTCCTGAAGG - Intergenic
991545991 5:67781981-67782003 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
991576037 5:68104202-68104224 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
992016405 5:72579267-72579289 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
992078077 5:73209043-73209065 TGCCTTACAAGATCTCCTGAAGG + Intergenic
992553302 5:77879899-77879921 TTCCTTCAAAGGTGGCCTGAGGG + Intergenic
992659343 5:78943444-78943466 TGCCCTGCAAGAGCTCCTGAAGG - Intronic
992700766 5:79339903-79339925 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
993163177 5:84316085-84316107 TGCCCTACAAGAGCTCCTGAAGG + Intronic
993178268 5:84516856-84516878 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
993244469 5:85433418-85433440 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
993341456 5:86730004-86730026 TGCCCTGCAAGACCTCCTGAAGG - Intergenic
993471413 5:88312170-88312192 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
993688670 5:90971676-90971698 TGCCCTACAAGGGGTCCTGAAGG + Intronic
993742438 5:91557345-91557367 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
994572391 5:101530850-101530872 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
994847202 5:105004535-105004557 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
994888550 5:105599087-105599109 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
995263950 5:110137207-110137229 TGCCTTGCAAGAGGTCCTGAGGG - Intergenic
995642787 5:114277003-114277025 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
995660643 5:114478873-114478895 TGCCTTTCAAGATCTCCTGAAGG + Intronic
996141989 5:119922757-119922779 TGCCTTACAAGGGGTCCTTAAGG - Intergenic
996147111 5:119990315-119990337 TGCCATACAAGGGCTCCTGAAGG - Intergenic
996181466 5:120425377-120425399 TGCCCTACAAGAGGTCCTGAAGG - Intergenic
996359942 5:122634954-122634976 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
997433351 5:133856794-133856816 GGCCCTCCTTGGTGTGCTGATGG - Intergenic
997861495 5:137421964-137421986 TGCCCTACAAGAGCTCCTGAAGG - Intronic
997875160 5:137539250-137539272 TGCCCTACAAGGGCTCCTGAAGG + Intronic
998421758 5:141994029-141994051 TCTCCTCCCAGGTGTCCAGAAGG - Intronic
998541781 5:142989622-142989644 TGCCCTACAAGAGCTCCTGAAGG - Intronic
998648347 5:144089857-144089879 TTCCCTCCAAAGTTTCCTGTTGG + Intergenic
998711213 5:144827512-144827534 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
998712543 5:144843244-144843266 TGCCCTTCAAGGGGTGCTGAGGG - Intergenic
999359012 5:150966087-150966109 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
999838206 5:155397398-155397420 TGCTCTTGAAGGAGTCCTGACGG + Intergenic
999963686 5:156784778-156784800 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1000144697 5:158442966-158442988 TGCCTTCCAAGAACTCCTGAAGG - Intergenic
1000144999 5:158445371-158445393 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
1000591791 5:163167017-163167039 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1000775483 5:165414510-165414532 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1001344088 5:170874994-170875016 TGCCTTCCAAGAGCTCCTGAAGG - Intronic
1001358981 5:171062326-171062348 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1001748151 5:174107869-174107891 TGCCCTTCAACGTCTTCTGATGG - Exonic
1001983534 5:176053713-176053735 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1001986909 5:176082337-176082359 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1002011255 5:176283499-176283521 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1002686008 5:181010006-181010028 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1003649605 6:7947345-7947367 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1005274402 6:24200484-24200506 TGCCTTACAAGAGGTCCTGAAGG + Intronic
1005373678 6:25160142-25160164 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1006511065 6:34521437-34521459 TGCCCTCCAGGGTCTCCTAGAGG + Intronic
1007199482 6:40094498-40094520 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1007478975 6:42137629-42137651 TGCCCTGCAGGGAGTCCTAAAGG + Intronic
1007824326 6:44588332-44588354 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1007845276 6:44749404-44749426 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1008414729 6:51226303-51226325 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1008491837 6:52095115-52095137 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1008576306 6:52863091-52863113 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1008635207 6:53404236-53404258 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
1008769676 6:54963261-54963283 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1008779921 6:55091002-55091024 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1009056337 6:58340913-58340935 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1009234845 6:61109685-61109707 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1009263118 6:61521210-61521232 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1009265909 6:61554674-61554696 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1009393439 6:63168941-63168963 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1009921071 6:70062455-70062477 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1010307462 6:74341950-74341972 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
1010310285 6:74377201-74377223 TGCCCTACAAGAGTTCCTGAAGG - Intergenic
1010692146 6:78922898-78922920 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1010695893 6:78973352-78973374 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1010821136 6:80417504-80417526 TGCCTTACAAGAAGTCCTGAAGG - Intergenic
1010869071 6:81016230-81016252 TGCCCTACAAGATCTCCTGAAGG - Intergenic
1010912835 6:81580510-81580532 TGCCCTAAAAGATCTCCTGAAGG + Intronic
1010990209 6:82471477-82471499 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1010992948 6:82500606-82500628 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1011010189 6:82694976-82694998 TCCCCTCCAAGAGGTCCTGAAGG - Intergenic
1011012448 6:82717174-82717196 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1011086322 6:83545218-83545240 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1011283299 6:85698925-85698947 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1011308600 6:85957072-85957094 TGCCCTACAAGAACTCCTGAAGG - Intergenic
1011336809 6:86270694-86270716 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1011337975 6:86282309-86282331 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1011348223 6:86394550-86394572 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1011766462 6:90625082-90625104 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1011884805 6:92080267-92080289 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1011924592 6:92626314-92626336 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1012238487 6:96845370-96845392 TGCCCTGCAAGAGGTCCTTAAGG + Intergenic
1012251359 6:96985038-96985060 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1012317350 6:97796596-97796618 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1012338209 6:98087207-98087229 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1012419199 6:99044178-99044200 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1012435069 6:99206250-99206272 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1012459908 6:99448997-99449019 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1012479984 6:99655834-99655856 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1012481717 6:99674970-99674992 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1012508221 6:99973727-99973749 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1012561290 6:100584750-100584772 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1012605792 6:101156416-101156438 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1012740022 6:103004848-103004870 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1013025250 6:106264818-106264840 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1013378076 6:109538771-109538793 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1013383605 6:109602240-109602262 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1013449070 6:110260941-110260963 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1013518002 6:110906255-110906277 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1013638568 6:112051739-112051761 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1013947763 6:115742964-115742986 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1014859946 6:126453531-126453553 TGCCTTGCAAGATGTCCTTAAGG + Intergenic
1014907297 6:127045219-127045241 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1015050267 6:128831424-128831446 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1015197569 6:130540563-130540585 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1015344867 6:132144617-132144639 TTCCTTCCAGGGTGTTCTGAAGG - Intergenic
1015677776 6:135769654-135769676 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1015890873 6:137968485-137968507 TTCCCTCAAAGGTGGCCAGAAGG + Intergenic
1016453441 6:144207870-144207892 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
1016585103 6:145675260-145675282 TGCCTTACAAGATCTCCTGAAGG + Intronic
1017020601 6:150137033-150137055 TGCCCTCCAGAGTGCCCAGAGGG - Intergenic
1017226728 6:152030116-152030138 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1017968492 6:159288712-159288734 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1018015226 6:159706092-159706114 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1019031407 6:169016823-169016845 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1020325732 7:6974151-6974173 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
1020430520 7:8112606-8112628 AGTCCTCCAAGGTGTCTTGTAGG + Intergenic
1020716244 7:11677242-11677264 TGCCTTACAAGGGCTCCTGAAGG + Intronic
1020759547 7:12251414-12251436 TGCCCTACAAGGGTTCCTGAAGG + Intergenic
1021047590 7:15942067-15942089 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1021069450 7:16218266-16218288 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1021166792 7:17352617-17352639 TGCCTTACAAGAAGTCCTGAAGG - Intergenic
1021947902 7:25745670-25745692 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1022114502 7:27250246-27250268 TGCCGCCAAAGGTGTCCAGACGG + Intergenic
1022994732 7:35743362-35743384 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1023245907 7:38203453-38203475 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1023322297 7:39011690-39011712 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1023419633 7:39965784-39965806 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1023458157 7:40364481-40364503 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1023510896 7:40952620-40952642 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1023911810 7:44561744-44561766 TCCCCTCCAAGGGTTCCTGTAGG - Intergenic
1024206037 7:47161626-47161648 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1024423388 7:49197029-49197051 TGACCTCCAAGGTGTCCATTTGG - Intergenic
1024673007 7:51613613-51613635 TGCCCTCCAAGTGCTCCCGATGG - Intergenic
1024718002 7:52102456-52102478 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1025524297 7:61785359-61785381 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1025547654 7:62197577-62197599 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1025594027 7:62901816-62901838 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1025600996 7:62997372-62997394 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1027627293 7:80562347-80562369 TGCCCTGCAAGAGCTCCTGAAGG - Intronic
1027733969 7:81908933-81908955 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1028054020 7:86221583-86221605 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1028159244 7:87466874-87466896 TGCCCTAAAAGAGGTCCTGAAGG + Intronic
1028211469 7:88079321-88079343 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1028321398 7:89464515-89464537 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1028325830 7:89523648-89523670 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1028337244 7:89673107-89673129 TGTCCTACAAGAGGTCCTGAAGG - Intergenic
1028395343 7:90363301-90363323 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1028643659 7:93071983-93072005 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1028782698 7:94755796-94755818 TGCCCTACAAGAGCTCCTGAGGG - Intergenic
1028821702 7:95219135-95219157 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1028836604 7:95381177-95381199 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1029039698 7:97559496-97559518 TGCCCTGCAAGAACTCCTGAAGG + Intergenic
1029064477 7:97835467-97835489 TGTTCTCCAAGGTGTCCCCAGGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1029521853 7:101067814-101067836 AGCCCTGCATGGTGGCCTGAGGG - Intergenic
1029734942 7:102460428-102460450 TGCCTTCCACAGTGTCCTGAGGG - Intronic
1029922339 7:104278499-104278521 TGCCCTAAAAGATCTCCTGAAGG + Intergenic
1029965299 7:104733888-104733910 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1030154637 7:106441336-106441358 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1030325634 7:108216077-108216099 TGCCTTACAAGATCTCCTGAAGG - Intronic
1030401621 7:109059004-109059026 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1030510236 7:110474179-110474201 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1030549024 7:110935163-110935185 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1030833353 7:114253959-114253981 TGCCCTACAAGGGCTCCTGAAGG - Intronic
1031157267 7:118124195-118124217 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
1031314426 7:120238996-120239018 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1031344533 7:120649782-120649804 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1031434095 7:121711631-121711653 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1031688957 7:124765218-124765240 TGCCCTCCAAGGTTCCTAGAGGG + Exonic
1031706179 7:124983630-124983652 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1031830077 7:126615349-126615371 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1031905224 7:127452922-127452944 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1032312351 7:130800482-130800504 TGCCTTACAAGGACTCCTGAAGG - Intergenic
1033371465 7:140712777-140712799 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1033541630 7:142361593-142361615 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1034039926 7:147867115-147867137 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1034078693 7:148257064-148257086 TGCACTCCCAGGTGTGCTCAGGG - Intronic
1034236753 7:149577970-149577992 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1035155964 7:156913553-156913575 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1035182958 7:157104021-157104043 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1035882051 8:3254041-3254063 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1036649895 8:10635425-10635447 TGCTCTCCCAGGTGTCCTGAAGG + Intronic
1037082620 8:14805054-14805076 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1037641176 8:20744632-20744654 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG + Intronic
1037918176 8:22785427-22785449 TGTCCTCCAATGTGTCCTCTCGG + Intronic
1037999317 8:23378106-23378128 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1038031819 8:23649360-23649382 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1038107485 8:24452817-24452839 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1038116421 8:24560662-24560684 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1038140684 8:24841534-24841556 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1038243131 8:25829337-25829359 TGCCCTGCAAGAGCTCCTGAAGG - Intergenic
1038377946 8:27062010-27062032 TGCCCTACAAGACCTCCTGAAGG - Intergenic
1038655910 8:29451165-29451187 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1038846524 8:31235431-31235453 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1038877488 8:31567324-31567346 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1038990433 8:32861367-32861389 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1040137058 8:43866899-43866921 TGCCCTACAAGAGCTCCTGATGG - Intergenic
1040390319 8:46944119-46944141 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1040403589 8:47077473-47077495 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1040473238 8:47753936-47753958 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1040910032 8:52508433-52508455 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1040962258 8:53047315-53047337 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1041027188 8:53699323-53699345 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1041035415 8:53784704-53784726 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1041051020 8:53934083-53934105 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1041213185 8:55573219-55573241 TGCCTTACAAGATCTCCTGAAGG + Intergenic
1041404691 8:57485008-57485030 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
1042070611 8:64929597-64929619 TGCCTTCCAAGAACTCCTGAAGG - Intergenic
1042332349 8:67594050-67594072 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1042348806 8:67755201-67755223 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1042394697 8:68278260-68278282 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1042410667 8:68461766-68461788 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1042423273 8:68617451-68617473 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1042434295 8:68745209-68745231 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1042597337 8:70464218-70464240 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1042629607 8:70802644-70802666 TGCCTTACAATGTGTCCTTAAGG - Intergenic
1042687081 8:71453745-71453767 TGCCCTACAAGCGCTCCTGAAGG + Intronic
1042720544 8:71822221-71822243 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1042763233 8:72293003-72293025 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1042766058 8:72322978-72323000 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1042773842 8:72407137-72407159 TGCCTTGCAAGGACTCCTGAAGG + Intergenic
1043131647 8:76470544-76470566 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1043200669 8:77365520-77365542 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1043272560 8:78352469-78352491 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1043748708 8:83908645-83908667 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1043911743 8:85872442-85872464 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1044156843 8:88858795-88858817 TGCCCTACAAGAGGTCCTGAAGG - Intergenic
1044221402 8:89674097-89674119 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
1044272755 8:90266069-90266091 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1044282952 8:90377392-90377414 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1044455147 8:92384844-92384866 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1044767476 8:95592183-95592205 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1044811983 8:96072377-96072399 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1045709102 8:104962861-104962883 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1045788889 8:105957625-105957647 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1046122225 8:109860588-109860610 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1046709047 8:117488637-117488659 TACCTTGCAAGATGTCCTGAAGG + Intergenic
1047046079 8:121054857-121054879 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1048466592 8:134669577-134669599 TGCCCTACAAGACCTCCTGAAGG + Intronic
1048467253 8:134675919-134675941 TGCCCTACAAGACCTCCTGAAGG + Intronic
1048713634 8:137242342-137242364 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1049074581 8:140384136-140384158 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1049899183 9:141516-141538 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1049907658 9:234063-234085 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1050065154 9:1751503-1751525 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1050075695 9:1860974-1860996 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1050083020 9:1935227-1935249 TGCCCTACAAGACCTCCTGAAGG - Intergenic
1050387188 9:5102869-5102891 TGCCTTACAAGATCTCCTGAAGG + Intronic
1050774388 9:9242011-9242033 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1050887148 9:10780242-10780264 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1050956630 9:11669423-11669445 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1050973708 9:11910574-11910596 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1051205267 9:14682015-14682037 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1051240597 9:15051418-15051440 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1051299218 9:15630002-15630024 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
1051312618 9:15792798-15792820 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
1051314963 9:15819168-15819190 TGCCCTGCAAGAGCTCCTGAAGG + Intronic
1051452602 9:17214221-17214243 TGCCCTACAAGACCTCCTGAAGG - Intronic
1051595547 9:18821363-18821385 TGCCTTCCAAGGTCTCCATAGGG + Intronic
1051801811 9:20943385-20943407 TGCCCTTCATGGTGCCATGATGG - Intronic
1051830955 9:21275865-21275887 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1051878751 9:21818276-21818298 TGCCCTCCCAGTTGCCCTGCCGG - Intronic
1051917363 9:22224496-22224518 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1051941130 9:22507030-22507052 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1052009980 9:23396168-23396190 TGCCCTAAAAGATCTCCTGAAGG + Intergenic
1052115276 9:24642916-24642938 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1052145521 9:25044132-25044154 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1052150060 9:25103961-25103983 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1052373558 9:27692356-27692378 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1052441028 9:28496825-28496847 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1052451767 9:28639987-28640009 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1052499606 9:29272165-29272187 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1052513645 9:29452546-29452568 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1052632543 9:31060235-31060257 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1052645449 9:31228678-31228700 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1053088429 9:35249522-35249544 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1054846982 9:69808439-69808461 AGGCCTCCAAGGTCTCCTGACGG + Intergenic
1054884721 9:70184047-70184069 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1054890172 9:70242273-70242295 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1055338506 9:75257862-75257884 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1055346435 9:75344739-75344761 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1055390738 9:75819916-75819938 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
1055616365 9:78076927-78076949 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1056003319 9:82241170-82241192 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1056399556 9:86213318-86213340 GGCCCTTCAAGTTGTCATGAAGG + Intergenic
1056660475 9:88539409-88539431 AGCCCTCCAAGGAGTCCTCATGG + Intronic
1057031113 9:91775767-91775789 TGCCCATCAAGGGGTCCTAAAGG + Exonic
1057175750 9:92997640-92997662 TGCCTTACAAGAGGTCCTGAAGG - Intronic
1057342883 9:94218707-94218729 TGCCTTACAAGGGCTCCTGAAGG + Intergenic
1057513373 9:95699415-95699437 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1057965689 9:99500577-99500599 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1058192808 9:101939572-101939594 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1058208068 9:102132776-102132798 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1058211248 9:102172856-102172878 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1058244387 9:102604512-102604534 TGCCTTACAAGATATCCTGAAGG - Intergenic
1058338213 9:103860369-103860391 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1058480672 9:105391140-105391162 GTCCCTCCAAAGTGACCTGATGG + Exonic
1059616852 9:115960993-115961015 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1059675530 9:116535522-116535544 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1059913052 9:119067584-119067606 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1060615821 9:125012006-125012028 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1060865748 9:126995005-126995027 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1061019402 9:128004346-128004368 TGCCTTCCAAGGAGTTCTCAGGG - Intergenic
1061678106 9:132229619-132229641 TGCACCCCGAGGTGTCCTCAGGG + Intronic
1061839817 9:133352109-133352131 TGCCCTCCAATGGGTCCTCCAGG + Exonic
1061887709 9:133601011-133601033 GGCCCTCCCAGGGGTCCTCATGG - Intergenic
1062709164 9:137963860-137963882 TGCCCTACAAGGGGTCCTAATGG - Intronic
1203517996 Un_GL000213v1:21720-21742 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1203758057 Un_GL000218v1:154554-154576 TGCCCTAAAAGATCTCCTGAAGG - Intergenic
1186736735 X:12473289-12473311 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1186775659 X:12862462-12862484 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1186913176 X:14191930-14191952 TGCCTTGCAAGGGCTCCTGAAGG - Intergenic
1187857317 X:23649863-23649885 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1188044661 X:25412168-25412190 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1188119334 X:26285468-26285490 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1188238852 X:27760517-27760539 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1188289072 X:28366249-28366271 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1188803899 X:34563421-34563443 TGCCCTGCAAAGTCTCCTGTGGG - Intergenic
1189098570 X:38165124-38165146 GGCCTTGCAAGGTGTCCTGTGGG + Intronic
1189303637 X:39970551-39970573 TGCACGCCAAGGTGGCCTGCTGG + Intergenic
1189525022 X:41810559-41810581 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1190602182 X:52104743-52104765 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1190903293 X:54699455-54699477 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1190941967 X:55050975-55050997 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1190965950 X:55301820-55301842 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1191037511 X:56042981-56043003 TGCCTTGCAAGAGGTCCTGAAGG - Intergenic
1191070156 X:56392646-56392668 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1191138168 X:57089165-57089187 TGCCCTACAAGACTTCCTGAAGG - Intergenic
1191153450 X:57244704-57244726 TGCCTTCCAAGAACTCCTGAAGG + Intergenic
1191180622 X:57559328-57559350 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1191194942 X:57710489-57710511 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1191196499 X:57729545-57729567 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1191209023 X:57865122-57865144 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1191273647 X:58512330-58512352 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1191588999 X:62860044-62860066 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1191644369 X:63464471-63464493 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1191726316 X:64284799-64284821 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1191727866 X:64300743-64300765 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1191733661 X:64365585-64365607 TGCCTTACAAGGGCTCCTGAAGG + Intronic
1191744886 X:64476117-64476139 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1191779363 X:64849371-64849393 TGCCCTAAGAGGTGACCTGAGGG - Intergenic
1191800258 X:65071617-65071639 TGCCTTCCAAGAGCTCCTGAAGG - Intergenic
1191949739 X:66575655-66575677 TGCCCTACAAGAACTCCTGAAGG + Intergenic
1191969004 X:66793206-66793228 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1192029155 X:67490318-67490340 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1192041816 X:67630806-67630828 TGCCCTAAAAGAGGTCCTGAAGG - Intronic
1192064079 X:67862899-67862921 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1192701576 X:73480481-73480503 TGCCTTACAAGATCTCCTGAAGG - Intergenic
1192922140 X:75718281-75718303 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1192931254 X:75808969-75808991 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1192973595 X:76259523-76259545 TGCCCTACAAGAGATCCTGAAGG - Intergenic
1193029456 X:76881978-76882000 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1193067827 X:77278090-77278112 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1193088888 X:77472591-77472613 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1193094323 X:77529633-77529655 TGCCTTGCAAGAGGTCCTGAAGG + Intronic
1193174156 X:78372498-78372520 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1193244194 X:79209862-79209884 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1193360693 X:80575167-80575189 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1193391892 X:80938522-80938544 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1193395639 X:80980945-80980967 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1193402044 X:81056700-81056722 TGCCCTACAAGAGGTCCTTAAGG + Intergenic
1193465527 X:81842991-81843013 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1193544197 X:82806960-82806982 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1193553060 X:82923103-82923125 TGCCTTACAAGGGGTCCTTAAGG - Intergenic
1193687363 X:84593459-84593481 TGCCTTCCAAGAGCTCCTGAAGG + Intergenic
1194060844 X:89195862-89195884 TGCCTTGCAAGAGGTCCTGAAGG + Intergenic
1194370235 X:93062142-93062164 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1194417292 X:93629294-93629316 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1194498609 X:94651857-94651879 TGCCCTTCAACGTTTGCTGAGGG - Intergenic
1194907681 X:99598156-99598178 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1194924415 X:99807158-99807180 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1195117547 X:101715246-101715268 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1195214922 X:102690047-102690069 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1195232800 X:102868348-102868370 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1195233516 X:102875345-102875367 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1195337408 X:103869213-103869235 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1195339805 X:103895678-103895700 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1195354960 X:104031043-104031065 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1195587053 X:106577309-106577331 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1195659798 X:107366176-107366198 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1195736039 X:108013369-108013391 TGCCCTACAAGAGATCCTGAAGG + Intergenic
1195764247 X:108278967-108278989 TGCCCTACAAGAGATCCTGAAGG + Intronic
1195808560 X:108802800-108802822 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1195826958 X:109012344-109012366 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1196230010 X:113210693-113210715 TGCCTTACAAGGGCTCCTGAAGG - Intergenic
1196244889 X:113389577-113389599 TGCCTTACAAGAGGTCCTGAAGG - Intergenic
1196252763 X:113481230-113481252 TGCCCTACAAGAGATCCTGAAGG + Intergenic
1196561420 X:117153644-117153666 TGCCTTACAAGAGGTCCTGAAGG + Intergenic
1197667886 X:129242811-129242833 TGCCCTACAAGAGTTCCTGAAGG + Intergenic
1197983949 X:132248193-132248215 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1198067398 X:133112339-133112361 TGCCCTAAAAGGGCTCCTGAAGG + Intergenic
1198544259 X:137674069-137674091 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1198646019 X:138807418-138807440 TGCCCTACAAGAGCTCCTGAAGG + Intronic
1199378967 X:147146177-147146199 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1199468527 X:148167639-148167661 TGCCCTACAAGAGCTCCTGAGGG + Intergenic
1199469617 X:148180206-148180228 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1199481541 X:148303891-148303913 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1199484065 X:148329627-148329649 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1199486188 X:148351073-148351095 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1200011217 X:153122506-153122528 TGCCTTGCAAGATGTCCAGAAGG + Intergenic
1200028382 X:153277416-153277438 TGCCTTGCAAGATGTCCAGAAGG - Intergenic
1200288353 X:154846950-154846972 TGCCCTACAAGAGCTCCTGAAGG - Intronic
1200336454 X:155355672-155355694 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1200350016 X:155485555-155485577 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1200388290 X:155916522-155916544 TGCCTTACAAGAGGTCCTGAAGG - Intronic
1201285936 Y:12378709-12378731 TCCTCTCCATGGTTTCCTGAAGG - Intergenic
1201394562 Y:13534999-13535021 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201409345 Y:13682782-13682804 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1201533153 Y:15014634-15014656 TGCCCTACAAGAGCTCCTGATGG + Intergenic
1201582952 Y:15530434-15530456 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201588580 Y:15589152-15589174 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1201619905 Y:15945131-15945153 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201775999 Y:17666727-17666749 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201778620 Y:17694239-17694261 TGCCCTAAAAGAGGTCCTGAAGG - Intergenic
1201795431 Y:17891499-17891521 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1201795969 Y:17896607-17896629 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1201805586 Y:18009378-18009400 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201806125 Y:18014486-18014508 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201822936 Y:18211753-18211775 TGCCCTAAAAGAGGTCCTGAAGG + Intergenic
1201825557 Y:18239265-18239287 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1201920734 Y:19230988-19231010 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1201961750 Y:19688777-19688799 TGCCCTACAAGATCTCCAGAAGG - Intergenic
1202058017 Y:20856224-20856246 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202170954 Y:22042885-22042907 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1202220408 Y:22543488-22543510 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202241690 Y:22777452-22777474 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202322705 Y:23652175-23652197 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1202333444 Y:23779721-23779743 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202356859 Y:24060577-24060599 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1202357381 Y:24065672-24065694 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1202394673 Y:24411196-24411218 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202476111 Y:25258896-25258918 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1202513396 Y:25604442-25604464 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202513918 Y:25609537-25609559 TGCCCTACAAGAGCTCCTGAAGG - Intergenic
1202537325 Y:25890342-25890364 TGCCCTACAAGAGCTCCTGAAGG + Intergenic
1202548068 Y:26017881-26017903 TGCCCTACAAGAGCTCCTGAAGG - Intergenic